Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2002 Aug 1;30(15):3312–3322. doi: 10.1093/nar/gkf462

Transcriptional deregulation of the keratin 18 gene in human colon carcinoma cells results from an altered acetylation mechanism

Philippe Prochasson 1, Cécile Delouis 1, Olivier Brison 1,a
PMCID: PMC137086  PMID: 12140315

Abstract

We are investigating the mechanism responsible for the overexpression of the keratin 18 (K18) gene in tumorigenic clones from the SW613-S human colon carcinoma cell line, as compared with non-tumorigenic clones. We have previously shown that this mechanism affects the minimal K18 promoter (TATA box and initiation site). We report here that treatment of the cells with histone deacetylase inhibitors stimulates the activity of the promoter in non-tumorigenic cells but has no effect in tumorigenic cells, resulting in a comparable activity of the promoter in both cell types. The adenovirus E1A protein inhibits the activity of the K18 promoter specifically in tumorigenic cells. This inhibition can be reversed by an excess of CBP protein. The conserved region 1 (CR1) of E1A, which is involved in the interaction with the CBP/p300 co-activators, is necessary to the inhibitory capacity of E1A. A 79 amino acid long N-terminal fragment of E1A, encompassing the two domains of E1A necessary and sufficient for binding to CBP (N-terminus and CR1), has the same differential inhibitory capacity on the K18 promoter as wild-type E1A. Forced recruitment of GAL4–CBP fusion proteins to the K18 promoter results in a greater stimulation of its activity in non-tumorigenic than in tumorigenic cells. The histone acetyltransferase activity of CBP is essential for this differential stimulation and the presence of the CBP2 domain greatly augments the activation capacity of the fusion protein. Chromatin immunoprecipitation experiments carried out with anti-acetylated histone antibodies showed no difference in the level of histone acetylation in the region of the K18 promoter between the two cell types. The structure of chromatin in the promoter region is similar in tumorigenic and non-tumorigenic cells, as determined by mapping of DNase I hypersensitive sites and probing the accessibility of the DNA to restriction endonucleases. From all these results we conclude that alteration of an acetylation mechanism involving the CBP (or p300) protein and acting on a non-histone substrate is responsible for the higher activity of the K18 promoter in tumorigenic cells of the SW613-S cell line.

INTRODUCTION

Transcription is a key step in the regulation of gene expression. Transcription initiation involves the recognition of promoter DNA sequences by RNA polymerase II and transcription factors and the formation of a pre-initiation complex (1). The regulation of transcription is mediated not only by the action of transcription factors, but also by the structure of the chromatin template (2,3). Acetylation of histones has been shown to correlate with transcriptional activation. Hyperacetylated chromatin is found associated with actively transcribed genes, whereas hypoacetylation often correlates with gene silencing. There is also evidence for regulation of the activity of non-histone proteins by acetylation, in particular transcription factors (4). The acetylation state of histones and, most likely, other proteins, is a dynamic process which is regulated by the opposing activities of histone acetyltransferases (HAT) and histone deacetylases (5). Several proteins directly involved in transcriptional regulation have been shown to possess HAT activity. Such is the case for the TAFII250 general transcription factor and for the CBP/p300 and P/CAF proteins that are known co-activators of a variety of transcription factors (6–9). In addition, the CBP/p300 and P/CAF proteins have also been identified as components of the RNA polymerase II holoenzyme (10,11).

Deregulated gene expression is a hallmark of cancer cells. Many of the genetic lesions which have been documented in these cells affect genes encoding transcription factors (12). Recently, such lesions were also found in genes encoding proteins involved in histone modifications and chromatin remodeling (13,14). Alterations of the CBP and p300 genes have been reported in some tumor cells (13,15–17). One CBP allele is inactivated in the Rubinstein-Taybi syndrome which is associated with an increased predisposition to cancer (18). We are studying the mechanisms involved in transcriptional deregulation of gene expression in the cells of the SW613-S colon carcinoma cell line. This cell line is heterogeneous and composed of two main cell types: cells with a high level of amplification and expression of the c-myc gene, which are tumorigenic in nude mice, and cells with a low level of amplification, which are non-tumorigenic. Other phenotypic traits, such as the capability to grow in serum-free medium or the sensitivity to the induction of apoptosis, are markedly different between the two cell types. Several clones representative of one or the other type have been isolated (19). Many genes were shown to be overexpressed in the cells of tumorigenic clones, as compared with cells of non-tumorigenic clones (20–22). This situation most likely reflects a deregulation of gene expression in tumorigenic cells since, for some of these genes, we have shown that the expression level in non-tumorigenic cells corresponds to the level of expression found in epithelial cells of the normal human colon. Among the genes overexpressed in tumorigenic cells, we have chosen the keratin 18 (K18) gene with the aim of investigating the mechanism responsible for its overexpression in tumorigenic cells. We previously reported (23) that this mechanism exerts its effect on the minimal K18 promoter (TATA box and initiation site) and that it does not involve the binding of a factor to a specific site on the DNA (24). We also found that sodium butyrate treatment stimulates the expression of the resident K18 gene in non-tumorigenic, but not in tumorigenic cells. The effect of sodium butyrate on the K18 promoter is a direct one since it is insensitive to the protein synthesis inhibitor cycloheximide (24). Here, we provide evidence that K18 gene overexpression in tumorigenic cells is driven by an acetylation mechanism involving the CBP (or p300) protein and acting on a non-histone substrate.

MATERIALS AND METHODS

Cell lines, transfection and luciferase assays

The origin of the SW613-S cell line (erroneously referred to as a breast carcinoma cell line in the past) and cell culture conditions have been described previously (25,26). SW613-3 and SW613-12A1 are tumorigenic clones and SW613-B3 a non-tumorigenic clone derived from the SW613-S cell line (27). Transfection and luciferase assays were performed in duplicate for each construct in each experiment, as described previously (23,24). Six micrograms of each plasmid were used, unless otherwise stated. In each experiment, the two cell types were transfected in parallel with the pSVluc construct and the activity of any promoter construct was expressed relative to that of the SV40 early promoter. We have previously shown that this viral promoter is equally active in both cell types (23).

