Skip to main content
NCBI home page
RNA logoLink to RNA
. 2005 Nov;11(11):1667–1677. doi: 10.1261/rna.2162205

An artificial riboswitch for controlling pre-mRNA splicing

DONG-SUK KIM 1,3, VERONICA GUSTI 1,3, SAILESH G PILLAI 1, RAJESH K GAUR 1,2
PMCID: PMC1370853  PMID: 16244133

Abstract

Riboswitches, as previously reported, are natural RNA aptamers that regulate the expression of numerous bacterial metabolic genes in response to small molecule ligands. It has recently been shown that these RNA genetic elements are also present near the splice site junctions of plant and fungal introns, thus raising the possibility of their involvement in regulating mRNA splicing. Here it is shown for the first time that a riboswitch can be engineered to regulate pre-mRNA splicing in vitro. We show that insertion of a high-affinity theophylline binding aptamer into the 3′ splice site (3′ ss) region of a model pre-mRNA (AdML-Theo29AG) enables its splicing to be repressed by the addition theophylline. Our results indicate that the location of 3′ ss AG within the aptamer plays a crucial role in conferring theophylline-dependent control of pre-mRNA splicing. We also show that theophylline-mediated control of pre-mRNA splicing is highly specific by first demonstrating that a small molecule ligand similar in shape and size to theophylline had no effect on the splicing of AdML-Theo29AG pre-mRNA. Second, theophylline failed to exert any influence on the splicing of a pre-mRNA that does not contain its binding site. Third, theophylline specifically blocks the step II of the splicing reaction. Finally, we provide evidence that theophylline-dependent control of pre-mRNA splicing is functionally relevant.

Keywords: aptamer, riboswitch, pre-mRNA splicing, RNA–small molecule interaction, theophylline

INTRODUCTION

The vast majority of structural genes in higher eukaryotes contain intervening sequences (introns) whose precise removal from the mRNA precursors (pre-mRNAs) is essential for proper gene expression. Pre-mRNAs are spliced in a two-step pathway catalyzed by the spliceosome, perhaps the most complex ribonucleoprotein (RNP) assembly in the cell (Nilsen 2003; Butcher and Brow 2005). A number of RNA–RNA and RNA–protein interactions involving five small nuclear RNAs (U1, U2, U4, U5, and U6) and many snRNP and non-snRNP proteins mediate the removal of introns and joining of exons (Hastings and Krainer 2001; Will and Luhrmann 2001; Stevens and Abelson 2002; Jurica and Moore 2003; Sanford and Caceres 2004).

Pre-mRNAs can also undergo alternative splicing, a precisely regulated process in which differential joining of 5′ and 3′ ss of a single pre-mRNA generates variant mRNAs with diverse, and often antagonistic functions (Claverie 2001; Graveley 2001; Black 2003). Alternative splicing of pre-mRNA is now recognized as the most important source of protein diversity in vertebrates (Maniatis and Tasic 2002; Thanaraj et al. 2004). It has been estimated that 35%–60% of human genes generate transcripts that are alternatively spliced (Mironov et al. 1999; Johnson et al. 2003). Although the underlying mechanisms of alternative splicing are not fully understood, there is growing evidence that RNA secondary structures, either on their own or by providing the high-affinity binding sites for splicing regulators, influence splice site choice (Buratti and Baralle 2004 and references therein). Thus, RNA secondary structures within a pre-mRNA may be defined as “genetic control elements” that regulate gene expression by modulating pre-mRNA splicing.

Recently, untranslated regions of several messenger RNAs have been found to contain secondary structures, also known as riboswitches (Nudler and Mironov 2004; Tucker and Breaker 2005), that are capable of regulating host gene expression by binding to specific metabolites in complete absence of proteins. Riboswitches are natural allosteric aptamers that are composed of two functional domains: a ligand binding domain and an expression platform capable of relaying the signal into biological response (Soukup and Soukup 2004). It appears that the metabolite-binding RNA domains of riboswitches are highly conserved and at least one class of riboswitch, thiamine pyrophosphate (TPP) (Winkler et al. 2002), has been shown to be present in the introns of eukaryotes (Kubodera et al. 2003; Sudarsan et al. 2003). Given that RNA secondary structures also account for the regulation of splicing in a number of natural pre-mRNAs (Buratti and Baralle, 2004), it is conceivable that some of these structures could be putative riboswitches capable of regulating the splicing of host pre-mRNA by binding to undiscovered small molecule ligands.

To test this hypothesis, we constructed a series of pre-mRNAs carrying theophylline-responsive riboswitch within the 3′ ss region, and examined their splicing in HeLa nuclear extract in the absence or presence of theophylline. We show that theophylline can inhibit mRNA splicing by blocking the step II of the splicing reaction. Our results demonstrate that the location of 3′ ss AG within the theophylline aptamer plays a crucial role in conferring theophylline-dependent control of splicing. We also provide evidence to suggest that theophylline-dependent control of mRNA splicing is highly specific: First, a molecule similar in shape and size to theophylline failed to exert any effect on the splicing of a pre-mRNA that contains a theophylline-responsive riboswitch within the 3′ ss region. Second, the splicing of a pre-mRNA that does not contain theophylline-binding aptamer remained unaffected in the presence of theophylline. Third, theophylline failed to elicit any effect on the splicing of pre-mRNAs in which theophylline-responsive riboswitch was inserted 8 or 10 nucleotides (nt) downstream of the 3′ or 5′ ss, respectively. Since splicing of many pre-mRNAs is regulated in a tissue- or development-specific manner (Lopez 1998; Black 2003), the availability of such a system will be of broad application in gene-based therapy and functional genomics.

