ADH5 K113 Lactylation is Associated with Enhanced Glycolysis and Bladder Epithelial Cell Proliferation in Cystitis Glandularis

Abstract

Background

Cystitis glandularis (CG) is a common inflammatory proliferative disease of the bladder urothelial epithelium. Histologically, it is marked by Brunn ‘s nest formation and adenoid metaplasia. At present, the molecular mechanism of CG development is not yet clear, and the key signaling pathways regulating the abnormal proliferation of bladder epithelial cells remain to be explored. Lactate, a byproduct of anaerobic glycolysis, serves as a substrate for lactylation, a recently identified post-translational modification, which has been proved to play a regulatory role in inflammatory response and cell proliferation. However, whether this modification occurs in CG bladder epithelial cells and its potential role are still unknown.

Methods

Rat CG model induced by lipopolysaccharide (LPS) and SV-HUC-1 human bladder epithelial cell line treated with LPS were used. Lactic acid detection kits were used to evaluate the lactate content in cells, animal tissues and human serum, and the glycolytic ATP yield, oxygen consumption rate and extracellular acidification rate were detected by Seahorse analyzer. Quantitative lactylation omics was used to screen differentially lactylated proteins and sites in bladder epithelial cells of CG rats. Pan-lysine lactylation (Pan Kla) and ADH5-K113 lactate levels were detected by Western blot. The mRNA and protein expressions of PKM2 and LDHA were detected by qPCR and Western blot. The expression of PKM2, LDHA in rat bladder was detected by immunofluorescence. Cell proliferation activity was measured by CCK-8 kit, and cell migration function was evaluated by scratch test. HE staining was used to observe the formation of Brunn ‘s nest in rat bladder.

Results

Lactate levels in CG rats and LPS-treated SV-HUC-1 cells were significantly increased, glycolytic ATP production rate and extracellular acidification rate were increased, and glycolysis was enhanced. In vitro and in vivo experiments confirmed that the mRNA and protein levels of PKM2 and LDHA were up-regulated. Omics analysis further revealed that there were extensive differential lactylation in the glycolytic pathway, among which the up-regulation of alcohol dehydrogenase 5 lysine 113 lactylation (ADH5-K113la) was the most significant (log2FC = 2.463, FC = 5.52, P = 0.000101). The levels of pan-lysine lactylation and ADH5-K113 lactylation in CG were significantly increased. CCK-8 and scratch experiments confirmed that LPS treatment promoted the proliferation and migration of SV-HUC-1 cells. HE staining showed that the number of Brunn nests in the bladder of CG rats increased.

Conclusion

Lactate accumulation and glycolysis are enhanced in CG, and the level of ADH5-K113 lactylation is significantly up-regulated, which is related to the increase of PKM2, LDHA expression and cell proliferation, suggesting that ADH5-K113 lactylation is associated with enhanced glycolysis and proliferation in CG, suggesting its potential involvement in CG pathogenesis.

Introduction

Cystitis glandularis (CG) is a chronic and metaplastic proliferative lesion of the urinary epithelium of the bladder. The pathological features include Brunn ‘s nest formation and adenoid metaplasia.^1,2 Recently, due to the wide use of cystoscopy, the detection rate of CG has increased greatly, and the actual incidence may not be equal to the current statistics.³ The symptoms encountered are mostly repeated stimulation of the lower urinary tract or hematuria.⁴ As far as CG is concerned, there is no unified treatment opinion in the academic community at present: some people regard it as a precancerous condition and recommend surgery to deal with it;⁵ the expert consensus also pointed out that CG is not necessarily malignant, and excessive treatment will damage the patient ‘s body and mind.^6,7 This divergence actually stems from the lack of understanding of the molecular pathological mechanism of CG. From the current data, the discussion of CG molecular pathology is still insufficient, and the molecular pathways that drive Brunn ‘s nest and epithelial hyperplasia have yet to be elucidated. It has been mentioned in the literature that glycolysis promotion and lactate accumulation are of great significance in various inflammatory hyperplasia.^8,9 Therefore, it is speculated that whether abnormal glycolysis and lactate accumulation also play a role in the pathogenesis of CG should be further analyzed.

For a long time, lactylation has been defined as the terminal metabolic by-product of the glycolysis pathway. This traditional understanding has been fully updated in recent years. Existing studies have confirmed that lactylation can be covalently bound to lysine residues of proteins to form lactylation, so as to achieve direct regulation of the biological functions of histones and non-histones.¹⁰ At present, a number of studies have shown that lactylation is widely involved in the regulation of inflammatory response and cell proliferation. In macrophages, the lactylation of histone H3K18 site can initiate the transcriptional expression of genes related to repair function;¹⁰ the lactylated H4K12 site in microglia can form a two-way regulatory loop with PKM2, mediate the transformation of cell pro-inflammatory phenotype and participate in the development of cognitive impairment;¹¹ in addition, studies in sepsis models have also confirmed that lactylated modification of HMGB1 can further enhance the level of inflammatory response in macrophages.¹² In addition to the regulation of inflammation, non-histone lactylation has also been shown to directly regulate the catalytic activity of metabolic enzymes. For example, LDHA can increase its own enzyme activity after lactylation, which in turn mediates the resistance of lung adenocarcinoma cells to cisplatin.¹³ Lactylation of NAT10 can reshape the metabolic phenotype of host cells by regulating the acetylation level of tRNA.¹⁴ Based on the above research results, it is not difficult to find that lactylation plays a key role between glucose metabolism reprogramming and cell function regulation.