Plasmid constructions

Construction of plasmids pK18(41)luc, pK18(80)luc and pSVluc has been reported elsewhere (24). Plasmid p(AP1)3K18(41)luc was constructed by inserting three copies of an oligonucleotide containing an AP1-binding site (CTAGTGTGAGTCATGTGTG) between the SacI and NheI restriction sites of plasmid pK18(41)luc. Plasmid p(Ets)3< K18(41)luc was constructed by inserting three copies of an oligonucleotide containing an Ets-binding site (CAGGTCCGGAAGTAAAGC) between the SacI and NheI sites of plasmid pK18(41)luc. A KpnI–SphI fragment, excised from plasmid pUS(gal4)K18 and containing four GAL4-binding sites (28), was introduced between the KpnI and SstI sites of plasmids pK18(41)luc or pK18(80)luc to yield plasmids p(gal4)K18(41)luc or p(gal4)K18(80)luc, respectively. A XbaI–SacI fragment, isolated from plasmid p4×(GTIIC× 2)K18 and containing eight binding sites for transcription factor TEF-1 (GTIIC motifs) (29), was introduced between the SacI and XhoI sites of plasmid p(gal4)K18(41)luc to yield plasmid p(gal4)(GTIIC×2)4K18(41)luc. Plasmid pSG4 coding for the full-length GAL4 polypeptide has been described elsewhere (23). A DNA fragment encoding the H1 acidic domain (amino acids 411–455) of the herpes virus activator VP16 was inserted between the EcoRI and XbaI sites of plasmid pHKG-T (encoding the GAL4 DNA-binding domain) to yield plasmid pHKGT–VP16 coding for the GAL4–VP16 fusion polypeptide. Plasmids pPO64, pSW5, pSW1 and pSW6 were kindly provided by Dr P. O’Hare (30). Plasmid pCMV–E1A12S contained a cDNA coding for the adenovirus E1A12S polypeptide placed under the control of the cytomegalovirus promoter. Plasmid pCMV–E1AΔCR1 and plasmid pCMV–E1AΔCR2 were derived from plasmid pCMV–E1A12S by deleting the cDNA regions encoding amino acids 30–85 or 122–129 of the E1A12S protein, respectively. The expression vector encoding E1A–C79 was kindly provided by Dr R. Evans (31). The plasmid pCMV– mCBP contains the sequence coding for the full-length mouse CBP protein and was a kind gift of Dr A. Harel-Bellan (Villejuif). The construction and structure of the plasmids coding for polypeptides GAL4–CBP HAT, GAL4–CBP HATΔ, GAL4–CBP HAT CBP2, GAL4–CBP HATΔ CBP2, GAL4–CBP2 and GAL4–P/CAF, have been described by Martinez-Balbas et al. (32). Dr T. Kouzarides (Cambridge, UK) kindly provided them.

Histone preparation and analysis

Histones were prepared as described by Cousens et al. (33). One hundred micrograms of each extract were resuspended in sample buffer (8 M urea, 5% acetic acid, 5% β-mercaptoethanol and 0.3% pyronine Y) and loaded onto a 14% polyacrylamide gel containing 8 M urea, 5% acetic acid and 0.4% Triton X-100. The electrophoresis was carried out as described previously (34).

Chromatin immunoprecipitation assays

Two kits from Upstate Biotechnology containing anti-acetylated histone H3 or H4 antibodies were used. The chromatin immunoprecipitation assays were carried out according to the protocol of the supplier. Immunoprecipitated DNA was used as a template in polymerase chain reactions performed with the following pairs of forward and reverse primers: 20mer primers with 5′ ends at positions 2481 and 2724 of the human K18 gene (35; accession no. AF179904); primers GTGCGTGCCCAGTTGAACCA and CGGCTGACTGTCGAACAGGA for the human GAPDH gene; 20mer primers with 5′ ends at positions 249 and 465 of the human FGF-3 gene (36; accession no. X14445); primers TGTATCTTATGGTACTGTAACTG and CTTTATGTTTTTGGCGTCTTCCA complementary to vector sequences for cells transfected with plasmids pSVluc and pK18(80)luc in transient expression assays. Polymerase chain reaction conditions were: 95°C, 3 min; (95°C, 0.5 min; 65°C, 0.5 min; 72°C, 1.5 min) × n; 72°C, 5 min for assays on the resident genes. The number of cycles was 30 unless otherwise stated. For transient expression assays, the annealing temperature was lowered to 55°C. Quantification of the fluorescent (ethidium bromide staining) or radioactive (Southern blots) signals was achieved with the Image Gauge 3.12 software (Fuji Photo Film Co., Japan) after acquisition of the images with a video camera or a Fuji Bioimaging Analyzer BAS 1000, respectively.

Endonuclease protection assays

Mapping of DNase I hypersensitive sites was performed as previously described (37). Restriction endonuclease protection assays were carried out essentially as described by Tchenio et al. (38) with the following modifications: 107 cells were lysed in 10 ml of buffer, 100 U of each restriction enzyme was used to digest the nuclei and RNase treatment (10 µg/ml, 1 h, 37°C) was done in the nucleus lysis buffer containing SDS, before addition of proteinase K. Southern blotting and hybridizations were performed as previously described (37). The A and B probes were derived from plasmids pBK18I1AB and pBK18I1CD, respectively (39).

RESULTS

Two groups of activators can be distinguished by their effect on the K18 promoter

We have shown previously (23) that the behavior of the K18 promoter in transient expression assays mimics the regulation of the resident K18 gene in SW613-S cells. Indeed, the promoter is more active in cells of tumorigenic clones than in cells of non-tumorigenic clones from the SW613-S cell line. An Sp1-binding site, which is located upstream of the K18 minimal promoter, stimulates its activity without altering its differential regulation between tumorigenic and non-tumorigenic cells. In contrast, substitution of this Sp1 site by the 72-bp enhancer elements of the SV40 early promoter renders the promoter equally active in both cell types. These results suggested that some activators can abrogate the differential control of the K18 minimal promoter whereas others cannot. To strengthen this conclusion, different promoter constructs were made by inserting AP1-, Ets- or TEF-1 (GTIIC)-binding sites upstream of the K18 minimal promoter. The activity of these constructs was determined in transient expression assays performed with SW613-3 (tumorigenic) and SW613-B3 (non-tumorigenic) cells (Fig. 1A). For comparison of the differential activity of the various promoter constructs between the two cell types, we shall refer hereafter to factor ‘δ’, defined as the ratio of the activity in tumorigenic cells to that in non-tumorigenic cells. The presence of AP1-binding sites results in a 10-fold stimulation of the activity of the minimal promoter in both cell types [compare p(AP1)3K18(41)luc and pK18(41)luc]. Therefore, the differential expression of the reporter gene is maintained (δ = 3.7). Similarly, the presence of Ets-binding sites [p(Ets)3K18(41)luc] results in a 9-fold stimulation of the activity of the promoter in both cell types and does not affect its differential regulation (δ = 3.7). The minimal promoter flanked by its upstream Sp1-binding site [pK18(80)luc] displays a 6–10-fold higher activity than the minimal promoter in the two cell types. Thus, the differential behavior of the promoter is unaffected (δ = 5.6), confirming previous results (23). In contrast, the presence of the GTIIC sequence [p(GTIIC×2)4K18(41)luc] stimulates the activity of the promoter (3.5-fold) only in non-tumorigenic SW613-B3 cells. This unbalanced stimulation results in a suppression of the differential control of the promoter which becomes equally active in both cell types (δ = 1.3).

Figure 1.

Figure 1

Effect of different activators on the activity of the K18 promoter. (A) Construct pK18(41)luc corresponds to the K18 minimal promoter (TATA box and transcription start site). Concatenated copies of AP1-, Ets- or GTIIC-binding sites were inserted upstream of the minimal promoter, as indicated by the names of the plasmids. Plasmid pK18(80)luc contains the minimal promoter flanked by its natural upstream Sp1-binding site. Tumorigenic SW613-3 and non-tumorigenic SW613-B3 cells were transfected with the indicated plasmids. Two days after transfection, cell extracts were prepared and luciferase assays were performed. Luciferase activities are expressed relative to that obtained with plasmid pSVluc (SV40 early promoter) for each cell clone. The ratio of the luciferase activity in SW613-3 cells to that in SW613-B3 cells (δ factor) is indicated at the top. The experiments were performed three times. Error bars represent the SD of the mean of the three experiments. (B) The p(gal4)K18(80)luc construct contains three copies of a GAL4-binding site inserted upstream of the K18(80) promoter. Experiments were performed and results are presented as in (A), except that the experiments were performed five times and that SW613-3 and -B3 cells were co-transfected with plasmid p(gal4)K18(80)luc and with plasmids coding for the indicated polypeptides. GAL4–VP16, GAL4 DNA-binding domain fused to acidic domain H1 of VP16; GAL4 (DBD+AD), full-length GAL4 protein. (C) Experiments were carried out and results are presented as in (A) except that a logarithmic scale was chosen to take into account the large stimulation of the promoter activity achieved by some VP16 constructs. The experiments were repeated twice. A graphical representation of the GAL4–VP16 mutants is shown beside their names: black line, GAL4 DNA-binding domain; H1 and H2 boxes, VP16 acidic domains; the positions of mutated phenylalanine residues are indicated.

