TRPC5 mediates MUC5AC secretion via NLRP3 inflammasome in toluene diisocyanate-induced mixed granulocytic asthma

Abstract

Background and Objective

Airway mucus overproduction (predominantly MUC5AC) is a well-recognized pathogenic feature in asthma, but the upstream regulatory mechanisms were enigmatic. Emerging evidence has implied the crucial role for transient receptor potential canonical channel 5 (TRPC5) in the pathogenesis of allergic diseases. Yet, the specific role of TRPC5 in asthma still remains unclear. Thus, this study was aimed to explore the functional role of TRPC5 in toluene diisocyanate (TDI)-induced mixed granulocytic asthma and to delineate the mechanisms by which TRPC5 regulate MUC5AC secretion.

Methods

Bronchoalveolar lavage fluid (BALF) and mucosal biopsy samples were collected from asthmatic subjects and control. Using a murine model of TDI-induced asthma, we gave the asthmatic mice selective TRPC5 inhibitors ML204, AC1903 or an NLRP3 inhibitor, MCC950. In vitro experiments were performed in a human airway epithelial cell line BEAS-2B.

Results

BALF levels of MUC5AC were significantly increased in the recruited asthmatic patients, as well as the levels of HMGB1, and a positive correlation was observed between the two. Expression of TRPC5 was elevated in the airway epithelium of asthmatics when compared to the control. In mice, TDI exposure raised the expression of TRPC5. Blocking TRPC5 with either ML204 or AC1903 dramatically attenuated TDI-induced airway hyperresponsiveness (AHR), airway inflammation and remodeling. Additionally, both antagonists led to inhibited activation of NLRP3 inflammasome and muc5ac secretion in TDI-exposed mice. While pharmacological inhibition of NLRP3 inflammasome suppressed TDI-induced muc5ac secretion. In vitro, TDI induced increased expression of MUC5AC, NLRP3 and TRPC5 in BEAS-2B. Silence of either trpc5 or nlrp3 effectively inhibited MUC5AC hypersecretion in airway epithelium induced by TDI. Besides, TRPC5 agonist (Riluzole) promoted MUC5AC overproduction in airway epithelial cells, which could be suppressed by nlrp3 siRNA.

Conclusion

TRPC5 contributes to TDI-induced asthma, and mediates airway epithelial muc5ac hypersecretion by partially activating NLRP3 inflammasome.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s10565-026-10248-2.

Highlights

• TRPC5 contributes to airway inflammation and remodeling of TDI-induced asthma.

• TRPC5 promotes airway mucus secretion by modulating muc5ac overexpression in TDI-exposed mice.

• TRPC5 mediates TDI-induced muc5ac hypersecretion by partially activating NLRP3 inflammasome in the airway epithelium.

Graphical Abstract

TRPC5 Mediates MUC5AC Secretion via NLRP3 Inflammasome in Toluene Diisocyanate-Induced Asthma

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s10565-026-10248-2.

Introduction

Asthma remains a pressing global health challenge, with approximately 334 million people affected worldwide (Papi et al. 2018). Corticosteroids constitute the cornerstone of clinical asthma management; however, 5% ~ 20% of asthmatic patients exhibit poor responsiveness to high-dose steroids and progress to severe asthma. This condition leads to greater morbidity and mortality, posing a substantial economic burden to the healthcare system globally (Kim et al. 2017). Toluene diisocyanate (TDI), a leading trigger of asthma in industrialized areas, induces a distinct mixed granulocytic airway inflammation characterized by predominant neutrophil infiltration and milder eosinophil accumulation, both of which are insensitive to systemic nor inhaled steroid therapy (Chen et al. 2022a, b). Given the limited therapeutic options for severe asthma, a deeper mechanistic understanding of TDI-driven airway inflammation is critical for improving the management of severe asthma.

Airway mucus hypersecretion is a cardinal pathological feature of asthma, primarily driven by overproduction of mucin 5ac (MUC5AC, mu5ac in mouse) from the airway epithelial cells (Fahy and Dickey 2010). Elevated MUC5AC has been detected in the induced sputum and lung of asthmatic patients, with concentrations closely correlating to asthma severity (Ordonez et al. 2001). In 2015, Evans et.al reported that muc5ac^−/− mice exhibited decreased AHR, subsided airway inflammation and less mucous occlusion in an OVA-induced asthma model (Evans et al. 2015). Our prior studies also demonstrated increased muc5ac expression in TDI-induced asthmatic mice (Chen et al. 2019a, b, 2020a). Yet the upstream signaling pathway remains unexplored.

Transient receptor potential (TRP) channels are a family of ubiquitously expressed nonselective cation channels that can sense diverse stimuli, including temperature changes, pain, as well as intracellular and extracellular chemical signals (Kaneko and Szallasi 2014). Activation of TRP channels by exogenous or endogenous stimulus initiates a cascade of pathological processes, including inflammatory cytokine release, smooth muscle contraction, mucus overproduction, increased permeability, and ultimately resulting in chronic inflammation and airway remodeling (Grace et al. 2014). Multiple TRP subtypes (e.g. TRPA1, TRPV4, TRPC3, TRPC6, etc.) have been reported to be implicated in asthma pathogenesis (Sel et al. 2008; Wang et al. 2017; Yao et al. 2019). Yet, the role of TRPC5 was still obscure. In vitro and in vivo studies have indicated that TRPC5 blockade ameliorates airway smooth muscle cells contraction (Chen et al. 2020a, b; Liu et al. 2019a, b), suggesting a potential role for TRPC5 in the development of asthma. However, the specific function of TRPC5 in TDI-induced asthma, and its involvement in regulating MUC5AC secretion, has not been determined.

Thus, the present study was designed to address two key questions: (1) what is the role of TRPC5 in TDI-induced airway inflammation? (2) What are the mechanisms by which TRPC5 orchestrate MUC5AC secretion in TDI-induced asthma?

Methods

Human subjects

Bronchial mucosal biopsy samples and bronchoalveolar lavage fluid (BALF) were collected from subjects with asthma (n = 7 for biopsy/n = 22 for BALF) or without asthma (n = 13 for biopsy/n = 32 for BALF). All participants underwent bronchoscopy for evaluation of solitary pulmonary nodule at Shenzhen Peoples’ Hospital. Mucosal biopsy and BALF samples were collected from the upper lung lobe on the opposite side of the nodule to avoid nodule-related interference. BALF supernatant samples were isolated and stored at −80 °C until analysis of HMGB1 and MUC5AC concentrations by using commercially available enzyme-linked immunosorbent assay (ELISA) kits. Characteristics of the study subjects are presented in supplementary Table 1. This study was approved by the Ethics Committee of Shenzhen Peoples’ Hospital (NO. LL-KY-2023183–01). Written informed consent was obtained from all enrolled subjects prior to sample collection.

Animals

6 ~ 8 week old male BALB/c mice (20 ~  22 g) were purchased from Guangdong Medical Laboratory Animal Center (Guangzhou, China). All experimental mice were housed in a specific pathogen-free (SPF) facility with controlled environmental conditions: 12-h dark/light cycles (lighting: 7:00–19:00), temperature of 23 ± 2℃, and relative humidity of 40 ~ 70%. Sterile water and irradiated standard food chow were provided ad libitum throughout the study. All animal care and experimental procedures were conducted in accordance to the guidelines of the use and care of animals and were approved by the Animal Subjects Committee of Shenzhen People’s Hospital (NO. LL-KY-2021337).

Reagents

Toluene diisocyanate (toluene-2, 4-diisocyanate, ≥ 98.0%), methacholine and acetone were purchased from Sigma-Aldrich (Shanghai, China). The TRPC5 selective inhibitors ML204 (#S8691) and AC1903 (#S0977), the NLRP3 inflammasome inhibitor MCC950 (#S8930) and the TRPC5 agonist riluzole (#S1614) were obtained from Selleck Chemicals (Shanghai, China). Multiplex immunoassays for detecting interleukin (IL)−4, IL-5, IL-13, IL-17A, IL-6, IL-18 (#PPX-06) and an ELISA kit for total immunoglobulin E (IgE) (#88–50,460-22) were purchased from eBioscience (San Diego, CA, USA). ELISA kits for mouse HMGB1 (#NBP2-62,767), mouse muc5ac (#NBP2-76,704) and human HMGB1 (#NBP2-62,766), human MUC5AC (#NBP2-76,703) were obtained from Novus (Colorado, USA). Primary antibodies against HMGB1 (#ab79823), caspase-1 (#ab1872), NLRP3 (#ab214185), and α-smooth muscle actin (α-SMA, #ab124964) were purchased from Abcam (Shanghai, China). The primary antibody against MUC5AC (#GTX11335) was obtained from GeneTex (Irvine, CA, USA), and the primary antibody against TRPC5 (#25,890–1-AP) antibody was purchased from Proteintech (Rosemont, IL, USA). Periodic acid-Schiff (PAS) staining and Masson’s trichrome staining kits were brought from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). TRIzol reagents for extracting total RNA and gene expression analysis were purchased from Takara Biotechnology (Guangzhou, China).

Establishesment of TDI-induced Asthma model

The TDI-induced murine asthma model was established as described elsewhere (Chen et al. 2022a, b). Two independent experimental protocols were conducted. In Protocol 1, mice were randomly assigned to four groups: (1) vehicle-sensitized, vehicle-challenged, dimethyl sulfoxide (DMSO)-treated mice (control group); (2) TDI-sensitized, TDI-challenged, DMSO-treated mice (TDI group); (3) TDI-sensitized, TDI-challenged, 25mg/kg ML204-treated mice (TDI + ML204 group); (4) TDI-sensitized, TDI-challenged, 25mg/kg AC1903-treated mice (TDI + AC1903 group). In Protocol 2, mice were randomly allocated to 3 groups: (1) vehicle-sensitized, vehicle-challenged, and PBS-treated mice (control group), (2) TDI-sensitized, TDI-challenged, and PBS-treated mice (TDI group), and (3) TDI-sensitized, TDI-challenged, and 200 mg/kg MCC950-treated mice (TDI + MCC950 group).

For sensitization, mice received dermal application of 0.3% TDI (20μL per ear) on the dorsum of both ears on days 1 and 8. For challenge, mice were placed in a horizontal rectangular chamber and exposed to nebulized 3% TDI for 3 h per session on days 15, 18 and 21. Nebulization was performed using compressed air (NE-C28; Omron, Tokyo, Japan). Control mice underwent the same procedures but were treated with the same amount of vehicle. The vehicle used to dissolve TDI consisted of a mixture of two volumes of acetone and three volumes of olive oil for sensitization, and one volume of acetone and four volumes of olive oil for inhalation. ML204, AC1903 or MCC950 was diluted in 250μL PBS. ML204 (25 mg/kg), AC1903 (25 mg/kg) or MCC950 (200 mg/kg) was administered separately via intraperitoneal injection route once immediately after each nebulization challenge. Control groups received intraperitoneal injection of DMSO (Protocol 1) or PBS (Protocol 2) at the same volume.

Assessment of airway hyperresponsiveness

Airway reactivity to methacholine was evaluated 24 h after the final TDI challenge using the FinePointe Resistance and Compliance system (DSI, Buxco, USA) as previously described (Chen et al. 2019a, b). Mice were anesthetized, tracheostomized, and mechanically ventilated. Lung resistance (R_L) was measured in response to increasing concentrations of nebulized methacholine (6.25, 12.5, 25 and 50 mg/mL) every 5 min following each nebulization step until a plateau phase was reached. Results were expressed as the percentages of baseline R_L (measured before methacholine exposure) value for each concentration of methacholine.

Measurement of serum total IgE

Mice were euthanized with an overdose of pentobarbital (100 mg/kg, i.p.) one day after the final airway challenge. Blood samples were collected from the retroorbital plexus/sinus, allowed to clot at room temperature for 1 h, and then centrifuged at 3000 g for 20 min to isolate serum. Serum total IgE concentrations were measured using a commercial ELISA kit according to the manufacturer’s instructions.

Bronchoalveolar lavage fluid collection and detection of cytokines

After blood collection, the lungs were lavaged in situ twice with 0.8 mL prewarmed sterile saline (0.9% NaCl). Recovered BALF was pooled, and total cell counts were determined using a hemocytometer. Cytospin preparation were prepared and slides were stained with haematoxylin and eosin (H&E) for differential cell counting. The remaining BALF were centrifuged at 1000 g for 10 min to collect supernatants, which were stored at −80℃. Concentrations of IL-4, IL-5, IL-13, IL-6, IL-1β, IL-18, muc5ac and HMGB1 in BALF supernatants were measured using multiplex immunoassay kits or ELISA kits according to the manufacturers’ protocols.

Pulmonary histopathological examination

Left lungs were dissected, fixed in 4% neutral buffered formalin for 24 h, dehydrated through a graded ethanol series, and embedded in paraffin. Paraffin-embedded lung tissues were sectioned into 4-μm-thick slices using a Leica 2030 microtome (Leica Microsystems, Nussloch, Germany). Lung tissues were stained with H&E, PAS and Masson’s trichrome. Peribronchial and perivascular inflammation in H&E-stained sections were assessed using a previously described standard (Chen et al. 2019a, b). Airway epithelial denudation was quantified as the percentage of the denuded area relative to the entire circumference of the bronchus. Airway smooth muscle (ASM) thickness was measured by a modification of Cho's method. Briefly, the transverse diameter of the peribronchial smooth muscle layer (from the innermost to the outermost aspect) was measured in large airways. Collagen fibril deposition in Masson’s stained section was analyzed by ImageJ software (National Institutes of Health, USA). Scoring was performed at a magnification of 200 × by examining at least 8 ~ 10 image fields of 12 slices from 6 mice per group.

Western blot and Immunohistochemistry

Pulmonary expression of TRPC5, NLRP3, procaspase-1, caspase-1, muc5ac and HMGB1 were detected by western blot. Whole lung extracts mixed with 5 × sodium dodecyl sulfate (SDS) loading buffer were separated by 10% SDS–polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto polyvinylidene difluoride (PVDF) membranes. Membranes were then probed with primary antibodies against TRPC5 (1:1000), NLRP3 (1:1000), procaspase-1 (1:500), caspase-1 (1:500), muc5ac (1:1000), HMGB1 (1:2000) and β-actin (1:5000, internal control) with indicated dilutions. After incubation with an IRDye-680WC-conjugated secondary antibody (1:10,000) for 1 h at room temperature, immunoreactive bands were visualized and quantified using an Odyssey CLx Imager (LI-COR Biosciences, Lincoln, NE). Relative protein expression levels were normalized to β-actin.

Immunohistochemical staining was performed to detect the localization and expression of of TRPC5, NLRP3, caspase-1, muc5ac and HMGB1 in lung tissues. Deparaffinized lung sections were subject to antigen retrieval, and then were treated with 3% hydrogen peroxide (H₂O₂) for 15 min to block endogenous peroxidase. Subsequently, sections were blocked with 5% bovine serum albumin (BSA) in PBS for 1 h, and then incubated overnight at 4℃ primary antibodies in recommended dilutions of anti-TRPC5 (1:200), anti-NLRP3 (1:250), anti-caspase-1 (1:500), anti-muc5ac (1:250) and anti-HMGB1 (1:1000). After washing three times with PBS, slices were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 20 min at room temperature. Signals were visualized with 3, 3’-diaminobenzidine (DAB) substrate.

Cell culture and treatment

The human airway epithelium cell line BEAS-2B was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin. Cells between passages 3 and 15 were used to ensure genetic stability. Cells were cultured in a humidified incubator with 5% carbon dioxide (CO₂) at 37℃. When cells reached 70% ~ 80% confluence, they are starved in serum-free DMEM for 10 h to synchronize cell cycle. Cells were then treated with TDI or riluzole (an agonist of TRPC5) (Zhou et al. 2017) the indicated time periods. Thereafter, cells were collected for detecting protein or gene expression by western blot or quantitative polymerase chain reaction (qPCR).

Small interfering RNA (siRNA) transfection

The siRNAs targeting human TRPC5 (trpc5 siRNA) and human NLRP3 (nlrp3 siRNA) were synthesized by Jima Biological Technology (Nanjing, China). The sense sequence for TRPC5 siRNA was 5’-GCGGAAGCACUCUUCGCAATT-3’, and the sense sequence of NLRP3 siRNA was 5’-GUGCGUUAGAAACACUUCATT-3’. Scramble siRNA (NC-siRNA) was used as a negative control. The siRNA and scramble siRNA (negative control for siRNA, NC-siRNA) were transfected using Lipofectamine 3000 (lipo3000, Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. The culture medium was replaced with fresh serum-free DMEM 6 h after transfection. Incubated for 24 h after transfection, cells were stimulated with TDI, then collected for further analysis.

Gene expression analysis

Total RNA was extracted with an RNAiso Plus kit and reverse-transcribed to complementary DNA in the presence of PrimeScript™ RT reagent kit. Real-time PCR was carried out in a 20 µL reaction system using SYBR Green Premix Ex Taq (Takara) by LightCycler 480 Fast Real-Time PCR System. The primers used were listed in Table 1.

Table 1.

Primer sequences for quantitative PCR

Gene	Species	Forward (5' → 3')	Reverse (5' → 3')
β-actin	Mouse	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
muc5ac	Mouse	CAGGACTCTCTGAAATCGTACCA	AAGGCTCGTACCACAGGGA
β-actin	Human	GAGACCGCGTCCGCC	ATCATCATCCATGGTGAGCTGG
MUC5AC	Human	TGCCCCTACAACAAGAACAAC	GGAACAGCACTGGGAGTAGTT

Statistical analysis

GraphPad Prism (version 8, GraphPad Software Inc., San Diego, CA, USA) and SPSS (Version 22.0, IBM Corp., Chicago, IL, USA) were used for statistical analysis and graphing. Prior to formal analysis, data were tested for normality using the Shapiro–Wilk test and for homogeneity of variance using Levene’s test. Only data that met the assumptions of normal distribution and equal variance were used for parametric analysis. All quantitative data were presented as mean ± standard deviation (SD). Comparisons among groups were analyzed via one-way analysis of variance (ANOVA) accompanied by LSD-t for multiple comparisons. A two-tailed P < 0.05 was regarded as statistically significant.

Results

BALF MUC5AC level was increased in asthma patients and correlated with inflammatory parameters

BALF levels of MUC5AC from asthmatics and controls were detected, as well as the level of HMGB1, a well-known inflammatory mediator in asthma (Yang et al. 2020) (Demographic information and the results of clinical examination are summarized in supplementary Table S1 and Table S2). As shown in Fig. 1A, B, the levels of MUC5AC and HMGB1 in patients with asthma were significantly higher than control (P = 0.001, P = 0.046). And a positive correlation was observed between the two (Fig. 1C, Rho = 0.340, P = 0.016). In addition, BALF MUC5AC was found to be positively associated with BALF neutrophil percentage (Fig. 1E, Rho = 0.4380, P = 0.042), blood eosinophil counts (Fig. 1F, Rho = 0.562, P = 0.006), blood eosinophil percentage (Fig. 1G, Rho = 0.501, P = 0.018) and blood lymphocyte counts (Fig. 1H, Rho = 0.589, P = 0.004), and negatively correlated with BALF macrophage percentage (Fig. 1D, Rho = −0.466, P = 0.029). While BALF HMGB1 level was positively correlated with blood eosinophil counts (Fig. 1I, Rho = 0.471, P = 0.027), and blood eosinophil percentage (Fig. 1J, Rho = 0.548, P = 0.008), but negatively correlated to blood neutrophil percentage (Fig. 1K, Rho = −0.533, P = 0.011) in asthmatic subjects.

Fig. 1.

BALF MUC5AC in asthma patients and its correlation with inflammatory parameters. A-B, BALF levels of MUC5AC and HMGB1 were increased in asthma patients (MUC5AC, N = 22 vs. control N = 32, HMGB1, N = 22 vs. control N = 28). C, BALF MUC5AC level was positively correlated with BALF HMGB1 of all recruited subjects. D-H, BALF MUC5AC correlated positively with BALF neutrophil percentage (E), blood eosinophil counts (F), blood eosinophil percentage (G) and blood lymphocyte counts (H), but negatively correlated with BALF macrophage percentage (D). I-K, BALF HMGB1 was positively correlated with blood eosinophil counts (I), and blood eosinophil percentage (J), while negatively correlated to blood neutrophil percentage (K) in asthmatic subjects. ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

TRPC5 was up-regulated in mucosal biopsy of asthmatic subjects and TDI-induced experimental asthma

To investigate the potential role of TRPC5 in asthma pathogenesis, we detected TRPC5 expression in the mucosal biopsy of asthmatics. As shown in Fig. 2A, increased expression of TRPC5 was detected in the mucosa of asthmatics when compared to control, especially in the epithelium. Then we established a murine asthma model induced by TDI to study the role of TRPC5. The expression pattern of TRPC5 was first assessed in these mice. As can be seen in Fig. 2B, TDI exposure led to dramatically increased pulmonary TRPC5 expression, with strong staining localized to the airway epithelia. TRPC5-positive staining was also observed in the surrounding infiltrating inflammatory cells, airway smooth muscle and vascular smooth muscle (Fig. 2C). In line with this, western blot analysis confirmed that total pulmonary TRPC5 protein expression was higher in TDI-exposed mice than in vehicle-treated controls (Fig. 2D, E). This upregulated TRPC5 expression could be inhibited by treatment with ML204 or AC1903 at a dose of 25 mg/kg (Fig. 2B-D). The effects of ML204 and AC1903 on naive mice were shown in Supplementary Fig. S1.

Fig. 2.

Pulmonary expressions of TRPC5 in TDI-induced asthma. A, Immunohistochemical staining of TRPC5 in mucosal biopsy of asthma subjects (N = 7) and healthy volunteers (N = 13). Scale bar = 50 μm. B, Immunohistochemical staining of TRPC5 in the bronchial (upper panel) and alveolar regions (lower panel) of lungs in different groups. TDI exposure increased the expression of TRPC5 in the infiltrated inflammatory cells and airway epithelium, which was inhibited by specific TRPC5 inhibitors. Scale bar = 50 μm. Original magnification was 400 ×. C, Amplified view of TRPC5 expression in different cell types of TDI-exposed mice from Fig. 1B. Original magnification was 1000 ×. D-F, Protein expression of TRPC5 in lung homogenates was detected by western blot and densitometric analysis was performed. n = 3. ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

Pharmacological inhibition of TRPC5 signaling alleviates TDI-induced airway inflammation and remodeling in vivo

We evaluated the effects of TRPC5 inhibition on a TDI-induced asthma model. TDI sensitization and challenge elicited mixed infiltration of neutrophils and eosinophils in the airway, accompanied by increased airway hyperreactivity (AHR), as well as elevated production of type 2 and non-type 2 cytokines (Fig. 3, Fig. S2). Initially, we tested the effects of 50 mg/kg, 25 mg/kg of ML204 or AC1903 (Zhou et al. 2017) (data of 50 mg/kg not shown) and found that both doses attenuated airway inflammation and AHR, but found no obvious differences between two doses. Therefore, we chose the lower dose for subsequent experiments. Administration with either ML204 or AC1903 at the dose of 25 mg/kg per time after each TDI challenge for a total of 3 times dramatically attenuated airway inflammation and AHR, reduced neutrophils and eosinophils infiltrating in the airway lumen, as well as decreased levels of IL-4, IL-5, IL-13, IL-6 in BALF (Fig. 3, Fig. S2). Yet the elevated levels of IL-1β and IL-18 induced by TDI were not affected (Fig. S2). HMGB1 is a critical epithelia-derived mediator of allergic airway inflammation. Immunohistochemistry (IHC) revealed that HMGB1 was primarily expressed in the nucleus in lungs of control mice, but diffused in both nucleus and cytoplasm of airway epithelial and the infiltrating inflammatory cells after TDI exposure, which was significantly restored by treatment with either ML204 or AC1903 (Fig. 4A). Similar results was obtained from western blot and ELISA (Fig. 4B-D).

Fig. 3.

Inhibition of TRPC5 signaling attenuated TDI-induced airway inflammation and airway hyperresponsiveness (AHR). A, Representative H&E-stained lung sections of different groups. Original magnification was 200 ×. Scale bar = 50 μm. B, Representative H&E-stained cytospin samples from BALF of different groups. Black arrows indicate neutrophils while red indicate eosinophils. Original magnification was 200 ×. Scale bar = 50 μm. C, D, Semiquantification of airway inflammation was performed, n = 5 ~ 8. E, Semiquantification of epithelial denudation was performed. n = 5 ~ 6. F–H, Numbers of total inflammatory cells, neutrophils and eosinophils in BALF. n = 5 ~ 8. I, levels of total IgE in serum. n = 5 ~ 8. J, AHR was measured by lung resistance (R_L). n = 5.^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

Fig. 4.

Pharmacological inhibition of TRPC5 repressed HMGB1 release in TDI-exposed mice. A, Immunohistochemical staining of HMGB1 around the bronchial regions in different groups. Treatment with ML204 or AC1903 repressed TDI-induced HMGB1 nucleocytoplasmic translocation. Original magnifications were 400 × (upper panel, scale bar = 100 μm) and 1000 × (lower panel, scale bar = 20 μm). B, C, Protein expression of HMGB1 in lung homogenates was detected by western blot and densitometric analysis was performed. n = 3. D, Levels of HMGB1 in BALF was detected by ELISA. n = 5 ~ 8. ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

To assess the impact of TRPC5 inhibition on TDI-induced airway remodeling, Masson’s trichrome staining andα-SMA IHC were used to evaluate collagen deposition and airway smooth muscle (ASM) thickening, respectively. As indicated by Fig. S3, TDI exposure induced extensive submucosal collagen deposition and robust ASM thickening, of which TDI-induced collagen deposition was reduced by treatment with ML204 or AC1903, while ASM thickening was not changed (Fig. S3).

Antagonizing of TRPC5 signaling suppressed TDI-induced mucus secretion

Airway mucus hypersecretion, primarily driven by muc5ac overproduction from airway epithelial cells, is another cardinal pathological feature of asthma. And we assessed the effects of ML204 or AC1903 on TDI-induced goblet cell metaplasia and mucus production by PAS staining and IHC of muc5ac, respectively. We found that TDI-exposed mice exhibited pronounced goblet cell metaplasia and muc5ac secretion in the airway epithelium, and these were remarkably inhibited by treatment with ML204 or AC1903 (Fig. 5A-D). Similar results were observed by western blot and qPCR (Fig. 5E-F, H). Furthermore, ELISA indicated that TDI-induced elevation of muc5ac was effectively suppressed by administration with ML204 or AC1903 (Fig. 5G).

Fig. 5.

Blockade of TRPC5 alleviated TDI-induced mucus production. A, Representative PAS-stained lung sections of different groups. And blocking TRPC5 ameliorated TDI-induced goblet cells metaplasia. Original magnification were 200 × (upper panel, scale bar = 100 μm) and 1000 × (lower panel, scale bar = 100 μm). B, Representative immunohistochemistry of muc5ac in the bronchial regions. Treatment with ML204 or AC1903 inhibited muc5ac expression in the airway epithelium. Original magnification were 200 × (upper panel, scale bar = 100 μm) and 1000 × (lower panel, scale bar = 100 μm). C, Semiquantification of PAS staining was performed. The number of PAS-positive epithelial cells to be counted to obtain a percentage to quantify the PAS-positive staining. n = 5 ~ 8. D, Semiquantification of muc5ac staining was performed by ImageJ software. n = 5 ~ 8. E, H, Protein expression of muc5ac in lung homogenates was detected by western blot and densitometric analysis was performed. n = 3. F, Expression of Muc5ac gene (qPCR) in the lung. n = 5 ~ 8; G, level of muc5ac in BALF of different groups was detected by ELISA. n = 5 ~ 7; ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

TRPC5 blockade restrains TDI-induced NLRP3 inflammasome activation

The NLRP3 inflammasome has been proved to drive the pathogenesis of neutrophilic asthma in our previous study (Chen et al. 2019a, b). As expected, IHC showed that TDI inhalation robustly increased pulmonary expression of NLRP3 and its most important effector, caspase-1, which was nearly eliminated by treatment with ML204 or AC1903 (Fig. 6A, B). Similar results were obtained by western blot (Fig. 6C-E). These data suggest that TDI-induced NLRP3 inflammasome activation was partly dependent on TRPC5 signaling.

Fig. 6.

Treatment with either ML204 or AC1903 weakened pulmonary protein expression of NLRP3 and inhibited activation of caspase-1. A, Representative immunohistochemistry of NLRP3 in the bronchial regions (upper panel) and alveolar regions (lower panel). Treatment with ML204 or AC1903 weakened NLRP3 expression. Original magnification was 400 ×. Scale bar = 50 μm. B, Representative immunohistochemistric staining of caspase-1 in the bronchial regions (upper panel) and alveolar regions (lower panel) revealed much more staining after TDI exposure when compared with the control. Original magnification was 400 ×. Scale bar = 50 μm. C-E, Protein expression of NLRP3, procaspase-1 (45KD) and cleaved caspase-1(20KD) in lung homogenates was detected by western blot and densitometric analysis was performed. n = 3. ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

Blockade of NLRP3 signaling inhibited TDI-induced mucus secretion in vivo

To determine whether NLRP3 inflammasome activation mediates TDI-induced mucus secretion, mice were treated with the selective NLRP3 inhibitor MCC950. Treatment with MCC950 mitigated goblet cell metaplasia and muc5ac expression in the airway epithelium (Fig. 7A-D), alleviated muc5ac protein and gene levels in the whole lung (Fig. 7E-F), and inhibited muc5ac release in BALF of TDI-exposed mice (Fig. 7I). Additionally, TDI-induced nucleocytoplasmic translocation of HMGB1 was nearly restored by MCC950 treatment (Fig. 8A). Upregulated expression of HMGB1 in the lung and BALF of TDI-inhaled mice were also decreased by pharmacological inhibition of the NLRP3 inflammasome (Fig. 8B-D). Taken together, these data highlighted a crucial role for the NLRP3 inflammasome in the regulation of TDI-induced mucus secretion.

Fig. 7.

MCC950 alleviated TDI-induced muc5ac secretion. A, Representative PAS-stained lung sections of different groups. And MCC950 alleviated TDI-induced goblet cells metaplasia. Original magnification were 200 × (upper panel, scale bar = 100 μm) and 1000 × (lower panel, scale bar = 100 μm). B, Semiquantification of PAS staining was performed. The number of PAS-positive epithelial cells to be counted to obtain a percentage to quantify the PAS-positive staining. n = 8 ~ 10. C, Immunohistochemistry of muc5ac in the bronchial regions. Treatment with MCC950 inhibited muc5ac expression in the airway epithelium. Original magnification were 200 × (upper panel, scale bar = 100 μm) and 1000 × (lower panel, scale bar = 100 μm). D, Semiquantification of muc5ac staining was performed by ImageJ software. n = 8 ~ 10. E, Expression of Muc5ac gene (qPCR) in the lung. n = 6 ~ 8; F ~ H, Protein expression of muc5ac and NLRP3 in lung homogenates was detected by western blot and densitometric analysis was performed. n = 3. I, level of muc5ac in BALF of different groups was detected by ELISA. n = 6; ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

Fig. 8.

Inactivation of NLRP3 inflammasomes repressed TDI-induced HMGB1 release. A, Staining of HMGB1 around the bronchial regions in different groups. MCC950 repressed TDI-induced HMGB1 nucleocytoplasmic translocation. Original magnifications were 200 × (upper panel, scale bar = 100 μm) and 1000 × (lower panel, scale bar = 20 μm). B, C, Protein expression of HMGB1 in lung homogenates was detected by western blot and densitometric analysis was performed. n = 3. D, Levels of HMGB1 in BALF was detected by ELISA. n = 6. ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

Knockdown of NLRP3 abrogated riluzole-induced MUC5AC secretion in airway epithelial cell

In vitro experiments using the human bronchial epithelial cell line BEAS-2B were performed to validate that TRPC5 regulates MUC5AC secretion via NLRP3 inflammasome activation. As illustrated in Fig. 9, TDI (1 mM) induced increased gene expression of MUC5AC and protein expression of HMGB1, NLRP3 and TRPC5 in BEAS-2B cells. SiRNA-mediated silencing of trpc5 effectively inhibited TDI-induced upregulation of MUC5AC mRNA and HMGB1 protein (Fig. 9A, B). Similarly, nlrp3 siRNA knockdown also blunted TDI-elicited increases in MUC5AC and HMGB1 (Fig. 9C, D). Furthermore, TRPC5 agonist (Riluzole 16 μM) remarkably raised the expression of TRPC5, NLRP3, HMGB1 and MUC5AC in airway epithelial cells. Importantly, nlrp3 siRNA knockdown effectively suppressed riluzole-induced upregulation of MUC5AC and HMGB1 (Fig. 9E, F). These in vitro results confirmed that TRPC5 regulates MUC5AC secretion through activation of the NLRP3 inflammasome.

Fig. 9.

Silence of NLRP3 abrogated Riluzole-induced HMGB1 upregulation and MUC5AC secretion in vitro. A, B, Silence of trpc5 reduced TDI-induced upregulation of HMGB1 and MUC5AC in BEAS-2B cell line, n = 3 ~ 4. C-D, Transfection of sinlpr3 reduced elevated expression of HMGB1 and MUC5AC in TDI-exposed BEAS-2B, n = 3 ~ 4. E–F, TRPC5 agonist (Riluzole 16 μM) raised the expression of TRPC5, NLRP3, HMGB1 and MUC5AC in airway epithelial cells, and knockdown of nlrp3 effectively suppress riluzole-induced upregulation of HMGB1 and MUC5AC. ^*P < 0.05; ^**P < 0.01; ^***P < 0.001. n.s represents none significant differences

Discussion

In the present study, we demonstrated that pharmacological blockade of TRPC5 remarkably alleviated AHR, airway inflammation and airway remodeling in a TDI-induced murine asthma model. Furthermore, TRPC5 inhibition suppressed TDI-induced NLRP3 inflammasome activation and MUC5AC secretion. In vitro, nlrp3 siRNA suppressed riluzole-induced upregulated MUC5AC expression in airway epithelial cells. These findings collectively indicate that TRPC5 mediates MUC5AC overproduction partially through NLRP3 inflammasome in TDI-induced asthma.

Transient receptor potential (TRP) channels are a family of nonselective transmembrane proteins that sense intracellular and extracellular chemical stimulus (Kaneko, & Szallasi 2014). As integrators of multiple signals, TRP channels exhibit a preferential permeability for calcium ions, whose influx triggers the opening of voltage-gated ion channels and initiates a cascade of intracellular signaling events. TRP channels are widely expressed in the body including the respiratory tracts and lungs. In the current study, we observed increased TRPC5 expression in the airway epithelium, airway smooth muscle and vascular smooth muscle cells of both asthmatic patients and TDI-induced asthma model. This finding is consistent with a recent study showing that TRPC5-protein is ubiquitously distributed in human lung tissue (Umlauf et al. 2024), supporting the potential involvement of TRPC5 in pulmonary pathophysiology. Studies have shown that TRPC5 is engaged in mucosal eosinophilic inflammation (Fu et al. 2018) and smooth muscle cells contraction (Chen et al. 2020a, b; Liu et al. 2019a, b), implying that TRPC5 may contribute to asthma pathogenesis. In this study, we demonstrated that pharmacological inhibition of TRPC5 with inhibitors ML204 or AC1903 remarkably reduced TDI-induced AHR, airway eosinophil and neutrophil infiltration, HMGB1 release as well as airway mucus production in mice. These data confirmed that dysregulated TRPC5 expression and activity contribute to the development of TDI-induced asthma. Notably, TRPC5 is primarily known to sense mechanical stress or ligands, ions influx and arachidonic acid metabolites (Grace et al. 2014), and currently no direct evidence supports that TDI would bind to TRPC5. However, TDI exposure may activate TRPC5 indirectly through a diverse series of signaling pathways. The exact mechanisms by which TDI triggers TRPC5 activation and subsequent asthmatic responses requires further investigation.

Airway muc5ac hypersecretion is a hallmark feature of asthma that contributes critically to allergic airway inflammation and remodeling, and is associated with impaired lung function (Ordonez et al. 2001). Our prior studies reported significant upregulation of muc5ac in TDI-induced asthma model (Chen et al. 2019a, b, 2022a), and we confirmed this finding in the current study by demonstrating increased muc5ac protein expression in the lung tissues and enhanced secretion into BALF. Of particular interest, blocking TRPC5 by pharmacological antagonists in TDI-exposed mice or siRNA-mediated silencing of TRPC5 in cultured airway epithelial cells reversed TDI-induced muc5ac overproduction, indicating that TRPC5 contributes to TDI-induced mucus hypersecretion. To our knowledge, this is the first to report a link between TRPC5 signaling and airway muc5ac secretion. Several molecular pathways have been implicated in the abnormal secretion and production of MUC5AC. T helper cells (Th2) cytokines (e.g., IL-4, IL-13) play a key role in asthma pathogenesis by accelerating mucus production in airway epithelial cell (Samsuzzaman et al. 2019). Additionally, various stimuli, including TNF-α, reactive oxygen species (ROS) and bacterial products, can trigger MUC5AC production through activation of epidermal growth factor receptor (EGFR) signaling (Samsuzzaman et al. 2019). In this study, TRPC5 blockade suppressed the TDI-induced increase in Th2 cytokines (IL-4, IL-5, IL-13) in BALF, which may explain the inhibitory effect of ML204 or AC1903 on muc5ac expression, but the exact underlying mechanisms have not been elucidated.

There’s increasing evidence suggesting that the NLRP3 inflammasome signaling is involved in muc5ac regulation. Blocking NLRP3 inflammasome inhibited MUC5AC production in nasal epithelial (Liu et al. 2019a, b), wihle treatment with IL-1β, a classic downstream factor of NLRP3 inflammasome, induced MUC5AC expression in airway epithelial cells (Hu et al. 2021; Song et al. 2003). Consistent with these findings, in the current study we further observed that NLRP3 blockade repressed TDI-induced muc5ac overexpression in the BALF and lung of mice. Additionally, transfection of nlrp3 siRNA reduced MUC5AC gene expression in TDI-treated BEAS-2B. It is well documented that activation of the NLRP3 inflammasome requires integration of multiple nonmutually exclusive upstream signals, including ionic perturbations (efflux of potassium ions, chloride ions, and influx of calcium ions), organellar damage (lysosomal rupture, mitochondrial dysfunction, and trans-Golgi disassembly) and metabolic alterations (Schroder and Tschopp 2010). As a cation channel, TRPC5 primarily senses mechanical stress, ligands, ion influx and arachidonic acid metabolites. Activated TRPC5 drives robust intracellular Ca²⁺ influx, which is an essential priming signal for NLRP3 inflammasome assembly (He et al. 2016). In the current study, we observed that inhibition of TRPC5 signaling blunted NLRP3 inflammasome activation in TDI-exposed mice, leading us to hypothesize that TRPC5 medicates muc5ac secretion through NLRP3 inflammasome. We test this hypothesis in vitro and found that treatment with TRPC5 agonist (Riluzole) increase MUC5AC expression in airway epithelial cells, which could be suppressed by nlrp3 siRNA knockdown. These in vitro findings confirmed that TRPC5 regulates MUC5AC secretion partially through the activation of the NLRP3 inflammasome, but the exact mechanism by which TRPC5 regulates NLRP3 inflammasome need to be explored in the future.

A limitation of the present study is the lack of direct evidence for the molecular interaction between TRPC5 and the NLRP3 inflammasome. To date, evidence directly linking TRPC5 to NLRP3 signaling remains limited. Until 2024, Li et.al demonstrated that CaMKII and HDAC4 serve as critical intermediates connecting TRPC5-mediated NLRP3 upregulation in the myocardial cell (Li et al. 2024), further adding to our hypothesis. Future studies should explore the specific signaling molecules that link TRPC5 activation to the NLRP3 inflammasome assembly. Additionally, the use of pharmacological modulators but not in vivo gene-knockout could not fully exclude off-target effects. Actually, siRNA experiments in vitro were performed, supporting our conclusion to a certain degree. As for off-target effects, we acknowledged the possible non-specific binding of ML204 to other TRPC family ions (such as TRPC4) by referring to the existing target selectivity data of ML204. But the consistent therapeutic effects of AC1903 (specific to TRPC5) and ML204 reduce the possibility that the observed anti-asthma effects are caused by off-target actions. Meanwhile, we will propose follow-up studies with gene-deficient mice to fully confirm causality and verify the specificity of the inhibitors in our future research.

In summary, we proved that TRPC5 plays a pivotal role in the pathogenesis of TDI-induced asthma. Specifically, TRPC5 mediates MUC5AC overexpression by partially activating the NLRP3 inflammasome in the bronchial epithelium. These findings identified TRPC5 as a novel therapeutical target for the prevention and treatment of severe asthma.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

AHR

Airway hyperresponsiveness

ANOVA

One-way analysis of variance

ASM

Airway smooth muscle

α-SMA

α-Smooth muscle actin

ATCC

American Type Culture Collection

BALF

Bronchoalveolar lavage fluid

BSA

Bovine serum albumin

CO₂

Carbon dioxide

DMEM

Dulbecco’s Modified Eagle Medium

DMSO

Dimethyl sulfoxide

ELISA

Enzyme-linked immunosorbent assay

FBS

Fetal bovine serum

HDM

House dust mite

HMGB1

High-mobility group box 1

H&E

Haematoxylin and eosin

H₂O₂

Hydrogen peroxide

IgE

Immunoglobulin E

MUC5AC

Mucin 5ac

OVA

Ovalbumin

PAS

Periodic acid-Schiff

PVDF

Polyvinylidene difluoride

SDS

Sodium dodecyl sulfate

SPF

Specific pathogen-free

siRNA

Small interfering RNA

TDI

Toluene diisocyanate

TRPC5

Transient receptor potential canonical channel 5

TRP

Transient receptor potential channels

qPCR

Quantitative polymerase chain reaction

Author contributions

C. S. and C.R. designed the experiment, analyzed data and wrote the manuscript. C. S., L.Y., H.Z. and Y. K. performed the experiments. Y. L., Z. L., M.W., C.Z. and C.S. helped with the experiments. F.Y. and W.L. helped with data analysis and revised the manuscript. All the authors agreed that the final approval of the version to be published and ensured questions relating to the accuracy or integrity of any part of the work were appropriately investigated and resolved.

Funding

This study was supported by Shenzhen Medical Research Funds (A2303030, A2403011), National Natural Science Foundation of China (82100023, 82170042, 82200080), Shenzhen Science and Technology Program (JCYJ20250604142040011, JCYJ20210324114400001), the National Key R&D Program of China (2022YFF0710800, 2022YFF0710801) and the grant from the Shenzhen Clinical Research Center for Respiratory Disease (20220819095941004) and Shenzhen Key Laboratory of Respiratory Diseases (SYSPG20241211173920041), Shenzhen Institute of Respiratory Disease, Shenzhen People’s Hospital.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethical approval

This study was approved by the Ethics Committee of Shenzhen Peoples’ Hospital (NO. LL-KY-2023183–01). Written informed consent was obtained from all enrolled subjects prior to sample collection. All animal care and experimental procedures were conducted in accordance to the guidelines of the use and care of animals and were approved by the Animal Subjects Committee of Shenzhen People’s Hospital (NO. LL-KY-2021337). 

Consent for publish

Not applicable. 

Conflict of interest

The authors declare that there are no conflicts of interest.