However, the situation of lactylation in bladder epithelial cells, especially in CG, has not been reported. Its earliest known function is the metabolic enzymes of formaldehyde and S-nitrosoglutathione, which play a role in maintaining intracellular redox balance.^15,16 Subsequent studies have found that ADH5 is also involved in the regulation of cell proliferation and epithelial-mesenchymal transition in tumors such as non-small cell lung cancer,¹⁷ but its function of lactylation is still unclear. In order to explore this problem, we previously screened the bladder epithelial cells of CG model rats by quantitative lactylation omics and found that there were differential lactylation in multiple metabolic enzymes in the glycolytic pathway, among which the up-regulation of ADH5 lysine 113 lactate (ADH5-K113la) was the most significant. Bioinformatics analysis and preliminary experiments suggest that ADH5-K113 lactylation may be associated with increased expression of PKM2 and LDHA. Therefore, the purpose of this study was to clarify the changes of ADH5-K113 lactylation in CG, and to explore its relationship with PKM2, LDHA and cell proliferation.

Materials and Methods

Cell Culture

The immortalized human bladder epithelial cell line SV-HUC-1 (Procell, CL-0222) was cultured in F-12K medium (Procell) containing 10% fetal bovine serum (Sigma) and placed in a 5% CO2 incubator at 37°C. The medium was changed every other day, and passaged at a ratio of 1: 3 every 4–5 days. When the cells were fused to 70% −80%, they were collected for experiments. In order to construct CG cell model, cells were treated with serum-free F-12 K medium containing LPS (20 μg / mL) (MCE, HY-D1056) for 24 h, and the control group was cultured with the same amount of serum-free F-12 K medium for the same time.

The concentration of LPS (20 μg/mL) and the treatment duration (24 h) were selected based on previous studies on LPS-induced bladder epithelial injury and our pilot experiments.^18,19 This condition induced a stable inflammatory and glycolytic phenotype without marked cytotoxicity. The establishment of the LPS-induced cell model was confirmed by increased lactate production, enhanced glycolytic ATP production, and elevated ECAR, as described in the Results.

Cell Viability

The cell proliferation ability was detected by CCK-8 method (Biosharp). SV-HUC-1 cells in logarithmic growth phase were inoculated in 96-well culture plates at a density of 1×10 cells per well. After incubation in the incubator until the confluence reached 80%, the cells were grouped and treated as described in 2.1. After 24 and 48 hours, the medium was discarded, and 100 μL of 10% CCK-8 solution was added to each well. The plates were then incubated at 37°C in 5% CO2 for 2 hours. The optical density (OD) values of each hole at 450 nm wavelength were read by a microplate reader (Bio-Rad). Cell viability was calculated according to the following formula: cell viability (%) = (OD experimental group − OD blank group)/(OD control group − OD blank group) × 100%.

Lactic Acid Analysis

Frozen rat bladder tissue or cell samples were homogenized with PBS on ice. The homogenate was centrifuged at 4°C, 12,000×g for 15 minutes, and the supernatant was collected. Whole blood samples were allowed to clot at room temperature for 45 minutes, followed by centrifugation at 2,000 × g for 10 minutes at 4°C to collect serum. Samples were processed immediately to minimize ex vivo lactate production. The upper light yellow serum was carefully drawn for subsequent detection. The content of lactic acid in the supernatant was determined by L-lactic acid detection kit (Beyotime, S0208S), and the specific operation strictly followed the product instructions.

Clinical serum samples were collected with written informed consent from all participants, and the study was approved by the Ethics Committee of the Second Affiliated Hospital of Guilin Medical University (Approval No. EFY-GZR2024012). This study was conducted in accordance with the Declaration of Helsinki.

Quantitative Lactylation Omics Analysis

Quantitative lactylation omics analysis was performed by Cosmos Wisdom (Hangzhou, China). The brief steps are as follows: The bladder tissues of rats in the control group and the CG group were taken, ground into powder in liquid nitrogen, added to 8 M urea lysis solution for ultrasonic lysis, and the protein concentration was determined by BCA method. The equal amount of protein was precipitated by TCA, washed with acetone, redissolved with TEAB, and digested with trypsin at 37°C overnight. After the enzymatic peptides were reduced by DTT, alkylated by IAA, and desalted, affinity enrichment was performed using anti-lactylated lysine antibody beads. The enriched peptides were desalted by C18 column and then separated by gradient elution on Vanquish Neo liquid chromatography system. The separated peptides were collected DIA mode data by Orbitrap Astral high resolution mass spectrometer. The DIA-NN software was used to complete the database retrieval of the original data. The retrieval settings were as follows: trypsin digestion, allowing up to 1 missing cutting site; the fixed modification was set as Carbamidomethyl (C); the variable modification was set to Lactylation (K); the false positive rate of protein level was controlled within 1%. Bioinformatics analysis included GO annotation, KEGG pathway annotation, and subcellular localization analysis. The GO and KEGG enrichment analysis of differentially lactylated proteins was performed using Fisher ‘s exact test, and P < 0.05 was significant enrichment. The data analysis and mapping of omics were completed through the corresponding bioinformatics platform. Differentially lactylated proteins were identified using a fold change threshold of |log₂FC| > 1 and P < 0.05 (Student’s t-test). Genes encoding differentially lactylated proteins were mapped to KEGG pathways and GO terms using the DAVID database. Only terms with P < 0.05 (Fisher’s exact test) were considered significantly enriched.