We then looked at the effect of acidic activators, such as the yeast activator GAL4 and the herpes virus activator VP16, on the activity of the K18 promoter (Fig. 1B). For this purpose, the p(gal4)K18(80)luc construct (minimal K18 promoter with its flanking Sp1-binding site and three GAL4-binding sites inserted further upstream) was used. The GAL4–VP16 chimeric protein, which consists of the DNA-binding domain of GAL4 fused to the acidic domain of the activator VP16, stimulates the activity of the promoter much more efficiently in non-tumorigenic cells (60-fold) than in tumorigenic cells (13-fold). Similarly, the full-length GAL4 protein [GAL4 (DBD-AD)] yields a 25-fold stimulation of the promoter activity in non-tumorigenic cells, as compared with 5-fold in tumorigenic cells. In both cases, this unbalanced stimulation results in the suppression of the differential regulation of the promoter which becomes equally active in both cell types (δ = 1.4–1.5). Similar results were obtained with a reporter construct containing three GAL4-binding sites inserted upstream of the minimal promoter of K18 [p(gal4)K18(41)luc, data not shown].

Altogether, these results lead us to distinguish two classes of activators: (i) activators like Sp1, AP1 and Ets that stimulate equally the activity of the promoter in both cell types and maintain its differential behavior; (ii) activators like GAL4, TEF-1 (GTIIC), VP16 and the enhancer of the SV40 early promoter that stimulate the activity of the promoter more efficiently in non-tumorigenic than in tumorigenic cells, resulting in the loss of its differential regulation. A likely explanation for this phenomenon is that these two classes of activators stimulate the promoter by different mechanisms. It has been shown recently (40) that the acidic activators VP16 and GCN4 have the ability to recruit factors that exhibit acetyltransferase activity. The VP16 activation domain contains two acidic regions (H1 and H2). Some phenylalanine residues within these regions (F442 in H1 and F473, F475 and F479 in H2) are important for the activation function of the domain (30). In particular, it was shown that a VP16 activation domain deleted of the H2 region still interacts with the SAGA and NuA4 complexes but that an additional phenylalanine-to-proline mutation (F442P) in this molecule abolishes its interaction capacity with these HAT complexes (40). The effect of several VP16 mutants on the activity of the K18 promoter was therefore tested (Fig. 1C). GAL4–VP16 chimeric proteins that retain at least one intact acidic region (pHKGT–VP16, pPO64 and pSW1) stimulate the activity of the promoter more efficiently in non-tumorigenic (85–300-fold) than in tumorigenic cells (25–90-fold) and reduce greatly the differential expression of the reporter gene. In contrast, the F442P mutation in the context of the H1 region alone (pSW5) or all four F442P, F473A, F475A and F479A mutations in the context of both the H1 and H2 acidic regions (pSW6) result in chimeric proteins which still stimulate the K18 promoter but to a similar level (3–5-fold) in both non-tumorigenic and tumorigenic cells and are therefore unable to affect its differential regulation. These results raise the possibility that the differential activity of the K18 promoter is linked to a difference in an acetylation mechanism between tumorigenic and non-tumorigenic SW613-S cells.

Specific activation of the K18 promoter by deacetylase inhibitors in non-tumorigenic cells

The deacetylase inhibitors sodium butyrate and trichostatin A have been shown to increase the level of histone acetylation in vivo, leading to an alteration of chromatin structure and concomitant changes in the regulation of gene expression at the transcriptional level (41). We have previously reported that sodium butyrate treatment stimulates the expression of the resident K18 gene in non-tumorigenic, but not in tumorigenic, cells (24). Transient expression assays were carried out with the pK18(80)luc construct in tumorigenic and non-tumorigenic cells that had been treated for 12 h with sodium butyrate or trichostatin A (Fig. 2A). These treatments result in a 4.0–4.5-fold stimulation of the promoter activity in non-tumorigenic SW613-B3 cells, whereas no stimulation is observed in tumorigenic SW613-3 cells. Therefore, treatment with deacetylase inhibitors overcomes the differential behavior of the K18 promoter between the two cell types (δ = 1.4 and 1.0, respectively). A potential difference in the sensitivity of the two cell types to the histone deacetylase inhibitors could be responsible for the observed effect. To resolve this issue, histones extracted from SW613-3 or -B3 cells, pre-treated or not with sodium butyrate or trichostatin A, were analyzed by acid-urea-triton polyacrylamide gel electrophoresis (Fig. 2B). Hyperacetylation of histones H4, H2B and H3 is clearly visible upon treatment of both SW613-3 and -B3 cells. Moreover, the patterns of acetylated histones are very similar, indicating that the differential effect of the drugs on the activity of the K18 promoter is not due to a different sensitivity of the two cell types to these inhibitors. During the course of these experiments, we could also compare the state of acetylation of the histones extracted from untreated SW613-3 or -B3 cells (Fig. 2B). No difference in the electrophoretic patterns is detectable, indicating that no widespread and constitutive hyperacetylation of histones spontaneously occurs in tumorigenic compared with non-tumorigenic cells. Conceivably, such an alteration of the overall level of histone acetylation could have been responsible for the higher activity of the K18 promoter in tumorigenic cells. From all the results reported above, we conclude that a difference in the level of acetylation of histones and/or of some other proteins controlling the activity of the transcription complex between tumorigenic and non-tumorigenic cells plays a role in the differential activity of the K18 promoter. This differential acetylation mechanism has probably a local effect, restricted to the promoter region.

Figure 2.

Figure 2

Effect of sodium butyrate and trichostatin A treatment on the activity of the K18(80) promoter. (A) SW613-3 or -B3 cells were transfected with plasmid pK18(80)luc and treated with 1 mM sodium butyrate (NaBu) or 300 nM trichostatin A (TSA). After 12 h, cell extracts were prepared and luciferase assays were performed. Experiments were performed and results are presented as in Figure 1A except that they were repeated six times. (B) Effect of deacetylase inhibitors on histone acetylation in SW613-3 and -B3 cells. Cells were treated for 12 h with 1 mM sodium butyrate (NaBu) or 300 nM TSA, as indicated. Histones were extracted from treated and untreated cells and analyzed on an acid-polyacrylamide gel containing urea and Triton X-100. The gel was stained with Coomassie blue. The different acetylated forms of histone H4 are indicated as follows: 0, non-acetylated; 1, monoacetylated; 2, diacetylated; 3, triacetylated; 4, tetraacetylated.

