Replacing a farm-mixed diet with a commercial complete feed increases laying rate and is associated with physiological and cecal microbial changes in late-laying local crossbred hens

Abstract

This study examined the response to replacing a farm-mixed diet with a commercial complete feed in late-laying local crossbred hens. A total of 60 hens, approximately 350 d of age, were assigned to a 2 × 2 factorial design with genetic background and diet as factors, with 15 individually housed hens per treatment combination. The trial lasted 42 d. Laying performance was recorded throughout the trial, and egg quality was assessed on d 21 and 42. Serum indices were measured in 4 hens per treatment combination at each sampling time; reproductive traits, hepatic gene expression, and cecal microbiota were assessed on d 42. The diets had similar metabolizable energy and crude protein concentrations but differed in other nutrients and ingredients. The complete feed increased laying rate during both periods (P < 0.01). On d 21, diet affected egg length-to-width ratio, albumen height, Haugh unit, and yolk color. On d 42, diet affected yolk color, and genetic background × diet interactions were detected for albumen height and Haugh unit (P < 0.05). The complete feed decreased serum malondialdehyde and increased total superoxide dismutase and glutathione peroxidase activities on d 21; catalase and total superoxide dismutase activities were higher on d 42 (P < 0.05). Serum anti-Müllerian hormone was lower with the complete feed at both times (P < 0.05), whereas large white follicle counts were higher (P < 0.05). Hepatic CAT, GPX1, and SOD1 expression showed genetic background × diet interactions (P < 0.05). Cecal community structure differed among treatment combinations (P = 0.001); taxon-level comparisons were exploratory. The design does not identify the individual dietary components responsible for these responses. Replacing the farm-mixed diet increased laying rate and was accompanied by selected physiological and microbial differences, although production-scale studies that measure feed intake and feed cost per egg are needed before this feeding strategy can be recommended.

Introduction

Maintaining egg production during late laying requires sustained reproductive and metabolic function as hens age (Huang et al., 2025). Laying persistency and egg quality generally decline with age, often alongside lower antioxidant capacity and greater lipid peroxidation (Hao et al., 2021; Liu et al., 2023). These changes involve nutrient utilization, ovarian activity, and tissue metabolism (Tang et al., 2023). The liver supplies lipids and yolk precursors for follicular development, and the oviduct secretes albumen and forms the eggshell (Liu et al., 2018; Gao et al., 2025). The function of both tissues is therefore relevant to egg production during late laying.

Dietary management can help maintain production after peak lay (Khatibi et al., 2021). Farm-mixed diets depend on local ingredient availability and formulation practices, so replacing them with a commercial complete feed changes several dietary components at once. Energy and protein support egg production and tissue maintenance (Hu et al., 2024; Li et al., 2024). Calcium and phosphorus support eggshell mineralization and bone mineral metabolism, which are important in aging hens (Fu et al., 2024; Garcia-Mejia et al., 2024). Sodium and chloride contribute to osmotic and acid–base balance, and dietary electrolyte balance may affect laying performance and eggshell quality (Fu et al., 2021). Dietary fat and fiber may also influence hepatic lipid metabolism, intestinal function, nutrient utilization, and the substrates available to gut microbes (Jha and Mishra, 2021; Tejeda and Kim, 2021).

Dietary composition may affect redox status, reproductive endocrine activity, and the intestinal microbial community as well as nutrient supply. The demands of yolk deposition, albumen secretion, and eggshell mineralization during late laying may increase oxidative stress (Chen et al., 2024). Serum redox indices and lipid peroxidation products describe circulating oxidative status, and hepatic antioxidant-related gene expression provides information at the tissue level (Xie et al., 2019; Zhan et al., 2019). Anti-Müllerian hormone (AMH), associated mainly with small and prehierarchical follicles, may provide further information on follicular activity (Johnson, 2015; Huang et al., 2021). Circulating AMH nevertheless needs to be interpreted alongside follicular development and reproductive performance (Sun et al., 2021). Cecal microbial composition responds to diet and has been associated with nutrient utilization, production performance, and egg quality in laying hens (Guo et al., 2017; Zhan et al., 2019). Measuring these traits together may help characterize the response to dietary replacement.

Responses to dietary replacement may differ among genetic backgrounds. Local chickens and their crosses differ from highly selected commercial laying strains in feeding behavior, digestive capacity, metabolism, reproductive performance, and gut microbial composition (Berukilukilu et al., 2024; Wu et al., 2025). Host genetic background has also been associated with nutrient utilization, microbial colonization, and production traits (Zhao et al., 2013; Zhang et al., 2024b; Ren et al., 2026). Whether different local crossbred populations respond similarly to replacement of a farm-mixed diet during late laying remains unclear. We therefore used a 2 × 2 factorial design to examine the effects of genetic background, diet, and their interaction on laying performance, egg quality, reproductive traits, follicle counts, serum redox indices and AMH, hepatic CAT, GPX1, and SOD1 expression, and cecal microbiota. We hypothesized that the commercial complete feed would increase laying rate. Redox-related traits, AMH, and microbial composition were evaluated as secondary, exploratory outcomes. The comparison concerned whole diets and was not designed to isolate a single nutrient effect.

Materials and methods

Animal ethics statement

All animal procedures were approved by the Animal Care and Use Committee of Nanjing Agricultural University (protocol NJAU.No20260911230) and followed institutional guidelines and the Guide for the Care and Use of Agricultural Animals in Research and Teaching. Animal handling, feeding, sample collection, and euthanasia followed a pre-established protocol, with measures to minimize stress and discomfort.

Animals, experimental design, and management

Treatments were arranged in a 2 × 2 factorial design, with genetic background and diet as the two fixed factors. The genetic backgrounds were Huainanwang × Jinghong No. 1 and Tianchang Sanhuang × Jinghong No. 1 crossbred hens, and the dietary treatments were a farm-mixed diet and a commercial complete feed. At the beginning of the experiment, the hens were approximately 350 d of age and had passed peak egg production according to farm production records. Within each genetic background, hens were randomly assigned to the two dietary treatments. A total of 60 hens were used, with 15 hens in each treatment combination: HJ, Huainanwang × Jinghong No. 1 hens fed the farm-mixed diet; EHJ, Huainanwang × Jinghong No. 1 hens fed the commercial complete feed; TJ, Tianchang Sanhuang × Jinghong No. 1 hens fed the farm-mixed diet; and ETJ, Tianchang Sanhuang × Jinghong No. 1 hens fed the commercial complete feed. Each hen was housed individually and served as the experimental unit.

Hens were housed individually in cages in a naturally ventilated poultry house. Each hen was individually identified, and egg production was recorded daily throughout the experiment. Feed was offered at 120 g/hen per day, and water was provided ad libitum. Orts were not recorded; therefore, actual feed intake was not determined. A 16L:8D lighting schedule was maintained throughout the study. The average house temperature and relative humidity were approximately 25 °C and 77%, respectively. Manure was removed daily, the poultry house was disinfected regularly, and flock health was monitored throughout the study. Vaccination and routine husbandry followed the farm’s standard management practices.

The experiment lasted 42 d. Laying performance was evaluated separately for d 0 to 21 and d 22 to 42 using records from all 15 hens per treatment combination. Egg quality was assessed on d 21 and 42 using one freshly laid, intact egg from each hen (n = 15 per treatment combination at each sampling time). The first intact egg obtained from each hen within each sampling window was used. Serum redox indices and AMH were measured in 4 hens per treatment combination at each sampling time, with different hens sampled on d 21 and 42. After blood collection on d 42, trained personnel euthanized the sampled hens by cervical dislocation. The liver, ovary, oviduct, and cecal digesta were collected immediately to assess organ traits, follicle counts, hepatic gene expression, and cecal microbiota.

Experimental diets

The ingredient composition and nutrient contents of the experimental diets are presented in Table 1. The farm-mixed diet was prepared according to the farm’s formulation records, whereas the commercial complete feed was supplied by Anhui Tianzhu Feed Co., Ltd. (Tianchang, Anhui, China). The diets were similar in metabolizable energy and crude protein but differed in ingredient composition and in several nutrient contents. Compared with the farm-mixed diet, the commercial complete feed contained less ether extract and more calcium and total phosphorus, and included sodium chloride, dicalcium phosphate, and wheat bran.

Table 1.

Ingredient composition and calculated and analyzed nutrient levels of the experimental diets on an air-dry basis.

Item	Farm-mixed diet	Commercial complete feed
Ingredient composition, %
Corn	58.99	57.00
Soybean meal	25.80	25.00
Wheat bran	0.00	3.00
Limestone	8.20	8.00
Soybean oil	2.00	0.00
Premixa	4.99	4.99
Sodium chloride	0.00	0.40
Dicalcium phosphate	0.00	1.60
Calculated and analyzed nutrient levelsb
Metabolizable energy, kcal/kg (MJ/kg)	2,651 (11.09)	2,629 (11.00)
Crude protein, %	16.10	16.20
Ether extract, %	4.72	2.80
Ash, %	11.20	11.30
Crude fiber, %	2.73	2.90
Calcium, %	3.20	3.45
Total phosphorus, %	0.33	0.60
Lysine, %	0.84	0.78
Methionine, %	0.26	0.28
Methionine + cystine, %	0.56	0.58

Notes:

^aThe vitamin-mineral premix provided the following per kilogram of diet: vitamin A, 7,000 IU; vitamin D3, 3,000 IU; vitamin E, 15 IU; vitamin K3, 2 mg; vitamin B1, 1 mg; vitamin B2, 5 mg; vitamin B6, 3 mg; vitamin B12, 0.01 mg; nicotinic acid, 30 mg; calcium pantothenate, 10 mg; folic acid, 0.5 mg; biotin, 0.05 mg; choline chloride, 500 mg; Fe, 60 mg; Cu, 8 mg; Mn, 80 mg; Zn, 60 mg; I, 0.35 mg; and Se, 0.30 mg.

^bMetabolizable energy was calculated and expressed as kcal/kg, with MJ/kg values retained in parentheses; crude protein, ether extract, ash, crude fiber, calcium, total phosphorus, lysine, methionine, and methionine plus cystine were analyzed using representative feed samples. All nutrient values are expressed on an air-dry basis. Ingredient proportions may not total 100% because of rounding.

Representative samples of each diet were analyzed for crude protein, ether extract, ash, crude fiber, calcium, total phosphorus, lysine, methionine, and methionine plus cystine (Table 1). Metabolizable energy was calculated from formulation records and was not determined by bioassay. Dietary yolk pigment concentrations were not analyzed. Nutrient contents are reported on an air-dry basis.

Laying performance

Egg production and survival were recorded daily for each hen throughout the 42-d experiment. Cracked, shell-less, and soft-shelled eggs were included in the laying-rate calculation. Laying rate was calculated separately for each hen during d 0 to 21 and d 22 to 42 as follows:

$$\text{Laying}\text{rate}(\%)=\frac{\text{number}\text{of}\text{eggs}\text{produced}\text{by}\text{an}\text{individual}\text{hen}}{\text{number}\text{of}\text{days}\text{that}\text{the}\text{hen}\text{remained}\text{in}\text{the}\text{experiment}}\times 100$$

Egg quality measurement

On d 21 and 42, one freshly laid, intact egg was collected from each hen (n = 15 per treatment combination at each sampling time). Eggs were evaluated within a consistent interval after collection to limit variation due to storage duration and environmental conditions. Measurements included egg weight, yolk weight, egg length, egg width, egg length-to-width ratio, albumen height, Haugh unit, yolk color, and eggshell strength.

Egg weight and yolk weight were determined using a calibrated electronic balance. Egg length and width were measured using a digital caliper (500-196-30, Mitutoyo Corp., Kawasaki, Japan), and the egg length-to-width ratio was calculated by dividing egg length by egg width. Albumen height, Haugh unit, and yolk color were measured using an automatic egg-quality analyzer (EMT-7300, Robotmation Co., Ltd., Tokyo, Japan). Eggshell strength was measured using an eggshell strength tester (KQ-1A, Beijing Tianxiang Feiyu Technology Co., Ltd., Beijing, China). Measurements followed the manufacturers’ instructions. The individual hen was the experimental unit, with one egg per hen providing one observation at each sampling time.

Blood and tissue collection and reproductive organ measurements

On d 21 and 42, 4 hens per treatment combination were randomly selected for blood collection, with different hens sampled at the two time points. After a 12-h feed withdrawal, approximately 2 mL of blood was collected from the wing vein into evacuated tubes without anticoagulant. The feed withdrawal may have affected serum redox-related indices. Blood samples were allowed to clot at 4 °C for 30 min and were then centrifuged at 3,000 × g for 15 min at 4 °C. Serum was divided into aliquots and stored at −80 °C until analysis of redox-related indices and AMH.

After blood collection on d 42, the sampled hens were euthanized by cervical dislocation. The liver, ovary, oviduct, and cecal digesta were collected immediately. Liver, ovary, and oviduct weights were recorded using an electronic balance, and oviduct length was measured using a flexible ruler.

Visible ovarian follicles were assigned to three categories: small white follicles (SWF), large white follicles (LWF), and small yellow follicles (SYF). Small white follicles were defined as white follicles 2 to 4 mm in diameter without visible yolk deposition. Large white follicles were defined as white follicles 4 to 6 mm in diameter without obvious yolk deposition, and SYF were defined as yellow follicles 6 to 8 mm in diameter with visible yolk deposition but not yet incorporated into the preovulatory hierarchy. Classification was based on follicle diameter, color, and developmental morphology. Preovulatory hierarchical follicles were not counted. Follicles included in these categories were counted by the same operator using consistent criteria. Liver samples were snap-frozen in liquid nitrogen and stored at −80 °C for subsequent gene-expression analysis. Cecal digesta were also snap-frozen in liquid nitrogen and stored at −80 °C until microbial DNA extraction.

Serum redox-related indices and anti-müllerian hormone measurement

Serum catalase (CAT), malondialdehyde (MDA), total antioxidant capacity (T-AOC), total superoxide dismutase (T-SOD), glutathione peroxidase (GSH-Px), and AMH were measured using commercial assay kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The catalog numbers were A007-1-1, A003-1-2, A015-1-2, A001-1-2, A005-1-2, and H324-1-2, respectively. CAT activity was determined using the ammonium molybdate method, MDA concentration using the thiobarbituric acid method, T-SOD activity using the hydroxylamine method, and T-AOC and GSH-Px activity using the corresponding colorimetric methods. Serum AMH concentration was measured by ELISA. All assays were performed as specified by the manufacturers. The species specificity of the AMH kit for chicken AMH was not independently validated; AMH values were therefore interpreted as relative differences among treatments. Samples were analyzed in duplicate, and the mean of the duplicate measurements was used as the observation for each hen.

RNA extraction and quantitative real-time PCR

Approximately 50.0 to 60.0 mg of liver tissue was homogenized in 1.00 mL of TRIzol reagent (Vazyme, Nanjing, China). Total RNA was isolated following the manufacturer’s instructions. RNA concentration and purity were evaluated spectrophotometrically, and RNA integrity was examined by agarose gel electrophoresis. Samples with A260/A280 ratios of 1.8 to 2.0 and satisfactory electrophoretic quality were retained for reverse transcription. First-strand cDNA was synthesized using 5 × All-in-One RT MasterMix (AbmGood, Nanjing, China).

Quantitative real-time PCR was carried out on a LightCycler 96 Real-Time PCR System (Roche, Basel, Switzerland) using SYBR Green chemistry. The 20-μL reaction mixture comprised 10 μL of 2 × qPCR Mix, 0.4 μL each of forward and reverse primers (10 μM), 2 μL of cDNA, and 7.2 μL of nuclease-free water. Amplification followed the manufacturer’s recommended protocol, and product specificity was evaluated by melting-curve analysis. Each biological sample was assayed in technical triplicate, and the average cycle threshold value was used for analysis. Transcript abundance was normalized to ACTB as the sole reference gene and calculated using the 2^−ΔΔCt method. Primer sequences and corresponding GenBank accession numbers are provided in Table 2.

Table 2.

Primer information used for quantitative real-time PCR analysis.

Gene	Accession No.	Forward primer (5′–3′)	Reverse primer (5′–3′)	Product size, bp
SOD1	NM_205064.2	TGACCTCGGCAATGTGACTG	CATGGTACGGCCAATGATGC	103
CAT	NM_001031215.2	ACCAAGTACTGCAAGGCGAA	CCCAGATTCTCCAGCACAAGT	90
GPX1	NM_001277853.3	CACCATGTTCGAGAAGTGCG	TACTGCGGGTTGGTCATCAG	120
ACTB	NM_205518.2	TGAACCCCAAAGCCAACAGAG	TCACCAGAGTCCATCACAATACCA	142

Notes: SOD1, superoxide dismutase 1; CAT, catalase; GPX1, glutathione peroxidase 1; ACTB, β-actin. ACTB was used as the reference gene.

Cecal microbiota sequencing and bioinformatics analysis

Microbial DNA extraction and 16S RRNA gene sequencing

Cecal digesta collected on d 42 from 4 biologically independent hens per treatment combination were immediately frozen in liquid nitrogen and stored at −80 °C until analysis. Approximately 0.20 g of each sample was suspended in lysis buffer and homogenized at 60 Hz using a multi-sample tissue grinder (Tissuelyser-48, Jingxin, Shanghai, China). Microbial genomic DNA was extracted using the MagBeads FastDNA Kit for Soil (catalog no. 116564384; MP Biomedicals, CA, USA) according to the manufacturer’s instructions. DNA concentration and purity were assessed using a NanoDrop microvolume spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and DNA integrity was examined by 0.8% agarose gel electrophoresis. DNA samples meeting the quality requirements were used for subsequent PCR amplification and sequencing.

The V3–V4 region of the bacterial 16S rRNA gene was amplified using primers 338F (5′-ACTCCTACGGGAGGCAGCA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). A sample-specific barcode of 7 to 10 bp was attached to the 5′ end of the forward primer. PCR amplification was performed in a final volume of 25 μL containing 0.25 μL of DNA polymerase (ABclonal Technology, Wuhan, China), 5 μL of 5 × Reaction Buffer, 5 μL of 5 × High GC Buffer, 2 μL of dNTPs (10 mM), 2 μL of template DNA, 1 μL of each primer (10 μM), and 8.75 μL of nuclease-free water. The amplification program consisted of initial denaturation at 98 °C for 5 min; 26 cycles of denaturation at 98 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 45 s; and a final extension at 72 °C for 5 min.

PCR products were examined by 2% agarose gel electrophoresis, purified, and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen, Carlsbad, CA, USA). Purified amplicons were pooled in equimolar amounts. Sequencing libraries were prepared using the TruSeq Nano DNA LT Library Prep Kit (Illumina, San Diego, CA, USA), purified using AMPure XP beads (Beckman Coulter, Brea, CA, USA), and evaluated using an Agilent Bioanalyzer with a High Sensitivity DNA Kit. Qualified libraries were quantified using PicoGreen, pooled at equimolar concentrations, and denatured with 0.1 N NaOH. Paired-end sequencing (2 × 250 bp) was performed on an Illumina NovaSeq 6000 platform using the NovaSeq 6000 SP Reagent Kit (500 cycles). Library preparation and sequencing were conducted by Shanghai Personal Biotechnology Co., Ltd. (Shanghai, China).

Sequence processing and taxonomic assignment

Raw sequence data were processed using QIIME 2 (version 2022.11). Reads were demultiplexed, and barcode and primer sequences were removed using cutadapt. Quality filtering, denoising, paired-end read merging, and chimera removal were performed using DADA2. The retained sequences were resolved into amplicon sequence variants (ASVs), and an ASV abundance table was generated. Non-singleton ASVs were aligned using MAFFT, and a phylogenetic tree was constructed using FastTree 2. Taxonomic classification was performed using the classify-sklearn naïve Bayes classifier implemented in the QIIME 2 feature-classifier plugin against the SILVA release 138 reference database.

Microbial diversity and differential taxa analyses

Before diversity analyses, the ASV abundance table was rarefied to a uniform depth of 10,000 sequences per sample. Alpha diversity was evaluated using Chao1 richness, Shannon diversity, and Rao’s quadratic entropy. The effects of genetic background, diet, and their interaction on these indices were evaluated using the two-way ANOVA model described in the Statistical Analysis section. When an interaction was detected, simple-effects analyses were performed.

Beta diversity was quantified using weighted and unweighted UniFrac, Jaccard, and Bray–Curtis distances. Differences in microbial community structure were visualized using principal coordinates analysis, nonmetric multidimensional scaling, and unweighted pair-group method with arithmetic mean clustering. Overall differences in cecal microbial community structure among the 4 treatment combinations were evaluated by permutational multivariate analysis of variance (PERMANOVA) based on Bray–Curtis dissimilarities with 999 permutations. This analysis evaluated overall separation among treatment combinations and did not partition the individual effects of genetic background, diet, and their interaction. Cecal microbiota results were treated as exploratory and were not used to infer a causal mechanism for the laying-rate response.

Taxonomic composition was summarized from the ASV annotations and visualized using R (version 4.4.2). Shared and treatment-specific ASVs were descriptively illustrated using the VennDiagram package (version 1.7.0). Prespecified pairwise comparisons between EHJ and HJ and between ETJ and TJ were performed using Student’s t test, whereas differences among all 4 treatment combinations were evaluated using the Kruskal–Wallis test. Taxonomic comparisons were considered exploratory, and the resulting P-values were not adjusted for multiple comparisons. Accordingly, taxa with nominal P < 0.05 were retained as candidate differentially abundant taxa.

Linear discriminant analysis effect size (LEfSe) analysis was performed using P < 0.05 and a linear discriminant analysis score > 2.0 as the screening criteria. Taxa identified by these analyses were considered group-associated taxonomic features rather than confirmed microbial biomarkers.

Statistical analysis

Statistical analyses of laying performance, egg-quality traits, reproductive organ traits, follicle counts, serum redox-related indices, serum AMH concentrations, and hepatic antioxidant-related gene expression were performed using SPSS Statistics 24.0 (IBM Corp., Armonk, NY, USA). The individual hen was considered the experimental unit. Data were analyzed using a two-way ANOVA model that included the fixed effects of genetic background, diet, and their interaction:

$$Y_{ijk}=\mu +B_i+D_j+{(B\times D)}_{ij}+e_{ijk}$$

where $Y_{ijk}$is the observed response, $\mu$is the overall mean, $B_i$is the fixed effect of genetic background, $D_j$is the fixed effect of diet, ${\left(B\times D\right)}_{ij}$is their interaction, and $e_{ijk}$is the residual error. When a genetic background × diet interaction was detected, the interaction was followed by pairwise comparisons of the two diets within each genetic background, adjusted for multiple comparisons using Tukey’s test. The same procedure was used to compare genetic backgrounds within each diet when that effect was the focus. Main effects were interpreted only when no interaction was detected.

Laying rate was analyzed separately for the prespecified periods of d 0 to 21 and d 22 to 42. Egg-quality traits, serum redox indices, and serum AMH were analyzed separately at each sampling time. These analyses estimated genetic-background and dietary effects within each period or sampling time; they did not test time effects or interactions involving time. Reproductive organ traits, follicle counts, and hepatic gene expression were analyzed using d 42 measurements. Residual normality and homogeneity of variance were evaluated using the Shapiro–Wilk and Levene tests, respectively. Data were transformed when necessary to satisfy model assumptions; untransformed means are presented. Results are presented as means with standard errors of the mean (mean ± SEM). Differences were considered significant at P < 0.05.

Microbial community structure and taxonomic comparisons were analyzed as described under Cecal Microbiota Sequencing and Bioinformatics Analysis. The PERMANOVA assessed overall separation among the 4 treatment combinations rather than individual genetic-background or dietary effects. Taxon-level P-values were unadjusted and were treated as nominal values for exploratory comparisons. Figures were generated using GraphPad Prism 10.2.3 (GraphPad Software, Boston, MA, USA) and R version 4.4.2 (R Foundation for Statistical Computing, Vienna, Austria).

Results

Laying performance

Laying performance is summarized in Table 3. Across genetic backgrounds, hens fed the commercial complete feed had higher laying rates than those fed the farm-mixed diet during both d 0 to 21 and d 22 to 42 (P < 0.01). Neither a genetic-background effect nor a genetic background × diet interaction was detected for laying rate during either period (P > 0.05). No mortality occurred during the experiment.

Table 3.

Effects of genetic background and diet on laying rate in late-laying local crossbred hens.

Effect	Level	Laying rate, d 0 to 21, %	Laying rate, d 22 to 42, %
Treatment combination	HJ	77.00 ± 3.61	77.00 ± 3.87
	EHJ	91.00 ± 3.61	92.00 ± 3.10
	TJ	69.00 ± 4.91	70.00 ± 4.91
	ETJ	88.00 ± 2.58	90.00 ± 2.32
Genetic background	H × J	84.00 ± 4.13	85.00 ± 3.87
	T × J	79.00 ± 4.65	80.00 ± 4.65
Diet	Farm-mixed	73.00 ± 4.39b	73.00 ± 4.39b
	Commercial	90.00 ± 3.10a	91.00 ± 2.84a
P-value	Diet	<0.001	<0.001
	Genetic background	0.112	0.133
	Genetic background × diet	0.347	0.517

Notes: Values are presented as mean ± SEM. The individual hen was considered the experimental unit (n = 15 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. Within a column and main-effect comparison, means with different lowercase superscripts differ (P < 0.05); exact significance levels are provided in the P-value rows.

Egg quality

Egg-quality measurements are presented in Table 4. On d 21, the commercial complete feed increased egg length-to-width ratio (P < 0.05), albumen height, Haugh unit, and yolk color score (P < 0.01). Egg weight, eggshell strength, and yolk weight did not differ between diets (P > 0.05).

Table 4.

Effects of genetic background and diet on egg-quality traits in late-laying local crossbred hens on d 21 and 42.

Effect	Level	Egg weight, g	Eggshell strength, N	Egg length-to-width ratio	Yolk weight, g	Albumen height, mm	Haugh unit	Yolk color
21 d
Treatment combination	HJ	51.88 ± 1.23	45.68 ± 2.58	1.28 ± 0.01	15.47 ± 0.22	5.37 ± 0.65	70.98 ± 5.87	7.27 ± 0.40
	EHJ	53.04 ± 0.77	44.02 ± 1.37	1.29 ± 0.01	16.23 ± 0.21	7.37 ± 0.71	86.24 ± 3.10	9.38 ± 0.27
	TJ	53.75 ± 0.92	36.50 ± 2.43	1.30 ± 0.01	16.97 ± 0.41	6.14 ± 0.21	78.87 ± 2.07	8.20 ± 0.18
	ETJ	56.33 ± 1.27	39.04 ± 1.24	1.36 ± 0.01	17.52 ± 0.22	10.71 ± 1.11	99.68 ± 4.88	9.68 ± 0.28
Genetic background	H × J	52.46 ± 1.01	44.85 ± 2.01a	1.29 ± 0.01b	15.85 ± 0.23b	6.37 ± 0.71b	78.61 ± 4.99	8.32 ± 0.43
	T × J	55.04 ± 1.13	37.77 ± 1.90b	1.33 ± 0.01a	17.25 ± 0.33a	8.42 ± 0.99a	89.28 ± 4.57	8.94 ± 0.30
Diet	Farm-mixed	52.82 ± 1.08	41.09 ± 2.72	1.29 ± 0.01b	16.22 ± 0.37	5.75 ± 0.48b	74.93 ± 4.40b	7.73 ± 0.33b
	Commercial	54.69 ± 1.11	41.53 ± 1.43	1.33 ± 0.02a	16.88 ± 0.27	9.04 ± 1.01a	92.96 ± 4.35a	9.53 ± 0.27a
P-value	Diet	0.184	0.866	0.015	0.075	0.002	0.002	<0.001
	Genetic background	0.070	0.012	0.004	<0.001	0.039	0.061	0.114
	Genetic background × diet	0.612	0.422	0.101	0.768	0.189	0.617	0.411
Effect	Level	Egg weight, g	Eggshell strength, N	Egg length-to-width ratio	Yolk weight, g	Albumen height, mm	Haugh unit	Yolk color
42 d
Treatment combination	HJ	55.97 ± 1.19	40.41 ± 2.79	1.26 ± 0.02	16.28 ± 0.44	7.86 ± 0.79ab	87.74 ± 3.57ab	5.24 ± 0.71
	EHJ	60.17 ± 3.59	46.04 ± 2.08	1.29 ± 0.01	17.48 ± 0.38	8.67 ± 0.63ab	92.91 ± 2.80ab	6.39 ± 0.89
	TJ	55.73 ± 0.90	41.03 ± 1.84	1.34 ± 0.01	17.69 ± 0.43	9.07 ± 0.65a	95.23 ± 2.96a	5.88 ± 0.61
	ETJ	54.10 ± 0.70	36.78 ± 2.13	1.35 ± 0.01	18.30 ± 0.34	6.03 ± 0.73b	74.34 ± 6.04b	9.83 ± 0.25
Genetic background	H × J	58.07 ± 2.66	43.22 ± 2.50	1.28 ± 0.01b	16.88 ± 0.43b	8.26 ± 0.70	90.33 ± 3.19	5.82 ± 0.79b
	T × J	54.92 ± 0.81	38.90 ± 2.01	1.34 ± 0.01a	17.99 ± 0.38a	7.55 ± 0.78	84.79 ± 5.39	7.86 ± 0.69a
Diet	Farm-mixed	55.85 ± 1.03	40.72 ± 2.29	1.30 ± 0.02	16.98 ± 0.46	8.46 ± 0.72	91.49 ± 3.33	5.56 ± 0.65b
	Commercial	57.13 ± 2.64	41.41 ± 2.38	1.32 ± 0.01	17.89 ± 0.37	7.35 ± 0.75	83.63 ± 5.19	8.11 ± 0.78a
P-value	Diet	0.619	0.813	0.136	0.089	0.228	0.143	0.005
	Genetic background	0.226	0.144	<0.001	0.039	0.438	0.298	0.021
	Genetic background × diet	0.262	0.097	0.774	0.573	0.041	0.018	0.106

Notes: Values are presented as mean ± SEM. The individual hen was considered the experimental unit (n = 15 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. Within the same time point, column, and comparison, means with different lowercase superscripts differ (P < 0.05); exact significance levels are provided in the P-value rows. When a significant genetic background × diet interaction was detected, simple-effect comparisons among the four treatment combinations were adjusted using Tukey’s multiple-comparison test; in these cases, main effects should be interpreted with caution.

Eggshell strength was greater in Huainanwang × Jinghong No. 1 hens than in Tianchang Sanhuang × Jinghong No. 1 hens on d 21 (P < 0.05). In contrast, Tianchang Sanhuang × Jinghong No. 1 hens had a greater egg length-to-width ratio and yolk weight (P < 0.01) and greater albumen height (P < 0.05). No genetic background × diet interaction was detected for any egg-quality trait on d 21 (P > 0.05).

On d 42, yolk color score was greater in hens receiving the commercial complete feed than in those receiving the farm-mixed diet (P < 0.01). No dietary main effect was detected for the other egg-quality traits (P > 0.05). Tianchang Sanhuang × Jinghong No. 1 hens had a greater egg length-to-width ratio (P < 0.01) and greater yolk weight and yolk color score (P < 0.05) than Huainanwang × Jinghong No. 1 hens.

Genetic background × diet interactions were detected for albumen height and Haugh unit on d 42 (P < 0.05). Within the Tianchang Sanhuang × Jinghong No. 1 background, both traits were lower in hens fed the commercial complete feed than in hens fed the farm-mixed diet (P < 0.05). Neither trait differed between diets within the Huainanwang × Jinghong No. 1 background (P > 0.05).

Reproductive organ and liver traits

Organ measurements obtained on d 42 are presented in Table 5. Liver weight was greater in hens fed the commercial complete feed than in those fed the farm-mixed diet (P < 0.05). Oviduct weight, oviduct length, and ovary weight did not differ between diets (P > 0.05). No effects of genetic background or its interaction with diet were detected for the measured organ traits (P > 0.05).

Table 5.

Effects of genetic background and diet on organ weights and oviduct length in late-laying local crossbred hens on d 42.

Effect	Level	Liver weight, g	Oviduct weight, g	Oviduct length, cm	Ovary weight, g
Treatment combination	HJ	36.40 ± 1.74	41.63 ± 3.61	51.80 ± 4.60	3.65 ± 0.48
	EHJ	48.63 ± 7.20	45.23 ± 3.46	60.88 ± 2.83	4.65 ± 1.04
	TJ	36.18 ± 3.28	41.78 ± 3.80	54.55 ± 3.94	4.15 ± 0.39
	ETJ	53.78 ± 5.46	48.98 ± 3.29	62.00 ± 5.15	5.53 ± 0.26
Genetic background	H × J	42.51 ± 5.85	43.43 ± 3.41	56.34 ± 4.29	4.15 ± 0.79
	T × J	44.98 ± 6.29	45.38 ± 3.81	58.28 ± 4.69	4.84 ± 0.48
Diet	Farm-mixed	36.29 ± 2.43b	41.70 ± 3.43	53.18 ± 4.03	3.90 ± 0.43
	Commercial	51.20 ± 6.07a	47.10 ± 3.28	61.44 ± 3.86	5.09 ± 0.74
P-value	Diet	0.011	0.153	0.074	0.078
	Genetic background	0.623	0.592	0.654	0.286
	Genetic background × diet	0.592	0.621	0.850	0.766

Notes: Values are presented as mean ± SEM. The individual hen was considered the experimental unit (n = 4 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. Within a column and main-effect comparison, means with different lowercase superscripts differ (P < 0.05).

Follicle counts

Ovarian follicle counts at d 42 are presented in Table 6. Hens fed the commercial complete feed had more large white follicles than hens fed the farm-mixed diet (P < 0.05), whereas no dietary differences were detected in the numbers of small white or small yellow follicles (P > 0.05). No differences between genetic backgrounds were detected for any follicle category (P > 0.05). No genetic background × diet interaction was detected for any follicle category (P > 0.05).

Table 6.

Effects of genetic background and diet on prehierarchical ovarian follicle counts in late-laying local crossbred hens on d 42.

Effect	Level	SWF, no.	LWF, no.	SYF, no.
Treatment combination	HJ	40.00 ± 6.65	8.50 ± 1.45	2.75 ± 0.48
	EHJ	69.25 ± 10.45	14.50 ± 1.04	3.00 ± 0.41
	TJ	41.50 ± 9.95	8.50 ± 1.45	2.00 ± 0.41
	ETJ	48.00 ± 9.75	10.00 ± 2.04	2.00 ± 0.41
Genetic background	H × J	54.60 ± 11.25	11.50 ± 1.98	2.88 ± 0.42
	T × J	44.80 ± 9.30	9.25 ± 1.69	2.00 ± 0.38
Diet	Farm-mixed	40.80 ± 7.85	8.50 ± 1.34b	2.38 ± 0.46
	Commercial	58.60 ± 10.95	12.25 ± 1.93a	2.50 ± 0.47
P-value	Diet	0.082	0.031	0.782
	Genetic background	0.314	0.173	0.061
	Genetic background × diet	0.253	0.172	0.783

Notes: Values are presented as mean ± SEM. The individual hen was considered the experimental unit (n = 4 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. SWF, small white follicles; LWF, large white follicles; SYF, small yellow follicles. Within a column and main-effect comparison, means with different lowercase superscripts differ (P < 0.05).

Serum redox-related indices

Serum redox-related indices are summarized in Table 7. At d 21, hens fed the commercial complete feed had lower MDA concentrations (P < 0.05) and higher T-SOD and GSH-Px activities (P < 0.01) than hens fed the farm-mixed diet. No dietary differences were detected in CAT activity or T-AOC (P > 0.05). Tianchang Sanhuang × Jinghong No. 1 hens had lower MDA concentrations than Huainanwang × Jinghong No. 1 hens (P < 0.05), whereas the remaining indices did not differ between genetic backgrounds (P > 0.05). No genetic background × diet interaction was detected for any serum index at d 21 (P > 0.05).

Table 7.

Effects of genetic background and diet on serum redox-related indices in late-laying local crossbred hens on d 21 and 42.

Effect	Level	CAT, U/mL	MDA, nmol/mL	T-AOC, U/mL	T-SOD, U/mL	GSH-Px, U/mL
d 21
Treatment combination	HJ	44.16 ± 11.08	2.13 ± 0.33	35.93 ± 4.24	93.55 ± 10.93	112.56 ± 16.14
	EHJ	51.21 ± 3.12	1.45 ± 0.18	43.18 ± 5.92	137.93 ± 14.68	162.41 ± 17.10
	TJ	51.21 ± 2.34	1.44 ± 0.23	45.58 ± 4.53	111.25 ± 11.40	132.12 ± 13.00
	ETJ	59.87 ± 1.15	1.12 ± 0.07	49.90 ± 4.35	138.66 ± 7.18	172.32 ± 11.23
Genetic background	H × J	47.68 ± 7.77	1.79 ± 0.31a	39.55 ± 5.15	115.74 ± 16.86	137.48 ± 20.36
	T × J	55.54 ± 2.88	1.28 ± 0.18b	47.74 ± 4.27	124.95 ± 11.47	152.22 ± 15.56
Diet	Farm-mixed	47.68 ± 7.65	1.79 ± 0.32a	40.76 ± 4.81	102.40 ± 11.37b	122.34 ± 14.54b
	Commercial	55.54 ± 3.18	1.28 ± 0.15b	46.54 ± 5.13	138.29 ± 10.70a	167.37 ± 13.65a
P-value	Diet	0.208	0.041	0.252	0.008	0.009
	Genetic background	0.208	0.040	0.114	0.433	0.331
	Genetic background × diet	0.894	0.421	0.766	0.469	0.746
Effect	Level	CAT, U/mL	MDA, nmol/mL	T-AOC, U/mL	T-SOD, U/mL	GSH-Px, U/mL
d 42
Treatment combination	HJ	62.33 ± 5.38	2.83 ± 0.41	40.31 ± 1.01c	102.78 ± 13.60	127.03 ± 15.29
	EHJ	80.50 ± 5.55	2.14 ± 0.10	55.41 ± 1.03b	146.00 ± 9.45	161.34 ± 2.72
	TJ	69.28 ± 3.01	1.31 ± 0.05	62.20 ± 1.02ab	156.46 ± 16.83	189.74 ± 17.51
	ETJ	89.48 ± 1.89	1.38 ± 0.12	66.19 ± 2.91a	175.50 ± 10.16	201.80 ± 6.86
Genetic background	H × J	71.41 ± 7.02	2.48 ± 0.33a	47.86 ± 4.15b	124.39 ± 15.84b	144.18 ± 13.69b
	T × J	79.38 ± 5.88	1.35 ± 0.09b	64.19 ± 2.29a	165.98 ± 13.84a	195.77 ± 12.73a
Diet	Farm-mixed	65.80 ± 4.44b	2.07 ± 0.49	51.25 ± 5.93b	129.62 ± 20.16b	158.39 ± 22.64
	Commercial	84.99 ± 4.53a	1.76 ± 0.23	60.80 ± 3.52a	160.75 ± 12.03a	181.57 ± 11.85
P-value	Diet	0.001	0.183	<0.001	0.032	0.082
	Genetic background	0.086	<0.001	<0.001	0.007	0.001
	Genetic background × diet	0.815	0.115	0.007	0.365	0.380

Notes: Values are presented as mean ± SEM. The individual hen was considered the experimental unit (n = 4 hens per treatment combination at each sampling time). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. CAT, catalase; MDA, malondialdehyde; T-AOC, total antioxidant capacity; T-SOD, total superoxide dismutase; GSH-Px, glutathione peroxidase. Within the same time point, column, and comparison, means with different lowercase superscripts differ (P < 0.05); exact significance levels are provided in the P-value rows. When the genetic background × diet interaction was significant, treatment-combination comparisons were adjusted using Tukey’s multiple-comparison test; main effects should be interpreted together with the interaction.

At d 42, hens fed the commercial complete feed had higher CAT (P < 0.01) and T-SOD (P < 0.05) activities than hens fed the farm-mixed diet, whereas no dietary differences were detected in MDA concentration or GSH-Px activity (P > 0.05). A genetic background × diet interaction was detected for T-AOC (P < 0.01). Simple-effects analyses showed that the commercial complete feed increased T-AOC within the Huainanwang × Jinghong No. 1 background (P < 0.05), whereas no dietary difference was detected within the Tianchang Sanhuang × Jinghong No. 1 background (P > 0.05). Tianchang Sanhuang × Jinghong No. 1 hens had lower MDA concentrations and higher T-SOD and GSH-Px activities than Huainanwang × Jinghong No. 1 hens (P < 0.01).

Serum anti-müllerian hormone concentration

Serum AMH concentrations are presented in Table 8. At both d 21 and 42, hens fed the commercial complete feed had lower serum AMH concentrations than those fed the farm-mixed diet (P < 0.01). Huainanwang × Jinghong No. 1 hens had higher serum AMH concentrations than Tianchang Sanhuang × Jinghong No. 1 hens at d 42 (P < 0.01). No genetic background × diet interaction was detected at either sampling time (P > 0.05).

Table 8.

Effects of genetic background and diet on serum anti-Müllerian hormone concentration in late-laying local crossbred hens on d 21 and 42.

Effect	Level	d 21, pg/mL	d 42, pg/mL
Treatment combination	HJ	558.88 ± 90.02	424.32 ± 14.09
	EHJ	386.10 ± 35.85	263.87 ± 22.43
	TJ	619.47 ± 52.49	369.60 ± 16.80
	ETJ	276.10 ± 45.25	159.27 ± 8.06
Genetic background	H × J	472.49 ± 77.42	344.09 ± 47.03a
	T × J	447.79 ± 103.75	264.44 ± 58.80b
Diet	Farm-mixed	589.18 ± 67.96a	396.96 ± 20.41a
	Commercial	331.10 ± 47.34b	211.57 ± 32.37b
P-value	Diet	0.006	<0.001
	Genetic background	0.729	0.003
	Genetic background × diet	0.250	0.219

Notes: Values are presented as mean ± SEM. The individual hen was considered the experimental unit (n = 4 hens per treatment combination at each sampling time). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. AMH, anti-Müllerian hormone. Within the same time point, column, and comparison, means with different lowercase superscripts differ (P < 0.05); exact significance levels are provided in the P-value rows.

Hepatic antioxidant-related gene expression

Hepatic antioxidant-related gene expression is shown in Fig. 1. Genetic background × diet interactions were detected for CAT, GPX1, and SOD1 mRNA abundance (P < 0.05). Therefore, simple-effects analyses were performed within each genetic background. Within the Huainanwang × Jinghong No. 1 background, the commercial complete feed increased the expression of CAT, GPX1, and SOD1 (P < 0.01). Within the Tianchang Sanhuang × Jinghong No. 1 background, CAT expression increased (P < 0.01), whereas GPX1 and SOD1 expression did not differ between diets (P > 0.05).

Fig. 1.

Hepatic antioxidant-related gene expression in late-laying local crossbred hens on d 42. Relative mRNA abundance of CAT (A), GPX1 (B), and SOD1 (C) was measured by quantitative real-time PCR. Values were normalized to ACTB and calculated using the 2^−ΔΔCt method. Effects of genetic background, diet, and their interaction were analyzed by two-way ANOVA; Pairwise differences among treatment combinations were tested by Tukey’s multiple-comparison test and are indicated by horizontal brackets. Box plots show the distribution of relative expression values. The individual hen was the experimental unit (n = 4 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. CAT, catalase; GPX1, glutathione peroxidase 1; SOD1, superoxide dismutase 1; NS, not significant. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Cecal microbiota

Alpha and beta diversity of cecal microbiota

Cecal microbial diversity and community structure at d 42 are shown in Fig. 2. No effects of genetic background, diet, or their interaction were detected for either the Chao1 or Shannon index (P > 0.05). Rao’s quadratic entropy showed a genetic-background effect (P < 0.05) and a genetic background × diet interaction (P < 0.01). The EHJ group had higher Rao’s quadratic entropy than the HJ, ETJ, and TJ groups (P < 0.05), whereas the latter three groups did not differ (P > 0.05).

Fig. 2.

Alpha diversity, ASV distribution, and beta diversity of the cecal microbiota in late-laying local crossbred hens on d 42. Chao1 richness (A), Shannon diversity (B), and Rao’s quadratic entropy (C) were analyzed by two-way ANOVA with genetic background and diet as fixed effects. Tukey’s multiple-comparison test was used for pairwise comparisons among treatment combinations; different lowercase letters indicate P < 0.05. Shared and treatment-specific ASVs are shown in the Venn diagram (D). Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarities is shown in panel E. Overall differences in cecal microbial community structure among the 4 treatment combinations were evaluated by PERMANOVA based on Bray-Curtis dissimilarities with 999 permutations (R² = 0.321, P = 0.001). The individual hen was the experimental unit (n = 4 hens per treatment combination). ASV, amplicon sequence variant; PCoA, principal coordinate analysis; PERMANOVA, permutational multivariate analysis of variance. H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. In panel E, ellipses are included as visual aids for group dispersion.

Venn analysis identified 491 ASVs shared among all 4 treatment combinations. The EHJ, HJ, ETJ, and TJ groups contained 3,706, 3,479, 3,172, and 3,529 unique ASVs, respectively. Principal coordinates analysis based on Bray–Curtis dissimilarities showed partial separation among the 4 treatment combinations. PERMANOVA detected an overall difference in community structure among treatment combinations (R² = 0.321, P = 0.001).

Microbial composition at the phylum and genus levels

The taxonomic composition of the cecal microbiota is summarized in Fig. 3. Firmicutes and Bacteroidota accounted for the largest relative abundances across all treatment combinations. The most abundant taxa in the genus-level profile included Bacteroides, Phascolarctobacterium, Rikenellaceae_RC9_gut_group, Prevotellaceae_UCG-001, Desulfovibrio, Muribaculaceae, Megasphaera, Faecalibacterium, Clostridia_UCG-014, and Parabacteroides.

Fig. 3.

Cecal microbial composition at the phylum and genus levels in late-laying local crossbred hens on d 42. Stacked bars present group-mean relative abundances of the 10 most abundant taxa at the phylum (A) and genus (B) levels. Values were averaged from n = 4 individual hens per treatment combination; taxa outside the 10 most abundant categories were combined as Others. H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed.

Differential taxa comparisons

Exploratory comparisons of relative taxon abundance are presented in Fig. 4. In the EHJ versus HJ comparison, the relative abundance of Bacteroidota was lower in EHJ than in HJ at the phylum level (P < 0.05). In the genus-level profile, Subdoligranulum and Christensenellaceae_R-7_group were more abundant in EHJ, whereas Bacteroides, Parabacteroides, Saccharimonadales, Helicobacter, Prevotellaceae_NK3B31_group, GCA-900066575, Akkermansia, and Bilophila were less abundant (P < 0.05).

Fig. 4.

Exploratory comparisons of relative cecal taxon abundance in late-laying local crossbred hens on d 42. Within-background pairwise comparisons of relative abundance were performed for HJ vs. EHJ at the phylum (A) and genus (B) levels and for TJ vs. ETJ at the phylum (C) and genus (D) levels using Student’s t test. Box plots show taxon relative abundance, and adjacent panels show the pairwise-comparison output and nominal P values. Nominal P < 0.05 was used as the exploratory screening criterion. The individual hen was the experimental unit (n = 4 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. These comparisons were exploratory, and P values were not adjusted for multiple testing.

In the ETJ versus TJ comparison, WPS-2 was more abundant in ETJ, whereas Firmicutes and Fusobacteriota were less abundant at the phylum level (P < 0.05). In the genus-level profile, [Eubacterium]_brachy_group, Oribacterium, and DTU014 were more abundant in ETJ, whereas Eisenbergiella, Shuttleworthia, Fournierella, Fusobacterium, Lachnospiraceae_UCG-010, Lactobacillus, and Aeriscardovia were less abundant (P < 0.05).

LEfSe analysis

LEfSe results are presented in Fig. 5. With P < 0.05 and an LDA score > 2.0 as the screening criteria, the discriminating taxa differed between the two genetic backgrounds. In the EHJ versus HJ comparison, group-associated features were distributed across Firmicutes, Actinobacteriota, and Bacteroidota, including members of the families Bacteroidaceae and Ruminococcaceae. In the ETJ versus TJ comparison, group-associated features fell mainly within Firmicutes, Bacteroidota, and Verrucomicrobiota.

Fig. 5.

Linear discriminant analysis effect size (LEfSe) analysis of the cecal microbiota in late-laying local crossbred hens on d 42. The cladogram shows the phylogenetic distribution of discriminative taxa identified by LEfSe (A). Corresponding linear discriminant analysis scores are shown in panel B. Nominal P < 0.05 and an LDA score > 2.0 were used as exploratory screening criteria. Colors indicate the treatment combination in which each taxon was enriched and are consistent between panels A and B. The individual hen was the experimental unit (n = 4 hens per treatment combination). H × J, Huainanwang × Jinghong No. 1; T × J, Tianchang Sanhuang × Jinghong No. 1; HJ, H × J hens fed the farm-mixed diet; EHJ, H × J hens fed the commercial complete feed; TJ, T × J hens fed the farm-mixed diet; ETJ, T × J hens fed the commercial complete feed. LDA, linear discriminant analysis; LEfSe, linear discriminant analysis effect size.

Discussion

Laying persistency declines with age, and maintaining egg production in late laying is therefore an important nutritional objective (Bain et al., 2016; Guo et al., 2020). In this study, replacing the farm-mixed diet with the commercial complete feed increased laying rate in both crossbred populations and in both experimental periods. The accompanying changes in egg quality and physiological traits, however, were not uniform, and several responses depended on genetic background. Dietary replacement should therefore be judged on egg production together with the responses of the population that receives the diet.

The higher laying rate occurred even though the two diets were similar in several major nutrients. Calculated metabolizable energy and analyzed crude protein were similar, as were methionine and methionine plus cystine. Ether extract, mineral content, and several ingredients, by contrast, differed. Egg production depends on hepatic yolk-precursor synthesis, follicular development, and oviduct function, each of which responds to nutrient supply (Feng et al., 2021; Guo et al., 2024). The comparison therefore supports judging the complete formulation rather than the energy and protein concentrations alone. Several dietary components changed at the same time. The higher laying rate consequently cannot be assigned to one nutrient or ingredient. Feed intake and digestibility were not measured, so differences in nutrient intake and utilization may have contributed as well.

Egg quality did not improve consistently with the higher laying rate. On d 21, the complete feed increased egg length-to-width ratio, albumen height, Haugh unit, and yolk color score; on d 42, only yolk color showed a dietary main effect. Albumen height and Haugh unit were lower with the complete feed within the Tianchang Sanhuang × Jinghong No. 1 population at that sampling. Egg quality depends on nutrient supply, oviduct function, pigment deposition, age, and genetic background (Kljak et al., 2021; Kowalska et al., 2021; Vlaicu et al., 2021). The higher yolk color scores at both samplings may reflect dietary pigments, which were not analyzed. Internal egg quality therefore needs to be weighed alongside laying rate when a diet is selected for a particular crossbred population.

Eggshell strength showed no detected dietary difference at either sampling, even though the complete feed supplied more calcium and total phosphorus. Additional sodium and chloride sources were supplied with it as well. Mineral homeostasis, electrolyte balance, and eggshell formation all depend on these nutrients (Fu et al., 2021; Zhang et al., 2026), and shell strength further depends on calcite crystal organization and the organic matrix (Athanasiadou et al., 2018). The absence of a shell-strength response does not rule out a contribution of mineral nutrition to the higher laying rate. Mineral digestibility, calcium balance, bone metabolism, and uterine mineral transport were not measured. Such data would show how the two mineral supplies were used.

Serum redox indices changed together with the higher laying rate. On d 21, the complete feed was associated with lower serum MDA and higher T-SOD and GSH-Px activities; on d 42, CAT and T-SOD activities were higher in hens receiving it. The d 21 pattern is consistent with lower lipid peroxidation and greater activity of the antioxidant enzymes measured here, and these responses bear on the metabolic demands of late laying (Gu et al., 2021; Zhang et al., 2024a; Bai et al., 2025). T-AOC and hepatic CAT, GPX1, and SOD1 expression showed genetic background × diet interactions, so some redox-related responses differed between populations. Serum enzyme activity and hepatic gene expression describe different aspects of redox regulation, and the two need not move together. The dietary response therefore included changes in antioxidant-related traits; whether they contributed to the higher laying rate is unresolved.

The hepatic response included greater liver weight in hens fed the complete feed. The liver plays a central role in lipid metabolism and yolk-precursor synthesis (Huang et al., 2025; Song et al., 2023), so the greater weight may be relevant to the production response. It cannot, however, distinguish increased metabolic activity from lipid deposition or other tissue changes (Zou et al., 2025). The lower ether extract content of the complete feed (2.80 vs. 4.72%) does not establish whether hepatic lipid accumulation was reduced. Liver histology, lipid content, and yolk-precursor production would be needed to clarify the basis of the weight difference. No dietary differences were detected in ovary weight, oviduct weight, or oviduct length.

Serum AMH, however, was lower with the complete feed at both samplings, despite the higher laying rate. In hens, AMH is produced mainly by granulosa cells of small and prehierarchical follicles and participates in follicular development and selection (Huang et al., 2021; Francoeur et al., 2024). Large white follicle counts were higher with the complete feed, whereas the small white and small yellow categories did not differ, so the lower circulating AMH did not track the prehierarchical follicle counts measured here. Those counts were obtained after dissection and describe a single endpoint, without showing changes in follicular recruitment, growth, or atresia. The AMH result should therefore be interpreted alongside reproductive output and ovarian measurements, without treating it as evidence of improved or impaired ovarian reserve. Independent validation of the assay in chickens was lacking. The endocrine response remains exploratory and requires confirmation with validated hormone measurements and assessment of follicular dynamics.

Cecal community structure differed among the four treatment combinations, whereas Chao1 richness and Shannon diversity showed no detected effects. The complete feed introduced wheat bran and changed dietary fiber sources, which can influence digesta substrates, nutrient utilization, and microbial fermentation (Singh and Kim, 2021). Under the conditions studied by Wanzenböck et al. (2020), however, native or fermented wheat bran did not markedly alter the intestinal microbiota. In the present study, Rao’s quadratic entropy showed a genetic background × diet interaction, and the taxa identified by LEfSe differed between genetic backgrounds. Such patterns are consistent with previous reports of host-dependent microbial variation (Paul et al., 2021; Zhang et al., 2024b). Interpretation is limited by the four-group PERMANOVA, which did not test diet, genetic background, and their interaction separately, and by the absence of false discovery rate correction for the taxonomic comparisons. The identified taxa are therefore candidates for further study; microbial metabolites and functional genes would be needed to assess their biological relevance. The present data do not establish a microbial explanation for the higher laying rate.

The contrast between laying rate and the other measured traits matters when a diet is selected across genetic backgrounds. No genetic background × diet interaction was detected for laying rate, whereas interactions occurred for albumen height, Haugh unit, T-AOC, and hepatic antioxidant-related gene expression. The absence of a detected interaction does not establish equivalent production responses between populations. The interactions in other traits nevertheless show that a higher laying rate can come with different physiological responses to the same dietary replacement. Previous studies have linked host genetics to nutrient utilization, microbial colonization, and metabolism in chickens (Habibi et al., 2024; Li et al., 2025; Ren et al., 2026). Complete diets should therefore be tested in the populations for which they are intended, with production and egg quality both included in the evaluation.

The smaller samples used for the physiological, molecular, and microbial measurements limit the precision of these findings, and results based on 4 hens per treatment combination in particular require confirmation in larger samples. Feed intake, egg mass, and feed efficiency were not measured, so the economic benefit of the higher laying rate remains unknown. Nutrient digestibility, mineral balance, hepatic lipid deposition, microbial metabolites, and detailed follicular dynamics were not assessed either. Further studies should collect these measurements in larger populations and include feed-cost data to establish the practical value of the production response.

Replacing the farm-mixed diet with the tested commercial complete feed increased laying rate in both late-laying crossbred populations. Several egg-quality and physiological responses depended on genetic background, which shows that the same dietary replacement can have different effects beyond egg production. For practical feeding decisions, the gain in laying rate should be weighed together with internal egg quality and the responses of the target population. Feed use and cost per egg remain necessary measures for deciding whether this production benefit offers an economic advantage.

Author contributions

Wenze Song and Liuyang Han contributed equally to this work and share first authorship. Wenze Song conceived and designed the study, conducted the animal trial and laboratory analyses, curated, statistically analyzed, and interpreted the data, prepared figures, and drafted the manuscript. Liuyang Han contributed to the study design, conducted the animal trial and molecular experiments, curated and interpreted the data, verified the reproducibility of the results, prepared figures, and drafted the manuscript. Jia Shi curated and verified the data, contributed to data acquisition, analysis, and interpretation, and critically reviewed the manuscript for important intellectual content. Xinyue Yang curated and verified the data, contributed to data acquisition, analysis, and interpretation, and critically reviewed the manuscript for important intellectual content. Ziheng Zhou developed and optimized the experimental methods, contributed to data acquisition and analysis, and critically reviewed the manuscript for important intellectual content. Ligang Wang contributed to the experimental design and methods, provided and maintained the hens, interpreted the data, and critically reviewed the manuscript for important intellectual content. Debing Yu conceived and supervised the study and contributed to its design. He secured funding, managed the experimental animals and farm operations, evaluated the data, and critically revised the manuscript.

All seven authors, namely Wenze Song, Liuyang Han, Jia Shi, Xinyue Yang, Ziheng Zhou, Ligang Wang, and Debing Yu, have reviewed and explicitly approved the current revised version of the manuscript for submission, and each of them will review and explicitly approve the exact final version before publication. Each author individually agrees to be personally and publicly accountable for all aspects of the work and to ensure that any questions about the accuracy or integrity of any part of the research are thoroughly investigated and resolved.

Funding

This work was supported by the Yellow-Feathered Broiler Breeding Technology Innovation and New Variety Development Project (No. 2021YFD1300100). The program supports genetic improvement of yellow-feathered broiler lines and is not specific to laying hens. The study was conducted using institutional resources of the corresponding author’s laboratory. The funders had no role in study design, data collection, analysis, interpretation, manuscript preparation, or the decision to publish.

Disclosures

The commercial complete feed was purchased from Anhui Tianzhu Feed Co., Ltd. The authors declare no financial or personal relationship with the manufacturer and no conflicts of interest.

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.