Western Blot (WB)

Cells and rat bladder tissues were collected and lysed using a radioimmunoprecipitation assay (RIPA, Beyotime) lysis buffer supplemented with 1% benzylsulfonyl fluoride (Beyotime). The protein concentration of each sample was determined by BCA protein quantification kit (Beyotime). The same amount of protein lysate was separated by 10% SDS-PAGE gel electrophoresis, and then wet transferred to 0.45μm PVDF membrane (Millipore). The membrane was blocked with 5% skimmed milk diluted in Tris buffered saline containing Tween-20 (TBST) for 2 hours and incubated with primary antibody at 4 ° C overnight. Primary antibodies included Anti-PKM2 (1: 1000, Proteintech, 60268-1-Ig), Anti-LDHA (1: 1000, Proteintech, 19987-1-AP), Anti-ADH5 (1: 1000, Proteintech, 16379-1-AP), Anti-Pan Kla (Jingjie, PTM-1401RM), Anti-Lactyl-ADH5 (K113) (1: 500, KeyaBiotech, PABDZ010-P1, customized); anti-β-Actin (1: 1000, Proteintech, 81115-1-RR), Anti-β-Tubulin (1: 1000, Proteintech, 10094-1-AP). The secondary antibodies were HRP-labeled goat anti-rabbit IgG (H + L) (1: 1000, Beyotime, A0208) and HRP-labeled goat anti-mouse IgG (H + L) (1: 1000, Beyotime, A0216). The PVDF membrane was incubated at room temperature for 1 hour, and the protein bands were observed using an enhanced chemiluminescence (ECL) kit (Epizyme). Bio-Rad chemiluminescence imaging system (Bio-Rad, USA) was used to collect images, and the gray value of protein bands was analyzed and quantified by ImageJ software. For Pan Kla, the signal was widely distributed rather than a single band due to the detection of per-lactate modified proteins. The total gray value of the entire lane within the selected molecular weight range was used for quantification, and β-tubulin was used as an internal reference for standardization. All Western blot experiments used a three-color pre-stained protein Marker (10–250 kDa, Epizyme, WJ103) as a molecular weight marker.

Real-Time Fluorescent Quantitative PCR (RT-qPCR)

Total RNA was extracted from SV-HUC-1 cells and rat bladder tissues using the SPARKeasy tissue / cell RNA rapid extraction kit (SparkJade, AC0202), and the operation was performed according to the instructions. RNA was reverse transcribed into cDNA using the ToloScript All-in-one RT EasyMix for qPCR (TOLOBIO, # 22107) cDNA transcription kit, and RT-qPCR was performed using 2 × Q3 SYBR qPCR Master Mix (Universal) (TOLOBIO, # 22204). The relative expression level of the target gene was calculated by 2ΔΔCt method with β-actin as the internal reference gene. The primer sequences used in this study are listed in Table 1.

Table 1.

Primer Sequences for RT-qPCR

Gene	Forward (5′→3′)	Reverse (5′→3′)
PKM2	TGAAGTACGCCCGAGGATCT	GATGATCCCAGTGTTGCGGG
LDHA	CCTCTGGGGAATCCAGAAGGA	TCAACACAACTGGACCAACCAC
β-actin	GTGCTATGTTGCTCTAGACTTCG	ATGCCACAGGATTCCATACC

Immunofluorescence (IF)

The paraffin sections of rat bladder were treated with environmentally friendly dewaxing solution for 3 times (10 minutes each time), dehydrated with anhydrous ethanol for 3 times (5 minutes each time), and rinsed with distilled water. The sections were immersed in EDTA antigen repair solution (pH 8.0) and heated in the microwave oven according to the following procedure: medium fire for 8 minutes → cease fire for 8 minutes → medium and low fire for 7 minutes. After the repair was completed, it was naturally cooled to room temperature and washed with PBS (pH 7.4) for 3 times (5 minutes/time). The excess liquid was removed, and the circle was drawn along the periphery of the tissue with a histochemical pen. The BSA blocking solution was added dropwise in the circle and placed at room temperature for 30 minutes. The blocking solution was poured out and the primary antibody diluted with PBS (Anti-PKM2, 1:350, Proteintech, 60268-1-Ig; anti-LDHA, 1:100, Proteintech, 19987-1-AP), sliced and placed in a wet box at 4°C overnight.

On the next day, the sections were rinsed with PBS three times (5 minutes/time), and the corresponding species of fluorescent secondary antibody (goat anti-mouse IgG, 1:500, Proteintech, RGAM004; goat anti-rabbit IgG, 1:500, Proteintech, RGAR002) was incubated at room temperature in the dark for 50 minutes. After washing with PBS, DAPI working solution was added to the tissue and incubated in darkness for 10 minutes to mark the nucleus. Subsequently, the autofluorescence quencher was added dropwise for 5 minutes, rinsed with running water for 10 minutes, and rinsed with PBS. The target area was found under a fluorescence microscope and photographed and recorded with an anti-fluorescence decay sealing agent.

For immunofluorescence quantification, images were captured exclusively from the urothelial region. Five random fields of view per section were selected, and three sections per animal were analyzed. The mean fluorescence intensity (MFI) of PKM2 and LDHA was measured using ImageJ software (NIH, USA) by outlining the urothelial layer in each image, and the average MFI from all fields was used for statistical analysis. To help localize the urothelial region in Figure 1G, H&E staining was performed on adjacent sections from the same paraffin blocks. The CG sample used for IF showed clear urothelial thickening but no prominent Brunn’s nests; Brunn’s nest formation is separately demonstrated in Figure 2B.

Figure 1.

PKM2 and LDHA are upregulated in CG. (A) Western blot of PKM2 and LDHA in SV-HUC-1 cells. β-actin, loading control. (B) Quantification of (A). (C) Western blot of PKM2 and LDHA in rat bladder epithelium. (D) Quantification of (C). (E) qPCR of PKM2 and LDHA mRNA in SV-HUC-1 cells. (F) qPCR of PKM2 and LDHA mRNA in rat bladder epithelium. (G) Immunofluorescence of PKM2 (red) and LDHA (green) in rat bladder. DAPI (blue), nuclei. The CG group shows urothelial thickening, disorganized cellular arrangement, and uneven stratification compared with the control group, consistent with the histopathological features of cystitis glandularis. Insets show higher-magnification views of the urothelial region, highlighting the disorganized and sparsely distributed urothelial cells in the CG group. Scale bar: 50 μm (overview) and 20 μm (inset). Due to sectioning at different levels, slight differences in tissue orientation may be observed between the IF and H&E images; however, the urothelial layer can be clearly identified. Brunn’s nest formation is separately demonstrated in Figure 2B. (H) Quantification of mean fluorescence intensity in (G). Data are mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 vs Control.