Specific inhibition of the K18 promoter by the adenovirus E1A protein in tumorigenic cells

Several factors involved in the control of transcription harbor an acetyltransferase activity (42). This is especially true for the CBP and p300 proteins which are co-activators for several specific transcription factors (43), but could also be more widely involved in the formation of the transcription complex since they have been found associated with the RNA polymerase II holoenzyme (10,11). The adenovirus E1A protein binds to CBP and p300 and prevents their interaction with partner proteins such as P/CAF. In addition, it has been shown that the HAT activity of p300 is inhibited by E1A (31,44). The effect of the E1A protein on the activity of the K18 promoter was determined in tumorigenic and non-tumorigenic cells. A series of co-transfections was carried out in both cell types with the pK18(80)luc promoter construct and expression vectors coding for different forms of the adenovirus E1A protein (Fig. 3A). The wild-type E1A protein strongly inhibits (10-fold) the activity of the promoter in tumorigenic cells but has almost no effect (<2-fold inhibition) in non-tumorigenic cells. This results in the abolition of the differential behavior of the promoter (δ = 1.7). A mutant form of the E1A protein (E1AΔCR1), deleted of the conserved region 1 (CR1) which is necessary for the interaction with CBP/p300, is unable to repress the activity of the promoter in tumorigenic cells. In contrast, the E1A mutant E1AΔCR2, lacking the CR2 domain which is involved in the interaction with cellular factors such as the proteins of the Rb family, has the same effect on the activity of the K18 promoter as the wild-type E1A protein. Therefore, the inhibition of the activity of the K18 promoter by E1A is mediated by the CR1 domain. The E1A mutant C79 consists only of the N-terminal 79 amino acids of the E1A protein. This region encompasses the CR1 domain (amino acids 35–76) and the N-terminus domain (N25: first 25 amino acids), both of which are necessary and sufficient for CBP/p300 binding (45). Mutant C79 has the same effect on the activity of the K18 promoter as the wild-type E1A protein (Fig. 3A). In addition, the inhibitory effect of the E1A protein or of the C79 mutant on the promoter in tumorigenic cells can be reversed in a dose-dependent manner by overproduction of the CBP protein (Fig. 3B and data not shown). All these results indicate that the CBP (or p300) protein is likely to be involved in the mechanism responsible for the high activity of the K18 promoter in tumorigenic cells.

Figure 3.

Figure 3

Effect of the adenovirus E1A protein on the activity of the K18(80) promoter. (A) SW613-3 and -B3 cells were co-transfected with plasmid pK18(80)luc and one of the plasmids coding for the indicated polypeptides. E1A, full-length E1A12S protein; E1AΔCR1 and E1AΔCR2, E1A12S proteins with in-phase deletions between amino acids 30 and 85 or between amino acids 122 and 129, respectively. The E1A–C79 polypeptide consists of the N-terminal 79 amino acids of the E1A protein. Cells were treated (+NaBu) or not with 1 mM of sodium butyrate from the time of transfection. Experiments were performed and results are presented as in Figure 1A. They were repeated twice. The structure of the E1A12S protein and of the deletion mutants is schematized beneath the histogram. Numbering is in amino acids. (B) SW613-3 cells were transfected with plasmid pK18(80)luc alone or together with plasmids coding for the full-length E1A12S (E1A) or CBP protein, as indicated. Plasmid coding for E1A (0.5 µg) and varying quantities of plasmid coding for CBP were used, as indicated. Experiments were performed and results are presented as in Figure 1A, except that they were repeated twice. Luciferase activities are expressed relative to that obtained with plasmid pK18(80)luc.

As also shown in Figure 3A, expression of E1A prevents the previously observed stimulation of the promoter by sodium butyrate in non-tumorigenic cells (see above). This observation indicates that the mechanism responsible for hyperacetylation of a protein controlling the activity of the promoter in non-tumorigenic cells following sodium butyrate treatment is specifically inhibited by E1A. Furthermore, sodium butyrate treatment could not reverse the E1A inhibition of the promoter in tumorigenic cells (Fig. 3A). A plausible interpretation is that E1A represses a CBP (or p300) function specifically involved in the maintenance of a high-level acetylation of a protein necessary for a high activity of the promoter in these cells. This function cannot be replaced by another pathway that would hyperacetylate the factor in the presence of histone deacetylase inhibitors. These results strengthen the idea that the CBP (or p300) protein is specifically involved in the acetylation mechanism responsible for the differential regulation of the K18 promoter between tumorigenic and non-tumorigenic cells.

Unexpectedly, the E1AΔCR1 mutant protein stimulates specifically (4-fold) the activity of the K18 promoter in non-tumorigenic cells, whereas the wild-type E1A has almost no effect in these cells (Fig. 3A). This specific stimulation by the E1AΔCR1 mutant protein results in the abolition of the differential behavior of the promoter (δ = 1.9). In addition, sodium butyrate treatment in the presence of the E1AΔCR1 mutant protein barely increases this stimulation of the promoter in non-tumorigenic cells. This absence of an additive effect indicates that sodium butyrate and the mutant protein are acting through a common mechanism. This suggests that the stimulation observed with the E1AΔCR1 protein in non-tumorigenic cells is the consequence of an increase in the acetylation level of the protein implicated in the differential regulation of the K18 promoter. A possible explanation is that the E1AΔCR1 protein has the capacity to stimulate the HAT activity of CBP (or p300) through some as yet unknown mechanism. Thus, this mutant protein can mimic the effect of deacetylase inhibitors on the activity of the K18 promoter in non-tumorigenic cells. In support of this interpretation, one may recall that, in contrast to others (31,44), Ait-Si-Ali et al. (46) have reported a stimulatory effect of E1A on the HAT activity of CBP. Experiments are in progress to address this issue.

A role for the HAT and CBP2 domains of the CBP protein in the differential activity of the K18 promoter

Having established that the CBP (or p300) protein is likely to be involved in the acetylation mechanism responsible for the differential activity of the K18 promoter between the two cell types derived from the SW613-S cell line, we wondered whether the HAT activity of CBP would be able to directly stimulate the activity of the K18 promoter in a differential manner between the two cell types. Transient expression assays were performed by co-transfecting the p(gal4) K18(80)luc construct and different expression vectors coding for chimeric proteins made of the GAL4 DNA-binding domain fused to various domains of the CBP protein (Fig. 4). In a first series of experiments, we used a construct (GAL4–CBP HAT) which encodes a fusion protein containing the HAT domain of CBP. As a control, we used the GAL4– CBP HATΔ construct coding for the same protein with an in-phase deletion of 18 amino acids in the HAT domain which abolishes the HAT activity (32). The GAL4–CBP HATΔ protein had no significant effect on the activity or the differential behavior of the promoter (δ = 13.1 versus δ = 7.5). The GAL4–CBP HAT protein induces a moderate but reproducible stimulation of the activity of the promoter specifically in non-tumorigenic cells (4.6-fold in non-tumorigenic cells versus 1.7-fold in tumorigenic cells as compared with the GAL4–CBP HATΔ control). As a consequence, the differential behavior of the promoter is somewhat attenuated (δ = 4.9 versus δ = 13.1).

Figure 4.

Figure 4

Effect of different domains of the CBP protein on the activity of the K18(80) promoter. SW613-3 and -B3 cells were transfected with the plasmid pK18(80)luc alone (none) or together with one of the plasmids encoding the indicated polypeptides. Fold increase of the luciferase activity obtained in the presence of the GAL4–CBP HAT fusion protein, relative to that obtained in the presence of the GAL4–CBP HATΔ protein in the same cell type (×1), is indicated above each bar. Experiments were performed (three times) and results are presented as in Figure 1A. The structure of the fusion proteins between the DNA-binding domain of GAL4 and different domains of the CBP protein is schematized in the diagram below [adapted from Martinez-Balbas et al. (32)]. Numbering is in amino acids. Cys, ZZ and TAZ are putative zinc-finger regions. The CBP2 domain encompasses the ZZ and TAZ cysteine-rich regions and harbors the binding site for E1A and several other transcriptional activators. Bromo, the bromodomain; HAT, the histone acetyltransferase domain. The binding domain for CREB and other factors is indicated by a striped box and the GAL4 DNA-binding domain by a black box.