RESULTS

Construction and in vitro splicing of pre-mRNA containing theophylline-responsive riboswitch

To investigate whether formation of RNA-theophylline complex affects pre-mRNA splicing, we employed a derivative of AdML Par pre-mRNA (Gozani et al. 1994), designated AdML-Theo39AG, that has a theophylline aptamer sequence 3′ adjacent to the poly (Y) tract (Fig. 1A). The splicing results presented in Figure 1B demonstrate that unlike the parent substrate, which underwent both steps of the splicing reaction with normal kinetics, AdML-Theo39AG substrate gave rise to the accumulation of lariat-exon 2, suggesting that splicing was strongly affected at the second step (Fig. 1B, cf. lanes 2–5 and lanes 6–9).

FIGURE 1.

FIGURE 1.

Open in a new tab

BPS-to-theophylline aptamer distance affects step II of the splicing. (A) Diagram of AdML-Theo39AG pre-mRNA. Underlined A represents the branch point. The boxed residues in theophylline aptamer represent exon 2, and the residues that are conserved for theophylline binding are enclosed in the rectangular box. (B) Splicing time course with AdML Par and AdML-Theo39AG substrates. 32P-labeled pre-mRNA was incubated in HeLa nuclear extract at 30°C for the times indicated above each lane (for details, see Materials and Methods). Total RNA isolated from each sample was fractionated on a 13% polyacrylamide denaturing gel. The bands corresponding to splicing substrates, intermediates, and spliced products are indicated. (M) Century-plus RNA size marker (Ambion).

It has been previously shown that longer BPS-to-AG distance could negatively affect mRNA splicing by lowering the efficiency of the step II of the splicing reaction (Chua and Reed 2001). Indeed, a pre-mRNA derivative with BPS-to-AG distance of 29 nt (Fig. 2A, AdML-Theo29AG) not only underwent both steps of the splicing reaction (cf. Fig. 1B, lanes 6–9, and Fig. 2B, lanes 1–5) but also conferred theophylline-dependent control of splicing that follows a dose-dependent response (Fig. 2B, cf. lanes 1–5 and lanes 6–17). Quantification of the results indicates that 0.5 mM theophylline was able to inhibit the splicing of AdML-Theo29AG by ~50%, and at 2.0 mM theophylline, ~75% inhibition was achieved (Fig. 2C). Although a higher concentration of theophylline also appears to affect the first step of the splicing (Fig. 2B), accumulation of lariat-exon 2 with concomitant decrease in the spliced mRNA strongly suggests that the inhibition of the second step is more pronounced (Fig. 2D). To rule out the possibility that the observed results are substrate specific, a derivative of MINX pre-mRNA (MINX-Theo28AG) (Zillmann et al. 1988) carrying the high-affinity theophylline binding aptamer between the poly (Y) tract and 3′ ss AG was synthesized. Our results (data not shown) indicate that theophylline could efficiently inhibit the splicing of MINX-Theo28AG pre-mRNA by specifically repressing the step II of the splicing, thus confirming the generality of this approach.

FIGURE 2.

FIGURE 2.

FIGURE 2.

FIGURE 2.

Open in a new tab

Theophylline-dependent control of pre-mRNA splicing. (A) Schematic representation of AdML-Theo29AG pre-mRNA. Details as described in Figure 1A. (B) Splicing time course with the AdML-Theo29AG substrate. 32P-labeled AdML-Theo29AG pre-mRNA was subjected to in vitro splicing in the absence (lanes 1–5) or with indicated concentration of theophylline (lanes 6–17). The extracted RNA was fractionated on a 13% polyacrylamide denaturing gel. The bands corresponding to splicing substrates, intermediates, and spliced products are indicated on the left. (C) Histogram depicting the effect of theophylline on the second step of AdML-Theo29AG splicing at 120-min time point (from B). The step II efficiency was calculated as the ratio of spliced mRNA to the total and normalized to the control. (D) Theophylline inhibits the splicing of AdML-Theo29AG pre-mRNA by blocking the step II of the splicing. The amount of the lariat-exon 2 accumulation (triangles) and spliced product (squares) at 120-min time point is plotted as a function of theophylline concentration.

The location of AG determines theophylline-mediated regulation of splicing

The experiments presented above demonstrate that theophylline can specifically inhibit the second step of the splicing of a pre-mRNA whose 3′ ss AG is part of theophylline binding sequence. To investigate theophylline-mediated step II splicing inhibition in further detail, we constructed and analyzed the splicing of two different substrates, termed AdML-Theo27AG (Fig. 3A) and AdML-Theo-Stem21AG (Fig. 4A). Figure 3 shows that AdML-Theo27AG in which the lower stem of theophylline aptamer contains only a single base-pair responded less efficiently to theophylline-dependent step II splicing inhibition (cf. Figs. 2C and 3C). In contrast, AdML-Theo-Stem21AG pre-mRNA in which the proximal 3′ ss AG is no longer located within the theophylline binding pocket (Fig. 4A) was observed to be least responsive, while 0.5 mM theophylline was able to inhibit the step II of the splicing in AdML-Theo29AG by >50%, a fourfold higher concentration of theophylline could only achieve ~40%–50% inhibition in AdML-Theo27AG and AdML-Theo-Stem21AG substrates (Figs. 2C–4C).

FIGURE 3.

FIGURE 3.

FIGURE 3.

FIGURE 3.

Open in a new tab

The location of AG within the aptamer determines theophylline-dependent control of splicing. (A) Schematic representation of AdML-Theo27AG pre-mRNA. Details as described in Figure 1A. (B) Splicing time course with the AdML-Theo27AG substrate. 32P-labeled AdML-Theo27AG pre-mRNA was subjected to in vitro splicing in the absence (lanes 1–5) or with indicated concentration of theophylline (lanes 6–17) as described in Figure 2. The extracted RNA was fractionated on a 13% denaturing polyacrylamide gel. The position of the pre-mRNAs, splicing intermediates, and spliced products is indicated on the left. (C) Histogram representing the effect of theophylline on the splicing efficiency of AdML-Theo27AG pre-mRNA at 120-min time point (from B) and calculated as in Figure 2C.

FIGURE 4.

FIGURE 4.

FIGURE 4.

FIGURE 4.

Open in a new tab

A pre-mRNA in which the 3′ ss AG is located outside the theophylline aptamer core responded poorly to theophylline-mediated regulation of splicing. (A) Schematic representation of AdML-Theo-Stem21AG pre-mRNA. Details as described in Figure 1A. (B) Splicing time course with the AdML-Theo-Stem21AG substrate. 32P-labeled AdML-Theo-Stem21AG pre-mRNA was subjected to in vitro splicing in the absence (lanes 1–4) or with indicated concentration of theophylline (lanes 5–16) as described in Figure 2. The extracted RNA was fractionated on a 13% polyacrylamide denaturing gel. The position of the pre-mRNAs, splicing intermediates, and spliced products is indicated on the left. (C) Histogram representing the effect of theophylline on the splicing efficiency of AdML-Theo-Stem21AG pre-mRNA at 120-min time point (from B) as described in Figure 2C.

These results can be explained in terms of the accessibility of 3′ ss AG to the spliceosome. In AdML-Theo29AG, the AG proximal to the BPS is “buried” inside the theophylline-RNA complex, which makes its accessibility to the spliceo-some as a 3′ acceptor site difficult. This interpretation is in general agreement with the NMR structure of theophylline in complex with its aptamer (Zimmermann et al. 1997), which revealed that A28 (the adenine of 3′ ss AG) participates in multiple interactions involving G29 and G43 (Fig. 2A). These interactions not only add to the stability of RNA–ligand complex but also likely interfere in the recognition and activation of AG as a 3′ ss signal. In the case of AdML-Theo27AG (Fig. 3A), although the AG is located inside the theophylline-binding pocket, the deletion of 3 base pair in the lower stem apparently compromises with the stability of RNA–theophylline complex. However, in AdML-Theo-Stem21AG (Fig. 4A) the presence of proximal AG outside the theophylline-binding pocket enables its recognition as the 3′ ss relatively easier. Based on these results, we conclude that the location of AG within the aptamer plays a critical role in conferring theophylline-dependent regulation of pre-mRNA splicing.

Theophylline-dependent inhibition of step II of the splicing is functionally relevant

The results presented in the previous section strongly suggest that sequestering of functionally important element of pre-mRNA (the 3′ ss AG) within the theophylline–RNA complex led to the inhibition of step II of the splicing. If that is true, then relocation of theophylline aptamer to a position that has no apparent contribution in the selection and activation of AG should have no effect on the splicing. To test this hypothesis, we decided to synthesize two different substrates, AdML-TheoExon 2 (Fig. 5A) and AdML-Theo+10 (data not shown). In AdML-TheoExon 2 the theophylline-binding site was moved 8 nt downstream of the 3′ ss, whereas in AdML-Theo+10 pre-mRNA the theophylline aptamer was inserted 10 nt downstream of the 5′ ss. The in vitro splicing results presented in Figure 5B (and data not shown) demonstrate that both pre-mRNAs underwent splicing with normal kinetics (see Fig. 5C). However, unlike in AdML-Theo29AG, addition of theophylline had no effect on the splicing of AdML-TheoExon 2 or AdML-Theo+10 pre-mRNAs (cf. Fig. 2B, lanes 6–17, and Fig. 5B, lanes 6–14). We conclude that only the functionally important elements of pre-mRNA could be the target of theophylline-dependent control of pre-mRNA splicing.

FIGURE 5.

FIGURE 5.

FIGURE 5.

FIGURE 5.

Open in a new tab

Theophylline-dependent inhibition of the second step of the splicing is functionally relevant. (A) Schematic representation of AdML-TheoExon 2 pre-mRNA. Details as described in Figure 1A. (B) Splicing time course with the AdML-TheoExon 2 substrate. 32P-labeled AdML-TheoExon 2 pre-mRNA was subjected to in vitro splicing in the absence (lanes 2–5) or with indicated concentration of theophylline (lanes 6–14) as described in Figure 2. The extracted RNA was fractionated on a 13% polyacrylamide denaturing gel. The position of the pre-mRNAs, splicing intermediates, and spliced products is indicated on the right. (M) Century-plus RNA size marker (Ambion). (C) Histogram representing the effect of theophylline on the splicing efficiency of AdML-TheoExon 2 pre-mRNA at 120-min time point (from B) as described in Figure 2C.

The effect of theophylline on the assembly of the spliceosome

To investigate the effect of theophylline on spliceosome assembly, 32P-labeled AdML-Theo29AG pre-mRNA was incubated under splicing conditions in the absence or presence of theophylline. Aliquots were removed at various time points, followed by the separation of complexes on native agarose gels according to the published protocol (Das and Reed, 1999). In the absence of theophylline, complex A was detected as early as 5 min and converted into B/C complex thereafter (Fig. 6A, lanes 2–6). Complex B/C appeared after 5 min, peaked between 15–30 min, and declined steadily after 30 min. In the presence of theophylline, the kinetics of complexes A and B/C formation is not very different; complex A appeared at 5 min and decreased thereafter. However, the amount of complexes B/C steadily accumulated (Fig. 6A, cf. lanes 4–6 and lanes 10–12, 16–18, 22–24). In addition, complex H, which almost completely disappeared between 30–60 min in the absence of theophylline, also accumulated after 60–90 min of incubation (Fig. 6A, cf. lanes 4–6 and lanes 10–12, 16–18, 22–24). Quantitation of these results presented in Figure 6B indicates that theophylline-dependent inhibition of the step II of splicing leads to the accumulation of complex B/C, which is consistent with previously published reports in which mutation of the 3′ ss (Gozani et al. 1994) or the addition of boric acid, both of which specifically inhibit step II of the splicing, led to the accumulation of complexes B/C (Shomron et al. 2002; Shomron and Ast, 2003).

FIGURE 6.

FIGURE 6.

FIGURE 6.

Open in a new tab

Analysis of the effect of theophylline on spliceosomal complexes. (A) AdML-Theo29AG pre-mRNA was incubated with HeLa nuclear extract under the conditions that support pre-mRNA splicing for the times indicated above each lane at 30°C in the absence (lanes 1–6) or presence (lanes 7–24) of theophylline. The complexes were separated on a 2% agarose gel. The bands representing complex H, A, B, and C are marked on the left. (B) The relative intensity of the splicing complex B/C formed in the absence or presence of theophylline as a function of time is indicated.

Theophylline-mediated control of pre-mRNA splicing is specific

The extraordinary ability with which the splicing regulators discriminate between a specific and a nonspecific RNA target plays a critical role in the precise regulation of pre-mRNA splicing. Thus, before theophylline could be employed as a splicing regulator its specificity must be established; i.e., molecules that are similar in size and shape to theophylline should not inhibit the splicing of the pre-mRNA that contains theophylline-binding sequence, and theophylline should not affect the splicing of a substrate that does not contain its binding site.

To address the first issue, we decided to examine the splicing of AdML-Theo29AG in the presence of caffeine (Fig. 7A). Caffeine differs from theophylline only by a methyl group at the N-7 position in the imidazole ring, yet it binds to theophylline aptamer with 10,000-fold lower affinity (Jenison et al. 1994). Uniformly labeled AdML-Theo29AG was incubated in HeLa nuclear extract in the absence or with increasing concentrations of caffeine, and the products of the splicing reaction were analyzed by denaturing 13% PAGE. The splicing results shown in Figure 7B indicate that even at 2.0 mM concentration, caffeine failed to elicit any noticeable effect on the splicing of AdML-Theo29AG pre-mRNA. In contrast, a similar concentration of theophylline was able to inhibit the second step of splicing by >70% (cf. Fig. 2B, lanes 6–17, and Fig. 7B, lanes 7–18).

FIGURE 7.

FIGURE 7.

Open in a new tab

Theophylline-dependent regulation of pre-mRNA splicing is highly specific. (A) Structure of caffeine. (B) Splicing of AdML-Theo29AG pre-mRNA remained unaffected in the presence of caffeine. 32P-labeled AdML-Theo29AG pre-mRNA was subjected to in vitro splicing in the absence (lanes 2–6) or with increasing concentration of caffeine (lanes 7–18) as described in Figure 2. The extracted RNA was fractionated on a 13% polyacrylamide denaturing gel. The position of the pre-mRNAs, splicing intermediates, and spliced products is indicated on the right. (C) Histogram representing the effect of caffeine on the splicing efficiency of AdML-29AG pre-mRNA at 120-min time point (from B) as described in Figure 2C.

We addressed the second issue by examining the splicing of AdML-21AG (Chua and Reed 2001), a pre-mRNA that does not contain the binding site for theophylline but otherwise is identical to AdML-Theo29AG. We observed that the splicing of AdML-21AG pre-mRNA remained virtually unaffected even at the maximum tested dose of theophylline (data not shown). Collectively, these results suggest that theophylline-mediated inhibition of the second step of the splicing is highly specific.

DISCUSSION

The work described in this article was undertaken to test the hypothesis that splicing of certain introns may be regulated by riboswitches (also known as naturally occurring aptamers), whose binding to a specific ligand either terminates transcription prematurely or sequesters the Shine-Dalgarno sequence and inhibits translation initiation (Nudler and Mironov 2004; Tucker and Breaker 2005). To test this hypothesis, we constructed a series of model pre-mRNAs in which the 3′ ss AG was engineered to be the part of theophylline-binding aptamer (Fig. 1–4). In AdML-Theo39AG, the nearly abolished step II of the splicing in the absence of theophylline (Fig. 1B, lanes 6–9) and our observation that shortening the BPS-to-AG distance by 10 nt (Fig. 2, AdML-Theo29AG) rescued this inhibition are consistent with the previously published reports, which suggest that an AG >30 nt downstream of the BPS significantly reduces the efficiency of the second step of the splicing (Chua and Reed 2001), as well as that the insertion of pyrimidines upstream of such an AG alleviates this effect (Patterson and Guthrie 1991; Chiara et al. 1997).

Our results indicate that AdML-Theo29AG, AdML-Theo27AG, and AdML-Theo-Stem21AG pre-mRNAs conferred theophylline-dependent control of splicing, albeit with varying degree (Fig. 2–4, also see below). While 0.5 mM theophylline was able to inhibit step II of the splicing of AdML-Theo29AG by >50%, in case of AdML-Theo27AG this effect was insignificant (cf. Fig. 2C and Fig. 3C). Increasing the concentration of theophylline to 2.0 mM, however, reduced this difference to less than twofold (Figs. 2C, 3C). This difference, which corresponds to only ~0.5 kcal/mol, cannot account for the loss of three base pairing interactions between AdML-Theo29AG and AdML-Theo27AG (a hydrogen bond can contribute from 0.5–2.0 kcal/mol to the stability of a base pair), suggesting that the unpaired region of theophylline aptamer makes the major contribution toward the overall binding energy. This may explain why none of the 15 residues (Fig. 1A, nucleotides shown in the rectangular box) required for high-affinity theophylline binding resides in the lower stem (Jenison et al. 1994; Zimmermann et al. 2000).

Unlike AdML-Theo29AG and AdML-Theo27AG substrates, significantly poor response of AdML-Theo-Stem21AG to theophylline-mediated step II splicing inhibition is somewhat intriguing (cf. Fig. 4C and Figs. 2C, 3C). The following explanations can be offered for this observation: First, while present in the lower stem of the aptamer, the AG could still serve as a 3′ ss. Given that the 3′ ss AG as well as the nucleotides in its vicinity have been shown to interact with the nucleotides at the 5′ ss (Parker and Siliciano 1993; Deirdre et al. 1995; Collins and Guthrie 1999, 2001) and with the conserved loop of U5 snRNA (Sontheimer and Steitz 1993), it is highly unlikely that while sequestered in the double-stranded stem the AG could maintain these interactions. An alternative and more likely explanation is that after the completion of the first step or just prior to the step II of the splicing, the spliceo-some unwinds the lower stem of the aptamer and selects this AG as a splice acceptor site. Support for this explanation comes from the fact that the second step of the splicing is preceded by a major conformational rearrangement aided in part by putative RNA helicases, which likely unfold the lower stem (Umen and Guthrie 1995; Staley and Guthrie 1998).

Our data also indicate that even at the highest concentration of theophylline, 20%–25% of the AdML-Theo29AG pre-mRNA underwent splicing (Fig. 2B). This could most likely be due to the differential metal ion requirements for the binding of theophylline to its cognate RNA and in vitro splicing; while high-affinity theophylline-RNA aptamer binding requires 5.0 mM magnesium (Jenison et al. 1994; Zimmermann et al. 2000), ~3.0 mM magnesium has been found to be optimum for in vitro splicing (Krainer et al. 1984). Since the in vitro splicing experiments were performed in the presence of ~3.0 mM Mg2+, the observed incomplete step II splicing inhibition could be the consequence of weak theophylline–aptamer binding. In addition, the design of the pre-mRNA construct could also account for the incomplete repression of splicing. For example, unavailability of a competing 3′ ss likely forced the splicing machinery to select a structured AG. This interpretation is in agreement with previously reported studies in which the repression of a targeted splice site was significantly higher when an alternative splice site was available (Goguel et al. 1993; Villemaire et al. 2003).

Several lines of evidence argue strongly that the observed theophylline-dependent inhibition of step II of the splicing is specific. First, theophylline-mediated decrease in the yield of the spliced product is directly proportional to the amount of the lariat product, suggesting that the inhibition of AdML-Theo29AG splicing is not the result of mRNA degradation (see lariat and spliced product in Fig. 2B, lanes 2–17). Second, the lower yield of the mRNA is mirrored by the accumulation of lariat-exon 2 (Fig. 2D) and the accumulation of splicing complex B/C (Fig. 6), confirming that the splicing was preferentially blocked at the second step. Third, even at the highest concentration, theophylline does not have a significant effect on efficiency of the first step of splicing, thus excluding the possibility that the lower efficiency of the first step of splicing might be the cause of reduced level of mRNA (Fig. 2B). Fourth, theophylline failed to affect the splicing of pre-mRNAs in which the theophylline aptamer was inserted to 8 or 10 nt downstream of 3′ or 5′ ss, respectively (Fig. 5; data not shown). Fifth, caffeine, which is similar in shape and size to theophylline, had no effect on the splicing of AdML-Theo29AG pre-mRNA (Fig. 7). Finally, even at the highest tested dose, theophylline failed to elicit any effect on the splicing of a pre-mRNA that does not contain its binding site (data not shown).

The ability of artificial stem-loop structures (Solnick 1985; Eperon et al. 1988; Goodall and Filipowicz 1991; Goguel and Rosbash 1993; Goguel et al. 1993; Liu et al. 1995, 1997) and naturally occurring RNA structure elements (Buratti and Baralle 2004; Lian and Garner 2005) to influence pre-mRNA splicing, and the presence of ribo-switches near splice site junctions of introns (Kubodera et al. 2003; Sudarsan et al. 2003) indicate that riboswitches might be involved in the splicing of certain genes. However, detailed bioinformatics, genomics, and biochemical approaches are needed to determine whether riboswitches are indeed involved in regulating mRNA splicing.

In conclusion, we have demonstrated that an artificial riboswitch, which exploits the high-affinity binding of theophylline to an in vitro evolved aptamer, can conditionally inhibit pre-mRNA splicing by blocking the step II of the splicing reaction. Since theophylline is a well-known drug with favorable pharmacokinetics and cellular uptake properties, we believe that theophylline-dependent control of pre-mRNA splicing will have many applications in biotechnology and medicine.

MATERIALS AND METHODS

Pre-mRNA substrates

AdML Par and AdML21AG pre-mRNAs were generated by in vitro transcription using BamHI-digested plasmids pAdML Par (Gozani et al. 1994) and pAdML21AG (Chua and Reed 2001), respectively. AdML-Theo39AG pre-mRNA was synthesized from a PCR-derived template, which was amplified from plasmid pAdMLΔAG (Gozani et al. 1994) by using T7 primer (5′-TAATACGACTCACTATAG-3′) and primer 17179 (5′-TCAACGTCGAGACGCTGCCAAGGGCCTTTCGGCTGGTATCGCCAGAGAGAGAGG-3′) as forward and reverse primers, respectively. The underlined area represents theophylline binding sequence. Plasmids encoding AdML-Theo29AG, AdML-Theo27AG, and AdML-Theo-Stem21AG pre-mRNAs are derivatives of pAdML (Gozani et al. 1994) and were constructed by PCR using T7 oligonucleotide as the forward primer and oligonucleotide 17396 (5′-TTGACGTCGACCTCCTGCCAAGGGCCTTTCGGCTGGTATGAGGAAAAAAAAAGAAAAAAAGT-3′), oligonucleotide 17395 (5′-TTGACGTCGACCTGCCAAGGGCCTTTCGGCTGGTATGGAAAAAAAAAGAAAAAAAG T-3′), and oligonucleotide 22735 (5′-TTGACGTCGATCAGCTGCCAAGGGCCTTTCGGCTGGTATCTGAAAAAAAAAGAAAAAAAGT-3′), respectively, as reverse primers. AdML-TheoExon 2 pre-mRNA was synthesized from BamHI-digested plasmid pAdML-TheoExon 2, which was generated by PCR using oligonucleotides 30036 (5′-CCCTTGGCAGCGTCTGAGGACAAACTCTTCGCGG-3′) and 30037 (5′-CCTTTCGGCTGGTATCGCCACGTCGACCTGAAAAAAAAAG-3′) with pAdML21AG as the template. The PCR-amplified DNA was circularized by using T4 DNA ligase to yield plasmid pAdML-TheoExon 2.

In vitro transcription

Linearized plasmid (1 μg) or PCR-generated DNA (~150–200 ng) was used as the template for run-off transcription. A typical (10 μL) in vitro transcription reaction consisted of 40 mM Tris-HCl pH 8.0, 2.0 mM spermidine, 10 mM DTT, 20 mM MgCl2, NTP mixture (0.4 mM CTP and ATP, and 0.1 mM GTP and UTP), 2.0 mM cap analog (NEB), ~10 μCi [∝32P] UTP, 10–20 U SP6 (NEB), or T7 polymerase (Ambion). After incubation for 2 h at 37 °C, the reaction was terminated by adding 12.5 μL form-amide stop buffer, and RNA was purified on a 10% denaturing polyacrylamide gel.

In vitro splicing

Nuclear extracts were prepared from HeLa cells (obtained from National Cell Center), essentially as described by Dignam et al. (1983). To ensure that theophylline binds to its RNA target, a solution (5 μL) consisting of 32P-labeled pre-mRNA (5–10 fmol, ~10,000 cpm per reaction), indicated concentration of theophylline, 0.5 μL BC300 (20 mM HEPES pH 8.0, 20% glycerol, 300 mM KCl, 0.2 mM EDTA) and 0.25 μL 160 mM MgCl2 was heated to 65°C for 5 min, followed by 20-min incubation at room temperature. Next, 0.5 mM ATP, 20 mM creatine phosphate, 0.4 U of RNasin (Promega), 1.0 mM DTT, 6.25 μL HeLa nuclear extract, and water up to 12.5 μL (all concentrations are final) was added and incubation continued at 30°C for the indicated time. Where indicated, theophylline was substituted by caffeine or water. Splicing reaction was terminated by the addition of 125 μL stop buffer (100 mM Tris-HCl pH 7.5, 10 mM EDTA, 1% SDS, 150 mM NaCl, 300 mM sodium acetate) followed by phenol-chloroform extraction and isolation of the RNA by ethanol precipitation. The RNA pallet was washed with 70% aqueous ethanol, dried, and dissolved in 10 μL loading buffer. Splicing intermediates and products were analyzed by electrophoresis in 13% denaturing polyacrylamide gels. The fractionated RNAs were visualized by PhosphorImager (Molecular Dynamics), and RNA signals were quantified by ImageQuant version 4.2 software (Molecular Dynamics).

Spliceosome assembly

Spliceosome assembly and separation of individual complexes were performed essentially as described earlier (Das and Reed 1999). Briefly, pre-mRNA (~5 ng) was incubated in HeLa nuclear extract in the absence or presence of theophylline (12.5 μL total volume) under the conditions that support in vitro splicing. After the incubation, 2.5 μL of 4 μg/μL heparin and 2.5 μL of 5 × loading dye containing 1 × TBE (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA), 20% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanol were added, and the 3-μL aliquots of each reaction mixture were loaded on a 2% horizontal low-melting agarose gels followed by the separation of spliceosome complexes at 70 V for 4–6 h in Trisglycine running buffer at room temperature (Konarska and Sharp 1986). Gels were fixed in 10% acetic acid and 10% methanol for 30 min and then were dried under vacuum at 80°C.

Acknowledgments

We are particularly grateful to John Rossi for encouragement throughout the course of this work. We also thank Juan Valcarcel and R.-J. Lin for valuable suggestions; Robin Reed for the generous gift of the plasmids pHMS81, pAdML21AG, pAdML Par, and pAdML ΔAG; Faith Osep for administrative assistance; and members of Gaur laboratory for critical reading of the manuscript. This work was supported in part by a Department of Defense (CDMRP) grant to R.K.G. (BC023235) and from Beckman Research Institute start-up funds.

REFERENCES

  1. Black, D.L. 2003. Mechanisms of alternative pre-messenger RNA splicing. Annu. Rev. Biochem. 72: 291–336. [DOI] [PubMed] [Google Scholar]
  2. Buratti, E. and Baralle, F.E. 2004. Influence of RNA secondary structure on the pre-mRNA splicing process. Mol. Cell. Biol. 24: 10505–10514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Butcher, S.E. and Brow, D.A. 2005. Towards understanding the catalytic core structure of the spliceosome. Biochem. Soc. Trans. 33: 447–449. [DOI] [PubMed] [Google Scholar]
  4. Chiara, M.D., Palandjian, L., Feld Kramer, R., and Reed, R. 1997. Evidence that U5 snRNP recognizes the 3′ ss for catalytic step II in mammals. EMBO J. 16: 4746–4759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chua, K. and Reed, R. 2001. An upstream AG determines whether a downstream AG is selected during catalytic step II of splicing. Mol. Cell. Biol. 21: 1509–1514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Claverie, J.M. 2001. Gene number: What if there are only 30,000 human genes? Science 291: 1255–1257. [DOI] [PubMed] [Google Scholar]
  7. Collins, C.A. and Guthrie, C. 1999. Allele-specific genetic interactions between Prp8 and RNA active site residues suggest a function for Prp8 at the catalytic core of the spliceosome. Genes & Dev. 13: 1970–1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. ———. 2001. Genetic interactions between the 5′ and 3′ splice site consensus sequences and U6 snRNA during the second catalytic step of pre-mRNA splicing. RNA 7: 1845–1854. [PMC free article] [PubMed] [Google Scholar]
  9. Das, R. and Reed, R. 1999. Resolution of the mammalian E complex and the ATP-dependent spliceosomal complexes on native agarose mini-gels. RNA 5: 1504–1508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Deirdre, A., Scadden, J., and Smith, C.W. 1995. Interactions between the terminal bases of mammalian introns are retained in inosine-containing pre-mRNAs. EMBO J. 14: 3236–3246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dignam, J.D., Lebovitz, R.M., and Roeder, R.G. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11: 1475–1489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Eperon, L.P., Graham, I.R., Griffiths, A.D., and Eperon, I.C. 1988. Effects of RNA secondary structure on alternative splicing of pre-mRNA: Is folding limited to a region behind the transcribing RNA polymerase? Cell 54: 393–401. [DOI] [PubMed] [Google Scholar]
  13. Goguel, V. and Rosbash, M. 1993. Splice site choice and splicing efficiency are positively influenced by pre-mRNA intramolecular base pairing in yeast. Cell 72: 893–901. [DOI] [PubMed] [Google Scholar]
  14. Goguel, V., Wang, Y., and Rosbash, M. 1993. Short artificial hairpins sequester splicing signals and inhibit yeast pre-mRNA splicing. Mol. Cell. Biol. 13: 6841–6848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Goodall, G.J. and Filipowicz, W. 1991. Different effects of intron nucleotide composition and secondary structure on pre-mRNA splicing in monocot and dicot plants. EMBO J. 10: 2635–2644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gozani, O., Patton, J.G., and Reed, R. 1994. A novel set of spliceo some-associated proteins and the essential splicing factor PSF bind stably to pre-mRNA prior to catalytic step II of the splicing reaction. EMBO J. 13: 3356–3367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Graveley, B.R. 2001. Alternative splicing: Increasing diversity in the proteomic world. Trends Genet. 17: 100–107. [DOI] [PubMed] [Google Scholar]
  18. Hastings, M.L. and Krainer, A.R. 2001. Pre-mRNA splicing in the new millennium. Curr. Opin. Cell. Biol. 13: 302–309. [DOI] [PubMed] [Google Scholar]
  19. Jenison, R.D., Gill, S.C., Pardi, A., and Polisky, B. 1994. High-resolution molecular discrimination by RNA. Science 263: 1425–1429. [DOI] [PubMed] [Google Scholar]
  20. Johnson, J.M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P.M., Armour, C.D., Santos, R., Schadt, E.E., Stoughton, R., and Shoemaker, D.D. 2003. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302: 2141–2144. [DOI] [PubMed] [Google Scholar]
  21. Jurica, M.S. and Moore, M.J. 2003. Pre-mRNA splicing: Awash in a sea of proteins. Mol. Cell 12: 5–14. [DOI] [PubMed] [Google Scholar]
  22. Konarska, M.M. and Sharp, P.A. 1986. Electrophoretic separation of complexes involved in the splicing of precursors to mRNAs. Cell 46: 845–855. [DOI] [PubMed] [Google Scholar]
  23. Krainer, A.R., Maniatis, T., Ruskin, B., and Green, M.R. 1984. Normal and mutant human β-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell 36: 993–1005. [DOI] [PubMed] [Google Scholar]
  24. Kubodera, T., Watanabe, M., Yoshiuchi, K., Yamashita, N., Nishimura, A., Nakai, S., Gomi, K., and Hanamoto, H. 2003. Thiamine-regulated gene expression of Aspergillus oryzae thiA requires splicing of the intron containing a riboswitch-like domain in the 5′-UTR. FEBS Lett 555: 516–520. [DOI] [PubMed] [Google Scholar]
  25. Lian, Y. and Garner, H.R. 2005. Evidence for the regulation of alternative splicing via complementary DNA sequence repeats. Bioinformatics 21: 1358–1364. [DOI] [PubMed] [Google Scholar]