Figure 2.

Enhanced migration, proliferation, and Brunn’s nest formation in CG. (A) Wound healing assay images at 0 and 48 h. Scale bar: 200 μm. (B) H&E staining of rat bladder. Arrows indicate Brunn’s nests. Scale bar: 100 μm. (C) Quantification of wound closure at 24 and 48 h. (D) CCK-8 assay at 24 and 48 h. (E) Quantification of Brunn’s nests per HPF (n=6 per group). Data are mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 vs Control.

Detection of Cell Energy Metabolism

Cell oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured in real time by Seahorse XFe96 bioenergy analyzer (Agilent). XF Glycolysis Stress Test Kit: SV-HUC-1 cells were treated with LPS or control, and the medium was replaced with preheated to 37°C. The analysis was performed using phenol red-free DMEM (containing 1 mmol / L sodium pyruvate and 2 mmol / L glutamine), placed in a CO 2-free 37°C incubator for 1 hour. After equilibration, glucose (final concentration 10 mmol / L), oligomycin (1.0 μmol / L) and 2-deoxyglucose (50 mmol / L) were automatically added by the instrument according to the preset procedure, and ECAR data were continuously collected during this process. Mitochondrial function was detected by XF Mito Stress Test kit. The analysis medium was supplemented with 10 mmol / L glucose on the basis of the above components. After the cells were washed and balanced under the same conditions, oligomycin (1.5 μmol / L), FCCP (1.5 μmol / L) and rotenone / antimycin A mixture (0.5 μmol / L each) were added in turn, and the OCR values were recorded in real time. All metabolic readings were finally normalized according to the actual number of cells.

ATP Yield Detection

Cell ATP production rate was detected by Seahorse XFe96 analyzer with XF Real-Time ATP Rate assay kit (Agilent). SV-HUC-1 cells treated with LPS or control were removed from the original culture medium and replaced with phenol red-free DMEM (containing 10 mmol / L glucose, 1 mmol / L sodium pyruvate and 2 mmol / L glutamine), which was preheated to 37°C. The analysis was balanced for 1 hour at 37°C and 5% CO2. Oligomycin (final concentration of 1.5 μmol / L) and rotenone / antimycin A (final concentration of 0.5 μmol / L) were injected automatically according to the procedure, and the OCR value was recorded during the whole process. The software automatically calculated the mitochondrial ATP yield and glycolytic ATP yield according to the OCR changes before and after drug treatment.

Cell Scratch Test

SV-HUC-1 cells in the proliferative phase were digested with trypsin, centrifuged, resuspended with complete medium, and placed in a 6-well plate at a certain density (the bottom of the plate was pre-painted with a marker stroke. Horizontal lines with a spacing of about 0.5–1 cm were used as positioning markers). After overnight culture, the cells grew to the confluent monolayer. A cell-free blank band was made by using a 200 μL sterile gun head to cross the ruler vertically on the cell layer. After scratching, PBS gently washed twice to remove the scratched cell debris, replaced with serum-free medium, and then grouped according to the 2.1 section method. At the two time points of 0 hours and 48 hours after the scratch, the pre-marked position was photographed under an inverted microscope. The remaining scratch area at each time point was measured by ImageJ software. The migration was expressed by healing rate: healing rate (%) = (initial scratch area − scratch area at each time point) / initial scratch area × 100%.

Animal Experiment

Twenty female SD rats (6–8 weeks old, weighing 190–210 g) were purchased from Guizhou Biouhan Biotechnology Co., Ltd. All animals were fed in the barrier facility of the central laboratory of the Second Affiliated Hospital of Guilin Medical University. The environmental parameters were set as follows: temperature 22°C ± 2°C, humidity 40% −70%, circadian rhythm 12 h / 12 h, free access to feed and drinking water. The animal operations involved in this experiment were approved by the Animal Ethics Committee of Guilin Medical University (Approval No. GLMC20243190) and strictly followed the NIH Guide for the Care and Use of Laboratory Animals (1996) and the ARRIVE guidelines 2.0.

Twenty rats were randomly divided into two groups (n = 10 / group): control group was given normal saline, and LPS group was given LPS solution. The CG model was established by bladder perfusion method. The brief process is as follows: rats were induced by isoflurane inhalation anesthesia (3% −5% isoflurane mixed with oxygen, induction for about 40 seconds), and the depth of anesthesia was confirmed by the disappearance of toe reflex. During the anesthesia maintenance phase, 1.5% −3% isoflurane was continuously inhaled through a mask. After the end of the experiment, all rats were euthanized by cervical dislocation under deep anesthesia, and the operation followed the relevant provisions of the American Veterinary Association (AVMA) “Animal Euthanasia Guide”. The perineum and urethral orifice were disinfected with iodophor cotton balls, and then a 7 cm long one-time epidural catheter was taken and slowly pushed into the bladder (about 4 cm) from the urethral orifice, and the abdomen was gently pressed to empty the residual urine. The end of the catheter was connected with a 0.5 mL syringe, and 0.2 mL LPS solution (concentration 2 mg / mL, prepared with normal saline) was slowly perfused. After the perfusion was completed, the catheter was withdrawn, and the urethral orifice was immediately clamped with an artery clip for 30 minutes and then released. The animals in the control group received the same amount of sterile saline bladder perfusion, and the remaining operations were exactly the same as those in the LPS group. Perfusion was repeated every 2 days for 20 consecutive times. The method of establishing CG rat model induced by LPS was referred to the previous work of our group.¹⁸ Successful CG model establishment was confirmed by H&E staining, which showed urothelial hyperplasia, Brunn’s nest formation, and inflammatory cell infiltration in the bladder mucosa, consistent with the histopathological features of human CG as described previously.^18,19

All animal experiments were approved by the Animal Ethics Committee of Guilin Medical University (Approval No. GLMC20243190) and complied with the NIH Guide for the Care and Use of Laboratory Animals.