The C/H3 cysteine-rich region of the CBP protein (also named CBP2) lies adjacent to the HAT domain (32). This region is involved in the specific interaction of CBP not only with E1A, but also with a variety of specific transcription factors (MyoD, E2F, c-Fos, TFIIB) as well as with the P/CAF protein. The CBP2 domain has no effect on the activity of the K18 promoter when fused alone to the GAL4 DNA-binding domain (GAL4–CBP2, Fig. 4). However, it greatly augments the transactivation capacity of the CBP HAT domain, especially in non-tumorigenic cells, as shown by the effect of the GAL4–CBP HAT CBP2 polypeptide which contains the two contiguous domains fused to the GAL4 DNA-binding domain. When both domains are present, the activity of the promoter was enhanced 11-fold in non-tumorigenic cells but only 4-fold in tumorigenic cells, significantly reducing the differential behavior of the promoter between tumorigenic and non-tumorigenic cells (δ = 2.6). A deletion within the HAT domain that eliminates the HAT activity of the GAL4–CBP HAT CBP2 polypeptide (GAL4–CBP HATΔ CBP2, Fig. 4) completely abolished its activation potential, indicating that CBP2 synergizes with the functional HAT domain to increase the activation capacity of CBP. The implication of the CBP2 domain, which is specific to the CBP and p300 proteins, in the differential stimulation of the K18 promoter by GAL4–CBP HAT CBP2 again points out the specific role of CBP (or p300) in the differential activity of the promoter. Note that the GAL4–CBP HAT CBP2 fusion protein was able to overcome the strong inhibitory effect of the E1A protein on the activity of the K18 promoter (Fig. 4), mimicking the effect of the overexpression of the full-length CBP protein (see Fig. 3B). The P/CAF protein which interacts with the CBP2 domain of CBP/p300 is involved in the assembly of the pre-initiation complex and displays HAT activity. Co-transfection experiments similar to those described above were carried out with a construct encoding a GAL4–P/CAF chimeric protein in which the HAT domain of P/CAF is fused to the GAL4 DNA-binding domain. This fusion protein was efficiently synthesized in transfected cells and displayed HAT activity in the immunoprecipitation HAT assay of Ait-Si-Ali et al. (47) but was unable to stimulate the activity of the K18 promoter (data not shown). Altogether, these results lead us to conclude that the HAT activity, together with the CBP2 domain of the CBP (or p300) protein, are specifically involved in the acetylation mechanism responsible for the differential activity of the K18 promoter between tumorigenic and non-tumorigenic cells of the SW613-S cell line.

Chromatin structure and histone acetylation level at the K18 promoter are alike in tumorigenic and non-tumorigenic cells

A change in an acetylation mechanism in tumorigenic cells could affect the activity of the K18 promoter through a higher level of histone acetylation in the region of the promoter, resulting in an altered chromatin structure. To address directly this question, chromatin immunoprecipitation experiments were performed with anti-acetylated histone H3 antibodies. Both the promoter of the resident K18 gene in tumorigenic (SW613-3) and non-tumorigenic (SW613-B3) cells (Fig. 5) and that of the pK18(80)luc construct in transient expression assays carried out with these two cell lines (Fig. 6) were investigated by this technique. For the resident K18 gene, no significant difference in the acetylation level of histone H3 in the promoter region could be detected between SW613-3 and SW613-B3 cells (Fig. 5A, first and third lanes, and B). The results were in fact indistinguishable from those obtained with the promoter of the GAPDH gene which is expressed at the same level in tumorigenic and non-tumorigenic cells (O.Brison, unpublished results). In contrast, the acetylation level of histone H3 in the promoter region of the FGF-3 gene was found to be ∼4-fold higher in SW613-3 than in SW613-B3 cells. This gene is expressed in tumorigenic cells but is silent in non-tumorigenic cells (20). This last result indicates that our chromatin immunoprecipitation technique is operational and can detect differences in histone acetylation levels. Sodium butyrate treatment has no effect on the acetylation level of histone H3 in the region of the K18 and GAPDH promoters in either cell type (Fig 5A, last two lanes), despite the fact that it stimulates specifically the K18 promoter in non-tumorigenic cells (see above). In contrast, this treatment specifically increases the acetylation level of histone H3 in the promoter region of the FGF-3 gene in non-tumorigenic SW613-B3 which becomes equivalent to the acetylation level in tumorigenic SW613-3 cells.

Figure 5.

Figure 5

Acetylation level of histone H3 in the promoter region of the resident K18 gene. (A) Chromatin immunoprecipitation assays were performed as described in Materials and Methods for the promoter regions of the indicated genes. SW613-3 or -B3 cells were treated (+) or not (–) with sodium butyrate as described in Figure 2B and immunoprecipitation reactions were done in the presence (+) or absence (–) of anti-acetylated histone H3 antibody (Ab). Polymerase chain reaction amplification was for 30 cycles and the products were analyzed by agarose gel electrophoresis and ethidium bromide staining. Their sizes are indicated on the right. (B) For quantification purposes 15, 20 and 25 cycles of amplification were carried out and the products were analyzed by Southern blotting using as probes the 32P-labeled purified fragments. Radioactive signals were quantified as described in Materials and Methods and the average results of the three series of amplification are given. The results are expressed as the ratio of the signals obtained with SW613-3 and -B3 cells for each gene.

Figure 6.

Figure 6

Acetylation level of histone H3 in the region of the K18 promoter in transient expression assays. (A) SW613-3 and -B3 cells were transfected with the pK18(80)luc (K18) or the pSVluc (SV40) plasmid and chromatin immunoprecipitation assays were performed as described in Materials and Methods. Immunoprecipitation reactions were done in the presence (+) or absence (–) of anti-acetylated histone H3 antibody (Ab). Polymerase chain reaction amplification was for 25 cycles. The assays were performed in duplicate and the products were analyzed by agarose gel electrophoresis and ethidium bromide staining. Their sizes are indicated on the right. The amplification reaction of the first lane (–) was carried out without added template, as a control. (B) Luciferase activity was determined in transfected cell extracts as described in Figure 1A and is expressed relative to that obtained with plasmid pSVluc for each cell clone. Products of the polymerase chain reaction amplification of the chromatin immunoprecipitation assays (ChIP) were quantified after agarose gel electrophoresis and ethidium bromide staining (see Materials and Methods). Preliminary experiments with varying quantities of input template (data not shown) allowed the determination of reaction conditions yielding a linear relationship between input and signal after 25 cycles of amplification. The results are expressed as the ratio between the K18 and the SV40 signal for each cell clone. The ratios of the normalized luciferase activities and amplification signals obtained with SW613-3 and -B3 cells are also given.

In transient expression assays (Fig. 6), the results have to be normalized to those obtained with the early SV40 promoter to take into account a somewhat higher transfectability of SW613-3 compared with SW613-B3 cells. We have previously shown that this viral promoter is equally active in both cell types (23). Although the K18 promoter is, as expected, more active in tumorigenic than in non-tumorigenic cells (∼11-fold), again no difference in the acetylation level of histone H3 in the promoter region could be detected by the chromatin immunoprecipitation assay. Similar results were obtained for the promoter of the resident K18 gene and in transient expression assays when the same experiments were performed with an anti-acetylated histone H4 antibody (data not shown). Altogether, our data lead us to conclude that the acetylation mechanism involved in the differential expression of the K18 gene is acting on a non-histone substrate.