  26. Liu, H.-K., Goodall, G.J., Kole, R., and Filipowicz, W. 1995. Effects of secondary structure on pre-mRNA splicing: Hairpins sequestering the 5′ but not the 3′ ss inhibit intron processing in Nicotiana plumbaginifolia. EMBO J. 14: 377–388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu, Z.R., Laggerbauer, B., Luhrmann, R., and Smith, C.W. 1997. Crosslinking of the U5 snRNP-specific 116-kDa protein to RNA hairpins that block step 2 of splicing. RNA 3: 1207–1219. [PMC free article] [PubMed] [Google Scholar]
  28. Lopez, A.J. 1998. Alternative splicing of pre-mRNA: Developmental consequences and mechanisms of regulation. Annu. Rev. Genet. 32: 279–305. [DOI] [PubMed] [Google Scholar]
  29. Maniatis, T. and Tasic, B. 2002. Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418: 236–243. [DOI] [PubMed] [Google Scholar]
  30. Mironov, A.A., Fickett, J.W., and Gelfand, M.S. 1999. Frequent alternative splicing of human genes. Genome Res. 9: 1288–1293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nilsen, T.W. 2003. The spliceosome: The most complex macromolecular machine in the cell? Bioessays 25: 1147–1149. [DOI] [PubMed] [Google Scholar]
  32. Nudler, E. and Mironov, A.S. 2004. The riboswitch control of bacterial metabolism. Trends Biochem. Sci. 29: 11–17. [DOI] [PubMed] [Google Scholar]
  33. Parker, R. and Siliciano, P.G. 1993. Evidence for an essential non–Watson-Crick interaction between the first and last nucleotides of a nuclear pre-mRNA intron. Nature 361: 660–662. [DOI] [PubMed] [Google Scholar]
  34. Patterson, B. and Guthrie, C. 1991. A U-rich tract enhances usage of an alternative 3′ ss in yeast. Cell 64: 181–187. [DOI] [PubMed] [Google Scholar]
  35. Sanford, J.R. and Caceres, J.F. 2004. Pre-mRNA splicing: Life at the centre of the central dogma. J. Cell. Sci. 117: 6261–6263. [DOI] [PubMed] [Google Scholar]
  36. Shomron, N. and Ast, G. 2003. Boric acid reversibly inhibits the second step of pre-mRNA splicing. FEBS Lett. 552: 219–224. [DOI] [PubMed] [Google Scholar]
  37. Shomron, N., Malca, H., Vig, I., and Ast, G. 2002. Reversible inhibition of the second step of splicing suggests a possible role of zinc in the second step of splicing. Nucleic Acids Res. 30: 4127–4137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Solnick, D. 1985. Alternative splicing caused by RNA secondary structure. Cell 43: 667–676. [DOI] [PubMed] [Google Scholar]
  39. Sontheimer, E. and Steitz, J.A. 1993. The U5 and U6 small nuclear RNAs as active site components of the spliceosome. Science 262: 1989–1996. [DOI] [PubMed] [Google Scholar]
  40. Soukup, J.K. and Soukup, G.A. 2004. Riboswitches exert genetic control through metabolite-induced conformational change. Curr. Opin. Struct. Biol. 14: 344–349. [DOI] [PubMed] [Google Scholar]
  41. Staley, J.P. and Guthrie, C. 1998. Mechanical devices of the spliceosome: Motors, clocks, springs, and things. Cell 92: 315–326. [DOI] [PubMed] [Google Scholar]
  42. Stevens, S.W. and Abelson, J. 2002. Yeast pre-mRNA splicing: Methods, mechanisms, and machinery. Methods Enzymol. 351: 200–220. [DOI] [PubMed] [Google Scholar]
  43. Sudarsan, N., Barrick, J.E., and Breaker, R.R. 2003. Metabolite-binding RNA domains are present in the genes of eukaryotes. RNA 9: 644–647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Thanaraj, T.A., Stamm, S., Clark, F., Riethoven, J.J., Le Texier, V., and Muilu, J. 2004. ASD: The Alternative Splicing Database. Nucleic Acids Res. 32(database issue): D64–D69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tucker, B.J. and Breaker, R.R. 2005. Riboswitches as versatile gene control elements. Curr. Opin. Struct. Biol. 15: 342–348. [DOI] [PubMed] [Google Scholar]
  46. Umen, J.G. and Guthrie, C. 1995. The second catalytic step of pre-mRNA splicing. RNA 1: 869–885. [PMC free article] [PubMed] [Google Scholar]
  47. Villemaire, J., Dion, I., Elela, S.A., and Chabot, B. 2003. Reprogramming alternative pre-messenger RNA splicing through the use of protein-binding antisense oligonucleotides. J. Biol. Chem. 278: 50031–50039. [DOI] [PubMed] [Google Scholar]
  48. Will, C.L. and Luhrmann, R. 2001. Spliceosomal UsnRNP biogenesis, structure and function. Curr. Opin. Cell. Biol. 13: 290–301. [DOI] [PubMed] [Google Scholar]
  49. Winkler, W., Nahvi, A., and Breaker, R.R. 2002. Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature 419: 952–956. [DOI] [PubMed] [Google Scholar]
  50. Zillmann, M., Zapp, M.L., and Berget, S.M. 1988. Gel electrophoretic isolation of splicing complexes containing U1 small nuclear ribonucleoprotein particles. Mol. Cell. Biol. 8: 814–821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zimmermann, G.R., Jenison, R.D., Wick, C.L., Simorre, J.P., and Pardi, A. 1997. Interlocking structural motifs mediate molecular discrimination by a theophylline-binding RNA. Nat. Struct. Biol. 4: 644–649. [DOI] [PubMed] [Google Scholar]
  52. Zimmermann, G.R., Wick, C.L., Shields, T.P., Jenison, R.D., and Pardi, A. 2000. Molecular interactions and metal binding in the theophylline-binding core of an RNA aptamer. RNA 6: 659–667. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from RNA are provided here courtesy of The RNA Society

RESOURCES