Hematoxylin and Eosin (H&E) Staining

Bladder tissues of rats in each group were fixed in 4% formaldehyde solution for 24 hours, and then embedded in paraffin and cut into 4μm thick serial sections. After the slices were attached to the slides, they were dewaxed in xylene for 30 minutes, and then gradually hydrated with gradient alcohol (100%, 95%, 70%). The hydrated sections were rinsed with distilled water, stained with hematoxylin staining solution (Beyotime, C0105S) for 5–10 minutes, and then rinsed with running water in tap water for about 5 minutes. Next, it was re-stained with eosin for 2–5 minutes. After staining, it was dehydrated with gradient alcohol (70%, 95%, 100%), transparent with xylene, and finally sealed with neutral gum. The sealed sections were placed under an optical microscope to observe the pathological changes of bladder tissue in each group, and the representative areas were photographed and archived. The pathological score was evaluated according to the criteria of Zhou et al²⁰ from three aspects: the degree of edema, the infiltration of inflammatory cells and the number of Brunn nests. Each index was scored by 0 to 3 points (0 = normal, 1 = mild, 2 = moderate, 3 = severe), and the highest score of the three was 9 points. The specific scoring criteria of Brunn ‘s nest are as follows: 0 means that Brunn ‘s nest is not seen under high magnification; 1 point is 2 per high power field of view; 2 points are 5 in each high power field of view; the score of 3 represents that Brunn ‘s nest is widely distributed in the field of vision.

For Brunn’s nest quantification, five random high-power fields (HPF, ×400) per section were selected, and the number of Brunn’s nests was counted by two independent observers blinded to the group allocation. The average count per HPF was used for analysis.

Statistical Analysis

Normality was assessed using the Shapiro–Wilk test. For comparisons between two groups, unpaired Student’s t-test, Welch’s t-test, or Mann–Whitney U-test was used as appropriate. Categorical variables were compared using Fisher’s exact test. Comparisons among multiple groups were performed using one-way ANOVA followed by Tukey’s post hoc test for pairwise comparisons. P < 0.05 was considered statistically significant.

ARRIVE Guidelines Statement

This study was conducted in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines 2.0. A completed ARRIVE 2.0 checklist has been provided as supplementary material.

Results

Accumulation of Lactate in CG with Enhanced Glycolysis

In order to clarify whether lactate metabolism changes under CG state, we detected lactate levels from three dimensions cell, animal tissue and clinical serum. At the cellular level, after SV-HUC-1 cells were treated with LPS (20 μg / mL) for 24 hours, the lactate content in the supernatant was significantly higher than that in the control group (Figure 3A). The results of animal tissue test were consistent with the trend of cell experiment. The level of lactate in bladder tissue homogenate of CG model rats was significantly higher than that of normal control rats (Figure 3B). The results of clinical serum samples also verified the above trend: the serum lactate content of CG patients was significantly higher than that of healthy controls (Figure 3C). The above multi-level detection results suggest that increased lactate production is a prominent feature of CG lesions.

Figure 3.

Lactate accumulation and enhanced glycolysis in CG. (A) Intracellular and supernatant lactate levels in SV-HUC-1 cells treated with LPS (20 μg/mL, 24 h) or control. (B) Lactate concentration in bladder tissue homogenates from control and CG rats. (C) Serum lactate levels in CG patients (n = 6) and healthy controls (n = 6). (D) ATP production rates from glycolysis and oxidative phosphorylation in SV-HUC-1 cells. (E) OCR in SV-HUC-1 cells (left) and quantification of ATP production and maximal respiration (right). (F) ECAR in SV-HUC-1 cells (left) and quantification of glycolysis and glycolytic capacity (right). Data are mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs Control.

Lactate is the final metabolite of the glycolysis pathway, and its intracellular and extracellular accumulation is often accompanied by the activation of the glycolysis pathway. Based on the above changes in lactate levels, this study further examined the ATP production rate of cells to clarify the activation of energy metabolism pathways. The results showed that after LPS intervention, the ATP production rate of glycolysis pathway and mitochondrial pathway was higher than that of the control group, and the increase of glycolysis-derived ATP was more significant (Figure 3D), suggesting that LPS stimulation could enhance the overall energy metabolism level of cells, and the up-regulation of glycolysis pathway was more prominent. Next, we used the Seahorse analyzer to simultaneously detect the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of cells, which correspond to mitochondrial respiration and glycolysis activity, respectively. The results showed that the OCR of the LPS experimental group was increased (Figure 3E), and the basal respiration and maximum respiration were higher than those of the control group, indicating that the oxidative phosphorylation function of the cells was activated after LPS stimulation; the ECAR of the LPS experimental group was also increased (Figure 3F), and glycolysis and glycolytic capacity were higher than those of the control group, suggesting that the glycolytic activity was enhanced. Based on the above results, there are not only obvious lactate accumulation and enhanced glycolysis in CG, but also both of them may provide favorable conditions for the occurrence of lactylation.

The Expression of PKM2 and LDHA was Up-Regulated in CG

PKM2 and LDHA are two key enzymes in the glycolysis pathway. In order to clarify their expression changes in CG, we detected them at the mRNA and protein levels in cells and rat models, respectively. In vitro, the mRNA levels of PKM2 and LDHA in SV-HUC-1 cells treated with LPS (20 μg / mL) for 24 hours were significantly higher than those in the control group (Figure 1E). The results of Western blot further confirmed that the protein levels of PKM2 and LDHA in the LPS experimental group were also significantly up-regulated (Figure 1A and B).

Consistent with the results of cell experiments, in the rat CG model, the mRNA levels of PKM2 and LDHA in the bladder epithelium of the CG group were higher than those in the control group (Figure 1F), and the same trend was observed at the protein level (Figure 1C and D). We used immunofluorescence to verify the expression of these two enzymes in tissues. The fluorescence intensity of PKM2 and LDHA in the bladder epithelium of the CG group was significantly higher than that of the control group (Figure 1G and H). Consistent with the H&E findings, the CG group also exhibited urothelial thickening, disorganized cellular arrangement, and uneven stratification. In general, PKM2 and LDHA were up-regulated at both mRNA and protein levels in CG, which was consistent with the phenotype of enhanced glycolysis activity.

Lactylome Analysis Identifies ADH5-K113 Lactylation

In order to explore the overall changes of lactylation in CG, we performed quantitative lactylation omics analysis on the bladder epithelial tissue of rats in the control group and CG group. The volcano map showed that there were a large number of differentially lactylated proteins between the two groups, of which ADH5 K113 lactylated was particularly up-regulated in the CG group (Figure 4A). Quantitative analysis further confirmed that the lactylation level of ADH5 K113 in the CG group was much higher than that in the control group (log2FC = 2.463, FC = 5.52, P = 0.000101; Figure 4B).

Figure 4.

Lactylome analysis identifies ADH5-K113 lactylation in CG. (A) Volcano plot of differentially lactylated proteins between CG and control bladder epithelial tissues. Red dots indicate significantly upregulated sites (|log₂FC| > 1, P < 0.05, Student’s *t*-test), blue dots indicate significantly downregulated sites, and grey dots indicate non-significant sites. ADH5-K113 is highlighted. (B) Fold change of ADH5-K113 lactylation (TNLCQKIR peptide) in CG tissues compared with normal controls (log2FC = 2.463, FC = 5.52, P = 0.000101, Student’s t-test). Data are presented as mean ± SD (n = 3 per group), with each dot representing one biological sample. The bar graph shows log2 (raw intensity). The log2FC was calculated from normalized intensity. (C) Lactylation sites identified on glycolysis-related proteins, including LDHA-K126, ALDOA-K13/14/42/230, TPI1-K14, PFKL-K677, PGM1-K349, ACSS1-K615 and ADH5-K113. (D) MS/MS spectrum of the ADH5 lactylated peptide TNLCQKIR. The precursor ion and b/y ions are labeled. (E) KEGG pathway enrichment analysis of differentially lactylated proteins. The dot size represents the number of genes enriched in each pathway (gene count range: 5–25), and the dot color indicates the P value (red, lower P value; blue, higher P value). The glycolysis/gluconeogenesis pathway is highlighted. (F) GO biological process enrichment analysis of differentially lactylated proteins. The dot size represents gene count (range: 100–300), and the dot color indicates the P value. (G) Motif analysis of lactylation sites. The central position (0) is the lactylated lysine.

Combined with the previous findings of lactate accumulation and glycolysis enhancement, we focused on the lactylation of glycolysis pathway-related proteins. The results showed that multiple enzymes in the glycolysis pathway were modified by lactylation, and the sites covered Ldha K126, Aldoa K13 / K14 / K42 / K230, Tpi1 K14, Pfkl K677, Pgm1 K349, Acss1 K615 and Adh5 K113 (Figure 4C). Among them, the up-regulation of lactylation in ADH5 K113 was the most significant among all the identified sites (Figure 4C). The results of mass spectrometry also confirmed the reliability of ADH5 containing K113 lactylation modified peptide (TNLCQKIR) (Figure 4D).

In order to explore the biological pathways involved in these differentially lactylated sites, we performed KEGG enrichment analysis. The results showed that the differential proteins were significantly enriched in multiple metabolic pathways, and the glycolysis / gluconeogenesis pathway ranked in the top five (Figure 4E). GO biological process enrichment analysis showed that differentially lactylated proteins were mainly involved in energy metabolism related processes such as ATP synthesis coupled proton transport and tricarboxylic acid cycle (Figure 4F). In addition, Motif analysis also gave the sequence characteristics of amino acids near the lactylation site (Figure 4G). In summary, the proteins on the glycolysis pathway in CG have indeed undergone extensive lactylation, and ADH5 K113 is one of the most significant sites, suggesting that this site may be involved in the metabolic regulation of CG.

Increased Global Lactylation and ADH5-K113 Lactylation Levels in CG

The omics data suggested that ADH5-K113 lactylation was significantly up-regulated in CG. In order to verify this finding, we detected the global lactate level and the lactylation at the ADH5 K113 locus from the cell and animal levels, respectively. In cell experiments, after SV-HUC-1 cells were induced by LPS (20 μg / mL) for 24 hours, the Pan Kla signal was significantly enhanced compared with the control group (Figure 5A), indicating that the global lactylation of CG cells increased as a whole. At the same time, the total protein level of ADH5 was increased, and the lactylation at the K113 site was also up-regulated (Figure 5B and C), suggesting that LPS treatment not only increased the expression of ADH5, but also enhanced the lactylation at this site.

Figure 5.

Global lactylation and ADH5 K113 lactylation are upregulated in CG. (A) Pan Kla Western blot and quantification in SV-HUC-1 cells. (B) Western blot of total ADH5 and ADH5-K113la in SV-HUC-1 cells. β-tubulin, loading control. (C) Quantification of (B). (D) Pan Kla Western blot and quantification in rat bladder epithelium. (E) Western blot of total ADH5 and ADH5-K113la in rat bladder epithelium. (F) Quantification of (E). Data are mean ± SD. *P < 0.05, **P < 0.01 vs Control.

The results in the rat model were consistent with the results of cell experiments. The level of Pan Kla in the bladder epithelium of the CG group was higher than that of the control group (Figure 5D), the total protein level of ADH5 was increased, and the level of ADH5-K113 lactylation was significantly up-regulated (Figure 5E and F). The above results showed that the global lactate level in CG was increased, and the expression of ADH5 and the lactylation of K113 were up-regulated, which was consistent with the findings of omics analysis, further supporting that ADH5-K113 lactylation may be involved in the metabolic regulation of CG.

CG Bladder Epithelial Cell Proliferation and Migration Ability Enhancement

In order to understand the functional changes of CG bladder epithelial cells, we detected the migration and proliferation of cells by scratch test and CCK-8, and observed the pathological changes of rat bladder tissue by HE staining. The results of the scratch test showed that the healing rate of the LPS-treated group was significantly higher than that of the control group at 24 hours and 48 hours after scratch (Figure 2A and C), suggesting that the migration activity of CG cells was enhanced. A similar trend was also observed in the CCK-8 experiment. The OD values of LPS-treated cells at 24 and 48 hours were significantly higher than those of the control group (Figure 2D), indicating that their proliferation ability was also improved. HE staining showed that the epithelial layer of the bladder mucosa of CG rats was significantly thickened, and the typical Brunn nest structure appeared in the submucosa (Figure 2B). Quantitative statistics further confirmed that Brunn ‘s nests were not found in the bladder epithelium of the control group, while the number of Brunn ‘s nests in the CG group was significantly increased (Figure 2E). Based on these results, CG bladder epithelial cells showed an enhanced trend in both proliferation and migration, accompanied by the formation of Brunn nests.

Mechanism Model

Based on the above results, we proposed a working model of ADH5-K113 lactylation involved in the pathogenesis of CG. LPS stimulation caused lactate accumulation in bladder epithelial cells, which in turn activated the glycolysis pathway, leading to up-regulation of PKM2 and LDHA expression, and the expression of ADH5 also increased. Lactylome analysis omics screening locked ADH5-K113 lactylation as the most up-regulated differential site in CG. Subsequent verification experiments also confirmed that the global lactate level in CG and ADH5-K113 lactylation were significantly increased. These results are closely related to the enhanced proliferation, accelerated migration and Brunn nest formation of bladder epithelial cells (Figure 6). This model provides a preliminary framework for understanding the role of ADH5-K113 lactylation in the regulation of CG metabolism, but its underlying molecular mechanism remains to be elucidated.

Figure 6.

Schematic diagram of the proposed mechanism. Lactate accumulation enhances glycolysis and upregulates PKM2, LDHA, and ADH5 expression. ADH5-K113 lactylation, identified as the most prominent site by quantitative lactylomics, is associated with increased cell proliferation, migration, and Brunn’s nest formation in cystitis glandularis.

Discussion

In this study, it was confirmed that there was obvious accumulation of lactate and enhanced glycolysis in CG from both in vivo and in vitro, which was manifested by increased lactate level, accelerated glycolytic ATP production rate and up-regulated ECAR. At the same time, PKM2 and LDHA were highly expressed at mRNA and protein levels, suggesting that abnormal activation of glycolysis pathway was involved in the pathological process of CG. Studies have shown that enhanced glycolysis and lactate accumulation play a catalytic role in a variety of inflammatory proliferative diseases. Lactate is not only a by-product of metabolism, but also acts as a signal molecule to affect cell behavior by regulating gene expression and protein modification.^21,22 The above results provide a new experimental basis for understanding the relationship between metabolic disorders and epithelial proliferation in CG.

Lactylation modification has been considered as an important post-translational modification that connects metabolism and gene regulation since it was first reported in 2019.¹⁰ There is increasing evidence that lactylation plays a key role in many disease processes. In terms of tumors, histone lactylation can drive the progression of ocular melanoma by up-regulating YTHDF2.²³ Lactylation of METTL3 promotes tumor immunosuppression by affecting RNA m6A modification.²⁴ In terms of inflammation, lactate has been shown to be involved in macrophage polarization and the inflammatory response to sepsis.^11,12 In addition, recent work has also found that lactate is closely related to tumor chemotherapy resistance and metabolic network remodeling.^25,26 In recent years, a number of reviews have summarized the role of lactylation in the bridge between metabolism and epigenetic regulation.^27–31 However, the role of lactylation in bladder epithelial cells and CG has not been reported before. In this study, the change of lactylation in CG bladder epithelial cells was observed for the first time, which filled the gap for the study of lactylation in bladder diseases.

The core finding of this study is the significant up-regulation of ADH5-K113 lactylation in CG. ADH5 was originally recognized as a metabolic enzyme of formaldehyde and S-nitrosoglutathione, which plays an important role in the maintenance of intracellular redox balance.¹⁵ Metabolic reprogramming and redox homeostasis are closely linked.³² However, more and more evidence shows that ADH5 is involved in the regulation of cell proliferation and metabolism in addition to its detoxification function in tumors. Taking non-small cell lung cancer as an example, ADH5 has been found to inhibit proliferation, but can promote epithelial-mesenchymal transition.¹⁷ Another study confirmed that ADH5 can regulate cell metabolism by denitrosylation.¹⁶ However, whether ADH5 can undergo lactylation and what function this modification has have not been reported before. In this study, it was confirmed for the first time that ADH5 was a substrate for lactylation, and it was found that the lactylation level at K113 site was significantly increased in CG, which was associated with the up-regulation of PKM2 and LDHA expression and the enhancement of glycolysis. This finding extends the functional study of ADH5 from traditional redox regulation to a new level of metabolic regulation mediated by lactylation.

As two key metabolic nodes of the glycolysis pathway, PKM2 is responsible for the conversion of phosphoenolpyruvate to pyruvate, while LDHA mediates the conversion of pyruvate to lactate.^33,34 In our results, the expression of PKM2 and LDHA was up-regulated in CG state, which was consistent with the phenotypic results of lactate accumulation and enhanced glycolytic activity. At the same time, it was also consistent with the high expression pattern of glycolytic enzymes observed in other proliferative diseases.^33,34 The omics data suggest that multiple enzymes in the glycolysis pathway have differential lactylation. Therefore, we speculate that there may be a metabolic regulation network mediated by lactylation in CG, and ADH5-K113la, as the most significant site of change, may be a key node in this network. However, whether ADH5-K113 lactylation is directly involved in regulating the transcription of PKM2 and LDHA still needs to be further verified by experiments such as ChIP-qPCR and site-specific mutations. Our current data establish a strong correlation between ADH5-K113 lactylation and proliferative phenotypes in CG. However, direct evidence for a causal role requires further functional validation, such as ADH5 knockdown or K113 mutation experiments, which will be performed in future studies using CRISPR-Cas9-mediated ADH5 knockout or K113R knock-in models.

From the perspective of clinical transformation, these results may provide some reference for the hierarchical management of CG. At present, the clinical treatment of CG is not uniform, and the fundamental reason is the lack of molecular indicators that can judge the risk of disease progression.^6,7 Previous studies have shown that abnormal lactate metabolism has the value of biomarkers and therapeutic targets in a variety of diseases.^35,36 The association of ADH5-K113la with enhanced cell proliferation and Brunn ‘s nest formation in this study suggests that lactylation-related molecules have the potential to be candidate markers for assessing the activity of CG lesions. In addition, intervention strategies for lactate production or lactylation have shown efficacy in a variety of disease models,^29,30,37 which also provides a new direction for the drug treatment of CG.

Currently, the management of CG remains controversial. Some clinicians advocate surgical intervention based on the assumption that CG is a premalignant lesion, while others recommend conservative follow-up because the malignant transformation rate is low.^6,7 This divergence often leads to overtreatment and unnecessary psychological burden for patients. Our findings suggest that targeting lactylation-related pathways, particularly ADH5-K113 lactylation, may provide a non-surgical therapeutic option for CG patients with elevated lactate levels. However, further studies are needed to evaluate the safety and efficacy of such interventions.

This study also has some limitations. First of all, the rat CG model was used for lactylome analysis. Although the difficulty of sampling clinical samples is bypassed, there are species differences in the lactylation spectrum of rat and human bladder epithelium. In the future, it is necessary to further verify the key sites in human tissue samples. Secondly, we did not perform ADH5 knockdown or K113 site-specific mutation experiments, which are necessary to establish a causal relationship between ADH5-K113 lactylation and PKM2/LDHA upregulation. Although our data demonstrate a strong correlation, the functional causality remains to be confirmed. Future studies using CRISPR-Cas9-mediated ADH5 knockout or K113R knock-in models will be crucial to address this question. Third, only SV-HUC-1 single cell line was used in the cell experiment, which limited the integrity of the conclusion to some extent. The above problems will be gradually improved in subsequent research.

Conclusion

In summary, this study found that lactate accumulation and glycolysis were enhanced in CG, and the expression of PKM2 and LDHA was up-regulated at both mRNA and protein levels. Through lactylome analysis, we identified for the first time that ADH5-K113 lactylation is the most significantly up-regulated differential lactylation site in CG bladder epithelial cells, and the increase of this modification is accompanied by the increase of global lactate level, the enhancement of cell proliferation and migration, and the formation of Brunn ‘s nest. The above results reveal the potential significance of lactylation in CG, and the lactylation of ADH5-K113 may be a new clue to understand the pathogenesis of CG and optimize its clinical management.

Funding Statement

This work was supported by the National Natural Science Foundation of China (Grant No. 82460158); Guangxi Key Research and Development Program (Grant No. Guike AB25069043); Guangxi Province Qingmiao Talent Project (No. 25-qmrcxm-01); Guilin Scientific Research and Technology Development Plan (Grant No. 20230135-1-1); and Innovation Project of Guangxi Graduate Education (No. YCSW2025486). The authors would also like to gratefully acknowledge the support provided by Guangxi Medical and Health Key Cultivation Discipline Construction Project, Guangxi Key Laboratory of Tumor Immunology and Microenvironmental Regulation, and the Guangxi Zhuang Autonomous Region Engineering Research Center for Lower Urinary Tract Disease Research and Clinical Translation (approved in 2026).

Data Sharing Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request. The raw mass spectrometry data of the lactylome analysis will be deposited in the ProteomeXchange Consortium upon publication.

Ethical Approval Statement

All animal experiments were approved by the Animal Ethics Committee of Guilin Medical University (Approval No. GLMC20243190). Clinical sample collection was approved by the Ethics Committee of the Second Affiliated Hospital of Guilin Medical University (Approval No. EFY-GZR2024012), and written informed consent was obtained from all participants. Clinical sample collection was performed in accordance with the Declaration of Helsinki.

Author Contributions

Yueyang Gong: Conceptualization, Investigation, Data curation, Formal analysis, Writing – original draft, Writing – review & editing, Visualization. Yongbo Tang: Investigation, Data curation, Formal analysis, Writing – review & editing. Shuangyan Chen: Investigation, Formal analysis, Writing – review & editing. Jieyong Mo: Investigation, Visualization, Writing – review & editing. Bo Ge: Conceptualization, Supervision, Writing – review & editing, Funding acquisition. All authors gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Disclosure

The authors report no conflicts of interest in this work.