Despite the lack of a difference in histone acetylation level in the K18 promoter region between the two cell types, we wondered whether a difference in chromatin structure could be detected in this region. This was assayed by two different methods. First, DNase I hypersensitive sites were mapped in the promoter region of the resident K18 gene in tumorigenic and non-tumorigenic cells (Fig. 7A). Two closely spaced sites were localized in the vicinity of the Sp1-binding site important for the activity of the promoter (23), in agreement with results obtained by others (48), but these sites generate bands of similar intensity in the two cell types. As a second approach to probe chromatin structure, the accessibility of the DNA to restriction endonucleases in the promoter region of the resident K18 gene was determined in isolated nuclei from tumorigenic and non-tumorigenic cells (Fig. 7B). Patterns of partial digestion by the AvaI or HphI restriction enzymes were obtained but were found to be alike for tumorigenic and non-tumorigenic cells. In conclusion, no difference in chromatin structure could be detected in the region of the K18 promoter between the two cell types.

Figure 7.

Figure 7

Analysis of the chromatin structure in the promoter region of the resident K18 gene. (A) Nuclei prepared from tumorigenic SW613-12A1 or non- tumorigenic SW613-B3 cells were treated with increasing concentrations of DNase I (0, 10 or 20 µg/ml). DNA was extracted and analyzed by Southern blotting after digestion with the EcoNI or PstI restriction endonuclease, as indicated, using probes A or A and B, respectively. DNA extracted from human EJ/T24 cells (ATCC HTB-4) was used as a control. The position and size (bp) of the fragments generated by the DNase I hypersensitive sites are indicated by arrowheads and those of the molecular weight markers are indicated on the right. A map of the 5′ region of the human K18 gene is presented beneath. The position of the first two exons, of the TATA box, of the Sp1-binding site important for the promoter activity, of the A and B probes and of the mapped DNase I hypersensitive sites (thick arrows) is indicated. (B) Nuclei prepared from tumorigenic SW613-3 or non-tumorigenic SW613-B3 cells were treated or not (none) with the AvaI or HphI restriction endonuclease, as indicated. DNA was extracted, digested with the EcoNI restriction endonuclease and analyzed by Southern blotting using probe A. The position of the sites for these enzymes is indicated on the map of the 5′ region of the human K18 gene shown beneath.

DISCUSSION

The CBP (or p300) protein is involved in an acetylation mechanism responsible for the differential activity of the K18 promoter

The K18 gene is overexpressed in cells of tumorigenic clones derived from the SW613-S colon carcinoma cell line, as compared with cells of non-tumorigenic clones. This corresponds to a deregulation of the gene in tumorigenic cells since its expression level in non-tumorigenic cells is comparable with that in normal epithelial cells of human colon (39). We have investigated the mechanism responsible for the higher activity of the K18 promoter in tumorigenic cells. We conclude that an alteration of an acetylation mechanism is responsible for the high activity of the promoter in these cells. Indeed, the differential behavior of the promoter can be reduced or abolished through a rise of its activity in non-tumorigenic cells by treatment with histone deacetylase inhibitors or by enforced recruitment to the promoter either of a protein bearing a HAT activity (GAL4–CBP HAT CBP2) or of acidic activators which have been shown to have the capacity to bind complexes with HAT activity (40). We think that the CBP (or p300) protein is involved in this mechanism for the following reasons. First, the adenovirus E1A protein strongly inhibits the activity of the K18 promoter in tumorigenic cells but has almost no effect in non-tumorigenic cells. The two domains of E1A (N25 and CR1) which are necessary and sufficient for binding to CBP are sufficient to mediate this inhibitory action. The inhibition by E1A can be reverted by an excess of CBP protein. In addition, expression of E1A prevents the stimulation of the promoter by sodium butyrate treatment in non-tumorigenic cells, indicating that hyperacetylation at the K18 promoter induced by treatment with this histone deacetylase inhibitor is blocked by E1A. Secondly, the GAL4–CBP HAT CBP2 polypeptide stimulates the activity of the K18 promoter more efficiently in non-tumorigenic than in tumorigenic cells and both the CBP2 and the HAT domain have an important role in this phenomenon. A GAL4–P/CAF fusion protein was unable to stimulate the activity of the K18 promoter.

The differential activity of the K18 promoter is not a consequence of a quantitative or qualitative difference in the CBP (or p300) protein between tumorigenic and non-tumorigenic cells. Indeed, the accumulation level and the size of the mRNAs coding for the p300 and CBP proteins were found to be the same in both cell types by northern blot analysis of poly(A)+ RNA. These results were confirmed by western blot analysis of the accumulation level and the size of the two proteins (P.Prochasson, unpublished results). Thus, a quantitative difference in the amount of one of these factors or a major alteration of their structure is not the cause of the differential activity of the K18 promoter. The difference between the two cell types could have been qualitative, possibly affecting the HAT activity of these proteins. For example, it has been reported that the level of phosphorylation modulates the HAT activity of CBP throughout the cell cycle (46). We have found that the intrinsic HAT activity of CBP and p300 is the same in both cell types, as determined by an immunoprecipitation HAT assay (47) performed under denaturing conditions (P.Prochasson, unpublished results). We are now considering the possibility that a factor interacting with CBP (or p300) and modulating the function of the protein would differ quantitatively or qualitatively between the two cell types. This factor could interact with the CBP2 domain of the CBP protein, as may be inferred from the effect of the E1A protein and of the CBP HAT CBP2 polypeptide on the activity of the K18 promoter. In this model, we postulate that the CBP/p300 proteins are part of the pre-initiation complex without being recruited as co-activators through binding to a specific transcription factor. This is based on the results of others who found that the p300 protein is associated with the RNA polymerase II holoenzyme complex (10,11).

The substrate of the acetylation mechanism responsible for the differential activity of the K18 promoter does not seem to be the histones since we found no difference in the acetylation level of histones H3 and H4 in the region of the promoter between tumorigenic and non-tumorigenic cells. In fact, no difference in the chromatin structure of the promoter could be found between the two cell types. These results raise the possibility that the substrate of the acetylation mechanism is a component of the pre-initiation complex. CBP/p300 proteins are known to acetylate specific and general transcription factors as well as non-histone proteins (4).

A pleiotropic effect on transcriptional regulation

We have provided evidence that the deregulation of the K18 promoter activity in tumorigenic cells of the SW613-S cell line is due to an alteration of an acetylation pathway involving the CBP (or p300) protein. We have previously reported that the minimal K18 promoter (TATA box and initiation site) on its own presents a differential activity in transient expression assays carried out in tumorigenic and non-tumorigenic cells (23). We have also shown that the differential activity of the minimal promoter does not involve the specific binding of a factor to a sequence of the K18 promoter (24). Therefore, we proposed that the CBP/p300 proteins regulate the activity of the K18 promoter without being recruited by a specific transcription factor but as an integral part of the pre-initiation complex. Such a model suggests that these proteins may play a wider role in the assembly of the pre-initiation complex than that of co-activators of some specific transcription factors. If this is true, the effect of an alteration of the mechanisms involving these proteins is expected to be pleiotropic, affecting the expression level of multiple genes. Up to now, we have documented the expression level of approximately 100 genes in cells of tumorigenic and non-tumorigenic SW613-S clones. We found that ∼20% of them are overexpressed in tumorigenic cells, as compared with non-tumorigenic cells (20–22 and O.Brison, unpublished results). It remains to be determined whether the mechanism responsible for the overexpression of at least part of them is the same as for the K18 gene.

We have reported elsewhere (39) that the K18 gene is expressed at an elevated level in cells of 10 other colon carcinoma cell lines out of 15 tested. In these cells, the K18 gene is expressed at a level comparable with that observed in cells of tumorigenic SW613-S clones. This suggests that the alteration of the acetylation mechanism involving the CBP/p300 proteins, which is responsible for the deregulated expression of the K18 gene in tumorigenic SW613-S cells, may exist in many other human colon carcinoma cells.

Acknowledgments

ACKNOWLEDGEMENTS

We are grateful to Dr Tony Kouzarides for the gift of all the GAL4–CBP and the GAL4–P/CAF expression vectors, to Dr Annick Harel Bellan for providing us with the pHKG-T, pVP16 and pCMV–mCBP plasmids, to Dr Ronald Evans for the E1A–C79 plasmid, to Dr Peter O’Hare for the VP16 mutants and to Dr Nazanine Modjtahedi for giving us the wild-type and mutant E1A1 expression vectors. We thank Erwan Le Scolan and Stéphane Daffis for help with plasmid constructions and transient expression assays and Dr Christian Lavialle for help with the DNase I experiments and critical reading of the manuscript. This work was supported by grants from the Association pour la Recherche contre le Cancer and the GEFLUC Paris-Ile de France. P.P. and C.D. were supported by fellowships from the Comité de l’Essonne and the Comité du Val-de-Marne, respectively, of the Ligue Nationale contre le Cancer.

REFERENCES

  • 1.Orphanides G., Lagrange,T. and Reinberg,D. (1996) The general transcription factors of RNA polymerase II. Genes Dev., 10, 2657–2683. [DOI] [PubMed] [Google Scholar]
  • 2.Paranjape S.M., Kamakaka,R.T. and Kadonaga,J.T. (1994) Role of chromatin structure in the regulation of transcription by RNA polymerase II. Annu. Rev. Biochem., 63, 265–297. [DOI] [PubMed] [Google Scholar]
  • 3.Wolffe A.P. (1992) New insights into chromatin function in transcriptional control. FASEB J., 6, 3354–3361. [DOI] [PubMed] [Google Scholar]
  • 4.Goodman R.H. and Smolik,S. (2000) CBP/p300 in cell growth, transformation and development. Genes Dev., 14, 1553–1577. [PubMed] [Google Scholar]
  • 5.Kornberg R.D. and Lorch,Y. (1999) Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell, 98, 285–294. [DOI] [PubMed] [Google Scholar]
  • 6.Mizzen C.A., Yang,X.J., Kokubo,T., Brownell,J.E., Bannister,A.J., Owen-Hughes,T., Workman,J., Wang,L., Berger,S.L., Kouzarides,T. et al. (1996) The TAF(II)250 subunit of TFIID has histone acetyltransferase activity. Cell, 87, 1261–1270. [DOI] [PubMed] [Google Scholar]
  • 7.Bannister A.J. and Kouzarides,T. (1996) The CBP co-activator is a histone acetyltransferase. Nature, 384, 641–643. [DOI] [PubMed] [Google Scholar]
  • 8.Ogryzko V.V., Schiltz,R.L., Russanova,V., Howard,B.H. and Nakatani,Y. (1996) The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell, 87, 953–959. [DOI] [PubMed] [Google Scholar]
  • 9.Yang X.J., Ogryzko,V.V., Nishikawa,J., Howard,B.H. and Nakatani,Y. (1996) A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature, 382, 319–324. [DOI] [PubMed] [Google Scholar]
  • 10.Cho H., Orphanides,G., Sun,X., Yang,X.J., Ogryzko,V., Lees,E., Nakatani,Y. and Reinberg,D. (1998) A human RNA polymerase II complex containing factors that modify chromatin structure. Mol. Cell. Biol., 18, 5355–5363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Neish A.S., Anderson,S.F., Schlegel,B.P., Wei,W. and Parvin,J.D. (1998) Factors associated with the mammalian RNA polymerase II holoenzyme. Nucleic Acids Res., 26, 847–853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hunter T. (1997) Oncoprotein networks. Cell, 88, 333–346. [DOI] [PubMed] [Google Scholar]
  • 13.Giles R.H., Peters,D.J. and Breuning,M.H. (1998) Conjunction dysfunction: CBP/p300 in human disease. Trends Genet., 14, 178–183. [DOI] [PubMed] [Google Scholar]
  • 14.Versteege I., Sévenet,N., Lange,J., Rousseau-Merck,M.F., Ambros,P., Handgretinger,R., Aurias,A. and Delattre,O. (1998) Truncating mutations of hSNF5/INI1 in aggressive paediatric cancer. Nature, 394, 203–206. [DOI] [PubMed] [Google Scholar]
  • 15.Muraoka M., Konishi,M., Kikuchi-Yanoshita,R., Tanaka,K., Shitara,N., Chong,J.M., Iwama,T. and Miyaki,M. (1996) p300 gene alterations in colorectal and gastric carcinomas. Oncogene, 12, 1565–1569. [PubMed] [Google Scholar]
  • 16.Muhammad A.K., Yoshimine,T., Maruno,M., Tokiyoshi,K., Takemoto,O. and Hayakawa,T. (1997) Chromosome 22q allelic losses at microsatellite loci in human astrocytic tumors. Neurol. Med. Chir. (Tokyo), 37, 606–610. [DOI] [PubMed] [Google Scholar]
  • 17.Sakai K., Nagahara,H., Abe,K. and Obata,H. (1992) Loss of heterozygosity on chromosome 16 in hepatocellular carcinoma. J. Gastroenterol. Hepatol., 7, 288–292. [DOI] [PubMed] [Google Scholar]
  • 18.Petrij F., Giles,R.H., Dauwerse,H.G., Saris,J.J., Hennekam,R.C., Masuno,M., Tommerup,N., van Ommen,G.J., Goodman,R.H., Peters,D.J. et al. (1995) Rubinstein-Taybi syndrome caused by mutations in the transcriptional co-activator CBP. Nature, 376, 348–351. [DOI] [PubMed] [Google Scholar]
  • 19.Lavialle C., Modjtahedi,N., Cassingena,R. and Brison,O. (1988) High c-myc amplification level contributes to the tumorigenic phenotype of the human breast carcinoma cell line SW 613-S. Oncogene, 3, 335–339. [PubMed] [Google Scholar]
  • 20.Galdemard C., Brison,O. and Lavialle,C. (1995) The proto-oncogene FGF-3 is constitutively expressed in tumorigenic, but not in non-tumorigenic, clones of a human colon carcinoma cell line. Oncogene, 10, 2331–2342. [PubMed] [Google Scholar]
  • 21.Lamonerie T., Lavialle,C., de Galle,B., Binoux,M. and Brison,O. (1995) Constitutive or inducible overexpression of the IGF-2 gene in cells of a human colon carcinoma cell line. Exp. Cell Res., 216, 342–351. [DOI] [PubMed] [Google Scholar]
  • 22.Modjtahedi N., Haddada,H., Lavialle,C., Lazar,E., Lamonerie,T. and Brison,O. (1992) TGF-alpha production correlates with tumorigenicity in clones of the SW613-S human colon carcinoma cell line. Int. J. Cancer, 52, 483–490. [DOI] [PubMed] [Google Scholar]
  • 23.Gunther M., Frebourg,T., Laithier,M., Fossar,N., Bouziane-Ouartini,M., Lavialle,C. and Brison,O. (1995) An Sp1 binding site and the minimal promoter contribute to overexpression of the cytokeratin 18 gene in tumorigenic clones relative to that in nontumorigenic clones of a human carcinoma cell line. Mol. Cell. Biol., 15, 2490–2499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Prochasson P., Gunther,M., Laithier,M., Fossar,N., Lavialle,C. and Brison,O. (1999) Transcriptional mechanisms responsible for the overexpression of the keratin 18 gene in cells of a human colon carcinoma cell line. Exp. Cell Res., 248, 243–259. [DOI] [PubMed] [Google Scholar]
  • 25.Lavialle C., Modjtahedi,N., Cassingena,R. and Brison,O. (1990) High c-myc amplification level contributes to the tumorigenic phenotype of the breast carcinoma cell line SW 613-S (correction). Oncogene, 5, 245. [PubMed] [Google Scholar]
  • 26.Modjtahedi N., Lavialle,C., Poupon,M.F., Landin,R.M., Cassingena,R., Monier,R. and Brison,O. (1985) Increased level of amplification of the c-myc oncogene in tumors induced in nude mice by a human breast carcinoma cell line. Cancer Res., 45, 4372–4379. [PubMed] [Google Scholar]
  • 27.Lavialle C., Modjtahedi,N., Lamonerie,T., Frebourg,T., Landin,R.M., Fossar,N., Lhomond,G., Cassingena,R. and Brison,O. (1989) The human breast carcinoma cell line SW 613-S: an experimental system to study tumor heterogeneity in relation to c-myc amplification, growth factor production and other markers (review). Anticancer Res., 9, 1265–1279. [PubMed] [Google Scholar]
  • 28.Braselmann S., Graninger,P. and Busslinger,M. (1993) A selective transcriptional induction system for mammalian cells based on Gal4–estrogen receptor fusion proteins. Proc. Natl Acad. Sci. USA, 90, 1657–1661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xiao J.H., Davidson,I., Ferrandon,D., Rosales,R., Vigneron,M., Macchi,M., Ruffenach,F. and Chambon,P. (1987) One cell-specific and three ubiquitous nuclear proteins bind in vitro to overlapping motifs in the domain B1 of the SV40 enhancer. EMBO J., 6, 3005–3013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Walker S., Greaves,R. and O’Hare,P. (1993) Transcriptional activation by the acidic domain of Vmw65 requires the integrity of the domain and involves additional determinants distinct from those necessary for TFIIB binding. Mol. Cell. Biol., 13, 5233–5244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chakravarti D., Ogryzko,V., Kao,H.Y., Nash,A., Chen,H., Nakatani,Y. and Evans,R.M. (1999) A viral mechanism for inhibition of p300 and PCAF acetyltransferase activity. Cell, 96, 393–403. [DOI] [PubMed] [Google Scholar]
  • 32.Martinez-Balbas M.A., Bannister,A.J., Martin,K., Haus-Seuffert,P., Meisterernst,M. and Kouzarides,T. (1998) The acetyltransferase activity of CBP stimulates transcription. EMBO J., 17, 2886–2893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cousens L.S., Gallwitz,D. and Alberts,B.M. (1979) Different accessibilities in chromatin to histone acetylase. J. Biol. Chem., 254, 1716–1723. [PubMed] [Google Scholar]
  • 34.Bonner W.M., West,M.H. and Stedman,J.D. (1980) Two-dimensional gel analysis of histones in acid extracts of nuclei, cells and tissues. Eur. J. Biochem., 109, 17–23. [DOI] [PubMed] [Google Scholar]
  • 35.Kulesh D.A. and Oshima,R.G. (1989) Complete structure of the gene for human keratin 18. Genomics, 4, 339–347. [DOI] [PubMed] [Google Scholar]
  • 36.Brookes S., Smith,R., Casey,G., Dickson,C. and Peters,G. (1989) Sequence organization of the human int-2 gene and its expression in teratocarcinoma cells. Oncogene, 4, 429–436. [PubMed] [Google Scholar]
  • 37.Galdemard C., Yamagata,H., Brison,O. and Lavialle,C. (2000) Regulation of FGF-3 gene expression in tumorigenic and non tumorigenic clones of a human colon carcinoma cell line. J. Biol. Chem., 275, 17364–17373. [DOI] [PubMed] [Google Scholar]
  • 38.Tchenio T., Casella,J.F. and Heidmann,T. (2001) A truncated form of the human CAF-1 p150 subunit impairs the maintenance of transcriptional gene silencing in mammalian cells. Mol. Cell. Biol., 21, 1953–1961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fossar N., Chaouche,M., Prochasson,P., Rousset,M. and Brison,O. (2001) Deregulated expression of the keratin 18 gene in human colon carcinoma cells. Somatic Cell Mol. Genet., 25, 223–235. [DOI] [PubMed] [Google Scholar]
  • 40.Utley R.T., Ikeda,K., Grant,P.A., Cote,J., Steger,D.J., Eberharter,A., John,S. and Workman,J.L. (1998) Transcriptional activators direct histone acetyltransferase complexes to nucleosomes. Nature, 394, 498–502. [DOI] [PubMed] [Google Scholar]
  • 41.Mathis D.J., Oudet,P., Wasylyk,B. and Chambon,P. (1978) Effect of histone acetylation on structure and in vitro transcription of chromatin. Nucleic Acids Res., 5, 3523–3547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Struhl K. (1998) Histone acetylation and transcriptional regulatory mechanisms. Genes Dev., 12, 599–606. [DOI] [PubMed] [Google Scholar]
  • 43.Montminy M. (1997) Transcriptional activation. Something new to hang your HAT on. Nature, 387, 654–655. [DOI] [PubMed] [Google Scholar]
  • 44.Hamamori Y., Sartorelli,V., Ogryzko,V., Puri,P.L., Wu,H.Y., Wang,J.Y., Nakatani,Y. and Kedes,L. (1999) Regulation of histone acetyltransferases p300 and PCAF by the bHLH protein twist and adenoviral oncoprotein E1A. Cell, 96, 405–413. [DOI] [PubMed] [Google Scholar]
  • 45.Goodman R.H. and Smolik,S. (2000) CBP/p300 in cell growth, transformation and development. Genes Dev., 14, 1553–1577. [PubMed] [Google Scholar]
  • 46.Ait-Si-Ali S., Ramirez,S., Barre,F.X., Dkhissi,F., Magnaghi-Jaulin,L., Girault,J.A., Robin,P., Knibiehler,M., Pritchard,L.L., Ducommun,B. et al. (1998) Histone acetyltransferase activity of CBP is controlled by cycle-dependent kinases and oncoprotein E1A. Nature, 396, 184–186. [DOI] [PubMed] [Google Scholar]
  • 47.Ait-Si-Ali S., Ramirez,S., Robin,P., Trouche,D. and Harel-Bellan,A. (1998) A rapid and sensitive assay for histone acetyl-transferase activity. Nucleic Acids Res., 26, 3869–3870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Neznanov N.S. and Oshima,R.G. (1993) Cis regulation of the keratin 18 gene in transgenic mice. Mol. Cell. Biol., 13, 1815–1823. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES