NaB-induced inhibition of HDAC4 and TUG1: a novel strategy for reversing oxaliplatin resistance in colorectal cancer

Abstract

Background

Oxaliplatin (OXA) resistance affects the efficacy of colorectal cancer (CRC) treatment.

Methods

Gene expression profiles of OXA-resistant and OXA-sensitive cells were compared to identify differentially expressed non-coding RNAs. A dual-luciferase assay was used to research the targeting relationship and binding region of TUG1 and miR-449a. SiRNA interference was used to construct cell models of OXA-resistant cells with low expression of TUG1 and OXA-sensitive cells with high expression of HDAC, as well as animal models based on these two types of cells. Then, cellular function was assessed. Histopathologic conditions were assessed by immunohistochemistry.

Results

TUG1, miR-449a and Histone Deacetylase 4 (HDAC4) were all upregulated in OXA-resistant cells, and the increase of HDAC4 was accompanied by a decrease in acetylation level. TUG1 binds to miR-449a, and TUG1 was located in the cytoplasm of OXA-resistant cells. Downregulated expression of TUG1 could inhibit proliferation and induce apoptosis in OXA-resistant cells and reverse OXA resistance. Downregulated expression of HDAC4 could reduce the expression of TUG1, and inhibit proliferation and induce apoptosis of OXA-resistant cells. Treatment with 2 mmol/L sodium butyrate (NaB), a histone deacetylase inhibitor, markedly suppressed tumor cell growth through regulation of TUG1 compared with 0.01 mmol/L NaB. The OXA-resistant tumor-bearing mouse experiment further confirmed the inhibitory effect of NaB on tumor.

Conclusion

High-dose NaB can inhibit the expression of HDAC4, and then reduce the expression of TUG1 through acetylation modification, thereby inhibiting the development of CRC and reversing OXA resistance in CRC.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12885-026-16367-7.

Highlights

Reducing TUG1 can inhibit the proliferation of OXA-resistant cells and reverse OXA resistance.

HDAC4 regulates TUG1 via acetylation modification and affects OXA resistance.

Two mmol/L NaB (deacetylase inhibitor) could inhibit the proliferation of OXA-resistant cells and reverse drug resistance.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12885-026-16367-7.

Introduction

Colorectal cancer (CRC) is the second most common cause of cancer death, seriously threatening human health [1, 2]. It is estimated that by 2040, the number of new cases worldwide will rise to 3.2 million [3]. Oxaliplatin (OXA), as a platinum-based anti-cancer drug, is currently the core drug in the chemotherapy regimens for advanced CRC, aiming to shrink the tumor and inhibit its growth and spread [4]. The National Comprehensive Cancer Network (NCCN) guidelines recommend FOLFOX (OXA+ fluorouracil) and CapeOX (OXA+ capecitabine) containing OXA as first-line chemotherapy regimens for patients with CRC [5, 6]. These regimens can increase the 3-year disease-free Survival (DFS) of patients with CRC by 4.7%-8.7% [7–9].

OXA is widely used as a first-line chemotherapy drug for CRC. In recent years, its application has significantly reduced the mortality rate of CRC. However, nearly half of the initially chemotherapy-sensitive individuals will develop acquired drug resistance in the later stage of chemotherapy, leading to chemotherapy failure [10]. The main mechanisms include alterations in drug targets, epigenetic alteration, DNA damage repair, epithelial-mesenchymal transition, etc [11–17]. The mechanism by which CRC cells develop resistance to OXA is complex and diverse, worthy of our in-depth exploration and improvement. Therefore, elucidating the molecular mechanism of OXA resistance in CRC cells and searching for molecular targets of drug resistance to overcome OXA resistance in CRC cells has become an urgent clinical problem to be solved.

The key role of long non-coding RNA (lncRNA) in the formation of platinum-based drug resistance in CRC cells has become a research hotspot in recent years [18–20]. Taurine upregulated gene 1 (TUG1) is one type of lncRNA and is abnormally expressed in various malignant tumor tissues and cell lines such as esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, and CRC. The abnormal expression of TUG1 has been confirmed to be related to the proliferation, migration and drug resistance of cancer cells [18, 21, 22]. In previous studies, RNA differentially expressed between OXA-resistant and OXA-sensitive colon cancer cell lines was screened out, and TUG1 was proven to be related to OXA resistance [23].

Acetylation of proteins is a reversible dynamic process regulated by specific enzymes, and the acetylation of specific proteins (e.g., histones) plays an important role in gene activation [24]. Abnormal increases in specific lncRNA expression will lead to increased histone acetylation levels, which will directly promote the migration and invasion of cancer cells. At the same time, lncRNAs can also act as molecular baits to block the binding of histone acetylation enzymes to gene promoter regions, inhibit their action, and reduce the acetylation level of histones [25]. Abnormal acetylation of histones in promoter segments of some genes can activate the transcription of lncRNAs, resulting in abnormal increases in lncRNA levels, thus activating related pathways and triggering OXA resistance [26, 27].

In summary, the relationship between acetylation and TUG1 is still unclear, and the epigenetic mechanism by which TUG1 regulates OXA resistance still needs to be further studied. Therefore, this study further clarified the epigenetic mechanism of OXA resistance by exploring the effects of TUG1 on the proliferation, migration and apoptosis of OXA-resistant cells and providing guidance for subsequent OXA resistance mechanistic research.

Materials and methods

Cell lines and reagents

The OXA-resistant CRC cell line (HCT116/L, SW480/L) and OXA-sensitive CRC cell line (HCT116, SW480) were purchased from the Cell Bank of Shanghai Chinese Academy of Sciences. Cells were maintained in 90% RPMI 1640 + 10% FBS + 1% P/S medium (Jiangsu Keki Biotechnology, China) and cultured in a humidified atmosphere of 37 °C and 5% CO₂.

Quantitative real-time PCR (qPCR)

RNA data (NO. GSE42387) (Homo sapiens) was obtained from the NCBI GEO Database (Gene Expression Omnibus, GEO, http://www.ncbi.nlm.nih.gov/geo/). The differential RNA screening methods are detailed in [23]. Wei W et al. selected lncRNAs and miRNAs according to the connectivity ranking in the network graph, and TUG1 and miR-449a were the top lncRNAs and miRNAs, respectively. HDAC4 and HDAC5 were selected because they are associated with acetylation. Based on the results of the previous raw data analysis [23], 6 downstream target genes of TUG1 were screened. miR-449a and the top 5 mRNAs (ZNF148, PLAG1, SEMA5A, SORL1, and TMEM2) were selected according to their connectivity rank. The expression of 6 target genes was detected by qPCR. The primer sequences are shown in (Table 1).

Table 1.

Primers of genes used for qPCR

	Forward primer	Reverse primer
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
miR-449a	ACACTCCAGCTGGGTGGCAGTGTATTGTTA	TGGTGTCGTGGAGTCG
GAPDH	AGATCATCAGCAATGCCTCCT	TGAGTCCTTCCACGATACCAA
TUG1	TAGATTAACAGCCCTCCACTCC	CATCTGGTGTTGCTTAAGGGAG
PLAG1	CTCCATTTCAGTCCATGCAGAG	AAAGAAAGGTGGTGAGAGGGAT
ZNF148	ACCATGCCCATCAATAGCTTTC	ACCTGAAAAGGGAAATGAGTGC
PLAG1	CTCCATTTCAGTCCATGCAGAG	AAAGAAAGGTGGTGAGAGGGAT
SEMA5A	CTCACCCTGCTCGTCTATACTT	TTGATGTGGTTGGTTATGCTGG
SORL1	CAATTCCTCTGTGCTTGATCGT	TAGGCAGCAGAACCATCCATAT
TMEM2	GTTTCTCTTTCAGGATTCCGGG	ACATGGAATAGTCTGTGCTTGC
HDAC4	CACATCAAGCAACAACAGGAGA	TTTGCCCTTCTCCTTGTTCTTG
HDAC5	CTCCTACAGCAGAAGTTGAACG	AGCGATGCAGAGAGATGTAGAG

Total RNA was extracted from the cells using TRIzol reagent (Invitrogen 15596-026, USA). First-strand cDNA was synthesized from the total RNA using the PrimeScript RT Reagent Kit (TaKaRa RR036B, Japan). The cDNAs were amplified via an ABI Step One Plus Real Time-PCR system (Life Technologies Corporation, Carlsbad, CA, USA) and a One Step TB Green™ PrimeScript™ RT–PCR Kit II (TaKaRa RR086B, Japan) reaction system. The primer sequences are shown in (Table 1). The reaction conditions were as follows: 3 min of initial denaturation at 95 °C, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, extension at 72 °C for 1 min, and a final extension at 72 °C for 5 min.

Dual-luciferase analysis

HCT116/L cells were cotransfected with pmirglog-tug1-wt or pmirglog-tug1-mut with miR-449a mimics or miR-NC by Lipofectamine 2000-mediated gene transfer. Then, the cells were cultured in a 37 °C, 5% CO2, and Opti-MEM, which was replaced with complete medium after 6 h. After 48 h, the cells were harvested, washed with PBS, shaken in lysis buffer for 15 min, and harvested. The assay was performed with luciferase test reagent (LAR II, 50 µl Stop&Glo Reagent). The data are expressed as a fold change relative to the corresponding control group (defined as in 1.0).

Fluorescence in situ hybridization (FISH)

The 18 S rRNA was used as an internal control. Cells grown on coverslips were fixed, permeabilized and monitored by the Fish Probe Mix and FISH Kit (Ruibo). Cells were stained with DAPI staining solution for 10 min and then washed twice with 1X PBS for 5 min each. Finally, under dark conditions, the coverslips were carefully removed from the wells and fixed to slides with sealant (DAKO). FISH signals were observed using an LSM 510 META laser confocal microscope (Zeiss, Germany).

Small interfering RNA (siRNA)

pcDNA3.1/TUG1 (pcDNA3.1 as a control), shTUG1 (shRNA as a control). And TUG1 inhibitors were purchased from Applied Biological Materials (ABM, Vancouver, Canada). Interference was performed using the Lipofectamine 2000 kit (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. We validated the TUG1 levels in each group by PCR. The detailed process of PCR was as described above.

Western blot (WB)

Expression of HDAC4 and HDAC5 were detected in the resistant cell line HCT116/L and the sensitive cell line HCT116 by qPCR and WB analysis. The specific qPCR method was as described above, and the primer sequences are shown in Table 1. The WB procedure was as follows. Total protein was extracted from the HCT116/L and HCT116 cells using a Whole Protein Lift Kit (Jiangsu Keki Biotechnology Corporation KGP250, China). The extracted proteins were mixed with loading buffer, subjected to 10% SDS–PAGE, and transferred to PVDF membranes. The membranes were blocked with 5% (v/v) milk and incubated overnight with the corresponding primary antibody in 5% (w/v) bovine serum albumin (BSA) at 4 °C, followed by the corresponding horseradish peroxidase-conjugated secondary antibody. Then, the membrane was rinsed 3 times for 15 min. G: BOX chemiXR5 imaging and gEL-Pro32 software were used to analyze the results. Anti-HDAC4 (1:2000 dilution), anti-HDAC5 (1:2000 dilution), anti-H3 Lys14 (1:2000 dilution), and anti-GAPDH (1:3000 dilution) were purchased from Abcam. The raw blots are shown in the Supplementary Materials 1.

Cell transfection–HDAC4 overexpression (OE) model

Full-length cDNA of mouse HDAC4 was obtained by polymerase chain reaction (PCR). The cDNA of HDAC4 was subcloned into the NheI (GCTAGC)-EcoRI (GAATTC) sites of the pcDNA3.1(+) vector. Then, 2.5 µg plasmids were diluted with 125 µL serum-free medium Opti-MEM and the plasmids were incubated in the medium at room temperature for 5 min. Then, 5 µL Lipo3000 was added and incubated at room temperature for 20 min. The plasmid-Lipo3000 mixture was added to the culture wells containing 750 µL of medium and the cells, and gently mixed. The cells were incubated in a 37 °C CO₂ incubator for 24 h. Cell model construction conditions were verified by qPCR. The sequences of the overexpressed HDAC4 plasmids are shown in the Supplementary Materials 2. H3 (Lys14) levels were detected by WB analysis. Cell culture was continued for 48 h without adding NaB or with 0.01 mmol/L NaB or 2 mmol/L NaB in complete medium.

CCK-8 assay

Cell proliferation was assessed using the CCK-8 assay (Med ChemExpress). Each group of cells was seeded into 96-well plates. CCK-8 reagent (10 µL per well) was added according to the manufacturer’s protocol. The inhibition rate was calculated after 72 h of incubation in a 37 °C cell culture incubator, and the absorbance at 450 nm was measured using a microplate reader (BioTek Instruments, Winooski, VT, USA).

Annexin-V APC/7-AAD double-staining assay

Cell apoptosis was determined by the Annexin-V APC/7-AAD double-staining assay. CRC cells (5 × 105 cells/well) were treated with NaB at concentrations of 0.2, 2, and 5 mmol/l for 24 h. The cells were washed twice with PBS, the supernatant was removed by centrifugation, the cells were resuspended in 90 µl of PBS, and an Annexin V-APC/7-AAD cell apoptosis assay kit (KGA1024, Jiangsu Kaiki Biotechnology Co., China) was used. Fluorescent signals from 2000 cells per sample were obtained with a US Becton-Dickinson flow cytometer and the results were analyzed using Cell Quest software.

Transwell assay

Cell invasion ability was assessed using a Transwell assay. After transfection and serum starvation for 48 h, the cells were collected with 0.25% trypsin and the cell suspension was added to the upper Transwell chamber in serum-free medium (US Corning Incorporated 3422), 500 µL medium containing 20% FBS was added to the lower chamber. Diluted Matrigel matrix gel (Transwell BD 356234) was added to the chamber before adding the cells. The number of invading cells was counted 24 h later.

Scratch assay

Cell migration was measured by using a scratch assay. Cells in the logarithmic growth phase plated in a six-well plate with 80% confluence were scratched with a sterile pipette tip. The dislodged cells were washed off with PBS. Then, the cell migration distance was measured after culturing for 24 h.

EDU assay

Cell proliferation was determined by EDU assays. Cell suspensions were added to 96-well cell culture plates and incubated in a 37 °C, 5% CO2 incubator for 24 h with the EdU reagent, then washed twice in PBS. They were washed twice again and treated with the fixation fluid, glycine, PBS, 1× Apollo^® staining reaction solution, permeant (0.5% Triton X-100 PBS) and 1× Hoechst 33,342 reaction solution, and monitored using a High Connotation Cell Imaging System (MD, USA).

Fluoroscopic electron microscopy

Resistant cell structures were visualized by fluoroscopic electron microscopy. Samples were collected, washed in PBS, placed in EP tubes, fixed, dehydrated, embedded, cured, double stained with 3% uranium acetate-lead citrate, cut with a Type LKB-1 ultrathin slicer section, and finally imaged under a transmission electron microscope (JEM-1400, Japan).

Drug-resistant mouse model of CRC

Female BALB/c nude mice (Shanghai Slack Laboratory Animal Co., Ltd.), 4–5 weeks old, were purchased. OXA-resistant cell suspensions were prepared by interfering with cistransgenic cell lines at a concentration of 1 × 107 cells/mL, and 0.1 ml suspensions were inoculated subcutaneously into the right axilla of the nude mice to establish xenograft tumor models. The transplantation tumor diameter was measured with cursor calipers. After 16 days of inoculation, the tumor had grown to 80–100 mm3. Mice in the NaB intervention group were injected intraperitoneally with NaB solution once daily at 400 mg/kg and 200 µl/20 g and continuously observed for 28 days. Control mice were injected intraperitoneally with an equal volume of saline once daily and continuously observed for 28 days. After the intervention, the mice were killed by cervical dislocation, and the tumors were surgically removed and weighed. The expression of TUG1, miR-449a and HDAC4 was determined by PCR as described previously.

Hematoxylin eosin (HE) staining

Pathological tissue samples were analyzed by hematoxylin-eosin (HE) staining. Paraffin sections were pretreated, deparaffinated, cleared with xylene, hydrated with anhydrous ethanol, 95% ethanol, 85% ethanol, and 70% ethanol, and soaked in PBS. The sections were stained in nuclear dye solution, I, II, and plasma dye solution, and the excess dye solution was washed away. The sections were dried and sealed, and then scanned using a digital pathology scanner.

Tunel assay

Apoptosis was detected by the TUNEL assay. Paraffin sections were pretreated with HE. The sample was permeabilized with Triton-100, 50 µl 1xProteinase K, and the TUNEL reaction was performed followed by DAB development, observed using a microscope, restained with hematoxylin solution, and visualized with an optical microscope.

Immunohistochemical (IHC) staining

Ki67 expression and protein expression were detected by IHC. The paraffin sections were pretreated as described for the HE method. The sections were placed in a staining box containing antigen repair buffer and heated for antigen repair. Two drops of 3% H2O2-methanol solution were added to each section, sealed at room temperature (15–25 °C) for 10 min, washed with PBS three times, and then goat serum was added to block the sections. The antigen-antibody reaction was performed by dropping 50–100 µl of primary antibody (1:50 dilution) on the sections and then adding 50 µl of universal mouse/rabbit polymer and goat-anti-rabbit (1:200) secondary antibody to produce the primary antibody and secondary antibody reaction. DAB was used for color rendering, and microscopy was used for observation until the staining was complete. Hematoxylin was added for restaining, and then the sections were sealed. Finally, the sections were observed by light microscopy.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 10 software (GraphPad Software, La Jolla, CA, USA). Data are presented as mean ± standard deviation (SD). For comparisons between two groups, unpaired Student’s t-test was used. For multiple comparisons, one-way ANOVA, followed by Tukey’s post-hoc test, was applied. A p-value of < 0.05 was considered statistically significant. All experiments were repeated at least three times.

Results

TUG1/miR-449a was involved in the regulation of OXA-resistant cells

We selected lncRNAs and miRNAs according to the connectivity ranking in the network graph published in previous studies, and TUG1 and miR-449a were the top lncRNAs and miRNAs, respectively [23]. The IC50 values of OXA-resistant cell line (HCT116/L) and sensitive cell line (HCT116) were first verified, and the former was more resistant (Fig. 1A). Comparing the expression of TUG1 and miR-449a in the two cell lines, it was found that TUG1 and miR-449a were highly expressed in OXA-resistant cells (Fig. 1B). To validate their interaction, a luciferase reporter assay was performed, confirming that miR-449a had a binding relationship with TUG1 (Fig. 1C and D). FISH analysis showed that TUG1 localized predominantly to the cytoplasm in OXA-resistant cells and exhibited higher signal intensity than in sensitive cells (Fig. 1E). TUG1 was significantly decreased in both the HCT116 and HCT116/L groups as shown by si3522 interference (Fig. 1F). Therefore, the si3522 target was selected for subsequent experiments. We then analyzed the downstream effects of TUG1 knockdown by qPCR, focusing on miR-449a and its target genes. Our findings showed that knockdown of TUG1 led to a reduction in miR-449a and its target ZNF148, while PLAG1, SEMA5A, SORL1, and TMEM2 were upregulated, indicating that TUG1/miR-449a regulates OXA resistance (Fig. 1G).

Fig. 1.

The TUG1/miR-449a signaling pathway regulated OXA resistance. A The OXA IC50 of OXA-resistant cell line (HCT116/L) and sensitive cell line (HCT116). B TUG1 and miR-449a were differentially expressed in HCT116/L and HCT116. C Prediction of the binding sites of TUG1 and miR-449a. D Luciferase assay was used to detect the binding of TUG1 and miR-449a. The targeting relationship and binding region of lncRNA TUG1 and miR-449a were predicted using bioinformatics software, and the luciferase activity changes of each group were compared. E FISH was used to detect TUG1 in OXA-resistant and OXA-sensitive cells. F siRNA was used to interfere with TUG1, and qPCR was used to detect its expression. Si3522 was the best target of TUG1. G PCR was performed to detect the expression of miR-449a and 5 downstream target genes of TUG1. The control group represents the resistant cells treated without OXA. The experimental group represents the resistant cells treated with OXA. KB represents the blank plasmid control group. NC represents the control group. si3522 represents the TUG1 downexpression group. **p < 0.01, *p < 0.05 compared with the NC and KB groups

Downregulation of TUG1 could reversed OXA-resistance

To investigate the effect of TUG1 on OXA resistance, we generated OXA-resistant cells with downregulated TUG1 expression via siRNA knockdown (si3522). Compared to the control (KB and NC groups), TUG1 knockdown resulted in significantly reduced proliferation of OXA-resistant cells (Fig. 2A and B), increased apoptosis (Fig. 2C), and decreased invasion and migration abilities (Fig. 2D and E). These results indicated that the function of OXA-resistant cells was reduced when TUG1 was downregulated. In addition, as the experimental group shown in Fig. 2, after OXA intervention, the effects of TUG1 knockdown on OXA-resistant cells was further strengthened compared to the control group. Therefore, it is speculated that downregulated expression of TUG1 could make OXA-resistant cells more sensitive to OXA. This suggests that TUG1 may be the key gene that regulates the sensitivity of cells to OXA.

Fig. 2.

TUG1 regulated OXA resistant cells function. A-B. The cell proliferation ability was detected by CCK-8 assay. C. Annexin-V APC/7-AAD assay was used to detect cell apoptosis. Each quadrant (Q1, Q2, Q3, and Q4) represents the number of dead cells, the number of late apoptotic cells, the number of living cells, and the number of early apoptotic cells. D. Transwell assays were used to detect invasion. E. A wound healing assay was used to evaluate migration. The control group represents the resistant cells treated without OXA. The experimental group represents the resistant cells treated with OXA. KB represents the blank plasmid control group. NC represents the control group. si3522 represents the TUG1 downexpression group. *p < 0.05 compared with the NC and KB groups

HDAC4 reversed OXA resistance by regulating the expression of TUG1 through acetylation

Analysis of differentially expressed mRNAs between OXA-resistant and OXA-sensitive cell lines showed that HDAC4 and HDAC5 were expressed at high levels in OXA-resistant cell lines (Fig. 3A). HDAC4 was upregulated in the OXA-resistant group, while HDAC5 showed no significant difference between the two groups by further qPCR verification (Fig. 3B). Additionally, increased expression of HDAC4 was accompanied by low acetylation levels in the OXA-resistant cells (Fig. 3C-D).

Fig. 3.

HDAC4 regulated the expression of TUG1 in OXA-resistant cells. A HDAC4 and HDAC5 were found by screening differentially expressed RNA based on previous GEO database analysis. B PCR was used to detect the expression levels of HDAC4 and HDAC5. C-D. WB was used to detect HDAC4 and HDAC5 protein expression and acetylation levels. E. PCR was performed to detect the expression of HDAC4 in the HDAC4 OE cell model. F-G. The changes of H3 Lys14 were detected by WB. H. PCR was used to detect the TUG1 expression levels. HCT116 represents OXA sensitive cells. HCT116/L represents OXA resistant cells. KB represents the blank plasmid control group. NC represents the control group. OE represents the HDAC4 overexpression group. *p < 0.05 compared with the NC and KB groups

To explore the role of HDAC4 in regulating TUG1 expression, we constructed an HDAC4 overexpression model (OE group) in OXA-sensitive cells (HCT116). After confirming overexpression by qPCR (Fig. 3E), we compared acetylation levels in the HCT116, HCT116/L, KB, and OE groups. The results showed that acetylation levels were significantly lower in the OXA-resistant HCT116/L cells compared to the sensitive HCT116 cells (Fig. 3F and G). Interestingly, the overexpression of HDAC4 in HCT116 cells further decreased acetylation levels, which were restored upon NaB treatment (Fig. 3F and G).

We also measured TUG1 expression in these groups and observed that TUG1 expression was significantly higher in OXA-resistant HCT116/L cells compared to OXA-sensitive HCT116 cells. HDAC4 overexpression in HCT116 cells also led to an increase in TUG1 expression, which was reduced when NaB (HDAC4 inhibitor) was added (Fig. 3H). These findings indicate that HDAC4 modulates TUG1 expression through acetylation, and NaB, as a deacetylase inhibitor, can reduce HDAC4 and TUG1 levels while increasing acetylation, providing a potential therapeutic strategy to reverse OXA resistance.

HDAC4 regulated OXA resistance at the animal level

Based on the OXA-sensitive cell line with HDAC4 overexpression, xenograft models were successfully established to investigate the role of HDAC4 in OXA resistance. Subsequently, the tumor tissues were obtained by surgery. The mouse transplanted tumor model and the mouse tumor tissue removed by surgery are shown in Fig. 4A-B. Comparing the mouse weight, tumor volume and tumor weight, the results showed that the tumor volume and tumor weight of mice in the OE group were higher than those in the control group (p < 0.05), but there was no significant difference in the weight of the mice between the two groups (Fig. 4C-E). The relative expression of TUG1 in the overexpression group was higher than those in the control group (Fig. 4F).

Fig. 4.

HDAC4 regulates OXA resistance at the animal level. A-B. Based on the HDAC-overexpressing cell line previously constructed, a xenograft tumor model was established, and tumor tissue was obtained. C-E. Mouse weight, tumor volume and tumor weight were compared in both groups. F. The relative expression of HDAC4 and TUG1 was detected by qPCR. G. Tissue changes were confirmed by HE. H. TUNEL assay was used to detect cell apoptosis. I. The level of protein expression was detected by IHC staining. *p < 0.05 compared with the control group

The obtained tumor tissues were analyzed by pathology. The results showed that in the OE group, the edge of the tumor tissue was clear, and no obvious necrosis or inflammatory cells were observed in the tumor tissue. However, the tumor tissue edge was blurred with a small amount of inflammatory cell infiltration and even focal necrosis in the NC group (Fig. 4G). The percentage of apoptosis in the OE group was approximately 5–10% and that in the NC group was approximately 20% (Fig. 4H). In the NC group, the Ki-67 staining area presented pale yellow with weak positive expression. However,the corresponding staining area turned dark brown, showing strong positive expression in the OE group (Fig. 4I). These findings suggest that HDAC4 overexpression enhances tumor growth and OXA resistance.

High-dose NaB reverses OXA resistance by modulating HDAC4 and TUG1 expression

To investigate the impact of NaB on OXA resistance, we treated OXA-resistant cells with NaB at different concentrations. In the 2 mmol/L NaB treatment group, HDAC4 and TUG1 expression were significantly reduced compared to the control group (Fig. 5A and B). We observed that treatment with a low dose of NaB (0.01 mmol/L) + OXA had minimal effects on cell proliferation (Fig. 5C), apoptosis (Fig. 5E), and invasion (Fig. 5F). However, treatment with a high dose of NaB (2 mmol/L) + OXA significantly inhibited cell proliferation (Fig. 5D), promoted apoptosis (Fig. 5E), and reduced invasion ability (Fig. 5F). These results suggest that high-dose NaB effectively reverses OXA resistance by downregulating HDAC4 and TUG1, leading to reduced cell survival and increased susceptibility to OXA treatment. Similarly, high dose NaB (2 mmol/L) + OXA treatment inhibited the proliferation of OXA-resistant cells (SW480/L) (Fig. 5G). This suggests that the same phenotype is also present in other subtypes of CRC, and more cell lines can be further included to explore the mechanism of drug resistance in the future.

Fig. 5.

Small doses of deacetylase inhibitor NaB could not regulate OXA resistance, while high doses of NaB regulated cell function directly. A-B. The expression of HDAC4 and TUG1 was detected by using qPCR. C. CCK-8 was performed to detect the growth inhibition rate. D. CCK-8 was performed to detect the growth inhibition rate. E. Annexin-V APC/7-AAD double staining was used to detect apoptosis. F. Transwell invasion assays were used to evaluate the invasion capacity. G. The OXA IC50 of OXA-resistant cell line (SW480/L) and sensitive cell line (SW480); The cell proliferation of SW480/L.OXA:OXA intervention group; 0.01 mmol/L NaB: 0.01 mmol/L NaB intervention group. 2 mmol/L NaB: 2 mmol/L NaB intervention group. OXA+ 0.01 mmol/L NaB: OXA was added first, and 0.01 mmol/L NaB was added 24 hours later. OXA+ 2 mmol/L NaB: OXA was added first and 2 mmol/L NaB was added 24 hours later. NaB + OXA (0.01 mmol/L): NaB (0.01 mmol/L) was added first, and OXA was added 24 hours later. NaB + OXA (2 mmol/L): NaB (2 mmol/L) was added first, and OXA was added 24 hours later. *p < 0.05 compared with the NC or OXA group

High doses of NaB reverse OXA resistance through TUG1

To further evaluate the role of TUG1 in NaB-mediated reversal of OXA resistance, we assessed apoptosis, cell invasion, migration, and proliferation in OXA-resistant cells treated with NaB. The proportion of apoptosis of OXA-resistant cells in the NaB intervention group was higher than that in the control group, especially when the expression of TUG1 was downregulated (Fig. 6A). This suggests that NaB enhances apoptosis in OXA-resistant cells by targeting TUG1. The cell invasion, migration and proliferation ability of the NaB intervention group was weaker than that of the control group, and the migration and proliferation was the weakest when the expression of TUG1 was downregulated (Fig. 6B-D). This highlighting the importance of TUG1 in regulating these cellular functions in response to NaB treatment. Then, the structure of the OXA-resistant cells was observed (Fig. 6E). In the KB and NC groups, the nuclei of the cells were irregular and ingestion vesicles and mitochondria could be found in the nucleolus edge and cytoplasm, while in the si3522 group, cells died, the nucleolus chromatin was shrunken and homogenized, the endoplasmic reticulum expanded, and the mitochondrial crest disappeared. In the high-dose NaB intervention group, almost all of the cells died, the nucleolar chromatin shrank and became homogenized, the endoplasmic reticulum was dilated in the cytoplasm, and the mitochondrial crest disappeared. These observations indicate that NaB, particularly at high doses, induces substantial cellular damage and apoptosis in OXA-resistant cells through modulation of TUG1 expression.

Fig. 6.

High doses of NaB regulated OXA-resistant cell function through TUG1. A Annexin-V APC/7-AAD double staining was used to detect apoptosis. B Transwell invasion assays were used to evaluate the invasion capacity. C A wound healing assay was used to evaluate migration. D A EdU assay was used to detect the proliferation ratio of OXA-resistant cells. E Fluoroelectron microscopy was used to observe the structure of OXA-resistant cells. Control group: OXA-resistant cells without interferon. Experimental group: OXA-resistant cells treated with 2 mmol/L NaB. KB represents the blank plasmid control group. NC represents the control group. si3522 represents the TUG1 downexpression group. *p < 0.05 compared with the NC and KB groups

High doses of NaB inhibited tumor growth

To investigate the in vivo effect of NaB on OXA-resistant tumor growth, OXA-resistant mice model was successfully constructed, and then these tumor tissues were removed. The tumors of mice in the 2 mmol/L NaB intervention group were smaller than those in the control group (Fig. 7A). The tumor volume and weight of mice in the NaB intervention group were less than those in the control group (Fig. 7B-C). These results indicate that high-dose NaB effectively inhibits tumor growth in the OXA-resistant mouse model. Moreover, we analyzed the expression of key genes involved in drug resistance. Compared with the control group, the relative expressions of TUG1 and miR-449a were down-regulated, while the expression of HDAC4 was down-regulated in the NaB intervention group (Fig. 7D). Histological examination of tumor tissues showed that tumors in the NaB group exhibited obscure edges and loose textures, with areas of necrosis, while tumors in the control group had well-defined edges and dense tissue structures (Fig. 7E). Additionally, the percentage of apoptosis in the control group was approximately 1%, while that in the NaB intervention group was approximately 5% (Fig. 7F). The cell proliferation rate of the control group was approximately 80%, while that of the NaB intervention group was approximately 50% (Fig. 7G). These findings suggest that NaB inhibits tumor growth in OXA-resistant colorectal cancer through its effects on TUG1, miR-449a, and HDAC4 expression, as well as by inducing apoptosis and reducing cell proliferation.

Fig. 7.

High doses of NaB could inhibit tumor growth. A Size of the OXA resistant tumors. B Volume of the OXA resistant tumors. C Weight of the OXA resistant tumors. D The expression levels of HDAC4, TUG1 and miR-449 were detected by qPCR. E Tissue changes were confirmed by hematoxylin-eosin staining. F TUNEL assay was used to detect apoptosis. G Ki67 was detected by IHC. Control group: OXA-resistant cells without interferon. Experimental group: OXA-resistant cells were treated with 2 mmol/L NaB

Discussion

Although FOLFOX and CapeOX regimens containing OXA were established as first-line chemotherapy regimens in the NCCN guidelines, the 5-year survival rate of patients with advanced CRC is only 10%-15%, and drug resistance of tumor cells to chemotherapy drugs is an important reason for this [5, 6]. While previous studies have highlighted the roles of HDAC4, TUG1, and NaB in CRC and other cancers, the integration of NaB with the HDAC4–TUG1–miR-449a axis in the context of reversing OXA resistance represents a novel mechanism. The synergistic role of NaB in modulating the HDAC4–TUG1 axis, particularly through acetylation-mediated regulation of TUG1, has not been comprehensively explored in the context of OXA resistance. Our study introduces the novel concept that NaB, as a deacetylase inhibitor, targets HDAC4 to modulate TUG1 expression, which in turn regulates miR-449a and contributes to the reversal of OXA resistance in CRC cells. This unique mechanism differentiates our work from previous studies, as we focus on HDAC4’s role in regulating TUG1 via acetylation and the consequent therapeutic potential of NaB in sensitizing resistant CRC cells to chemotherapy. Thus, this study not only expands the understanding of the molecular interactions between HDAC4, TUG1, and miR-449a but also provides a promising therapeutic strategy to overcome chemotherapy resistance in CRC through NaB-mediated epigenetic modulation.

Studies in recent years have shown that lncRNA, as competitive endogenous RNA, can competitively bind to multiple miRNA sites and participate in the pathological evolution of tumors [28–32] as well as the regulation of the drug resistance mechanism of tumor chemotherapy. Meng et al. [33]found that the mutant P53 feedback loop of LINC00460-miR-149-5p/miR-150-5p could promote OXA resistance in CRC. Zhang et al. [34] found that lncRNA MALAT1 regulates OXA resistance in gastric cancer through miR-22-3p. Therefore, RNA related to OXA resistance, such as TUG1 and miR-449a, was screened out in the early stage. TUG1 is a lncRNA and plays an important role in the occurrence and development of CRC [18]. We found that TUG1 and miR-449a were highly expressed in OXA-resistant cells. Then, we further proved the binding relationship between miR-449a and TUG1 by cotransfection of the TUG1-WT plasmid and miR-449a mimics. When TUG1 was knocked down in the resistant cell line HCT116, the expression of TMEM2, PLAG1, SEMA5A, and SORL1 was upregulated, while the expression of ZNF148 and miR-449a was downregulated. This suggests that miR-449a is a downstream target gene of TUG1. Previous studies have shown that downregulation of TUG1 expression in CRC tissues can inhibit the proliferation of HCT116 cells, promote the apoptosis of HCT116 cells, and weaken the migration and invasive ability of HCT116 cells [35, 36] This is consistent with the results of this study, and after OXA intervention, knocking down TUG1 weakened OXA resistance. These results suggest that TUG1/miR-449a can regulate the function of drug-resistant cells and simultaneously regulate OXA resistance. Therefore, TUG1 is expected to be a novel drug target for OXA-resistant patients and be useful as a biomarker for the selection of combination therapy.

HDAC4 is a histone deacetylase that plays an important role in epigenetic regulation of normal cells and tumor cells [37]. We found that HDAC4 had high expression and low acetylation levels in OXA-resistant cell lines. When HDAC4 is inhibited by NaB, it increased the apoptosis ratio of drug-resistant cell lines and weakened their migration and invasion ability, showing a similar outcome to the downregulation of TUG1 expression. This suggests a possible link between HDAC4 and TUG1. Further studies showed that when HDAC4 was highly expressed, TUG1 expression was upregulated in OXA sensitive cell. These data suggest that HDAC4 regulates TUG1 expression via histone deacetylation, thereby contributing to OXA resistance. We innovatively modified the key genes of OXA resistance by epigenetic modification and realized the changes in the corresponding gene expression through acetylation regulation, providing more options for molecular targeted drug therapy.

NaB is an inhibitor of deacetylase HDAC4. Studies have shown that NaB has an inhibitory effect on the growth of CRC and that it participates in the regulation of apoptosis and the migration of CRC cells [38–40]. In a previous work, we verified the effect of NaB on inhibiting proliferation, promoting apoptosis, and weakening the migration and invasive ability of drug-resistant cell lines. Moreover, after knocking down TUG1, the effect of NaB on decreasing the function of drug-resistant cells was more obvious, which was further verified in mouse experiments. Therefore, we speculated that NaB reduces the expression of TUG1 by inhibiting the expression of HDAC4, thereby suppressing the development of CRC and reversing OXA resistance in CRC.

Although we demonstrated that downregulation of TUG1 expression can attenuate OXA resistance, it may provide guidance for clinical treatment. However, the specific mechanism has not been further studied, which is the limitation of this study. In previous studies, the role of TUG1 in various diseases, particularly in drug resistance, has been highlighted. For instance, TUG1 was found to promote cisplatin resistance in ovarian cancer by upregulating DNA polymerase eta, which is essential for translesion DNA synthesis and DNA damage tolerance [41]. Similarly, in tongue squamous cell carcinoma, TUG1 modulates cisplatin resistance by regulating miR-133b, which targets CXCR4 [42]. However, knockdown of TUG1 enhanced the sensitivity of acute myeloid leukemia cells to doxorubicin [43]. These studies highlight the widespread role of TUG1 in mediating chemoresistance through diverse molecular pathways, which could contribute to the development of drug resistance. In addition, we explored the regulatory mechanism of OXA resistance from the perspective of epigenetics and found that HDAC4 was differentially expressed. We verified that HDAC4 could regulate the function of OXA-resistant cells at both the cell and animal levels, but we have not clarified its specific modification sites or molecular regulation mechanisms. As our study primarily focuses on the broader impact of NaB on drug resistance and the relationship between TUG1 and miR-449a, a detailed mechanistic analysis of the binding sites of TUG1 and HDAC4 or miR-449a remains a future direction, which can provide a theoretical basis for targeted treatment in the clinic. That is the focus of our subsequent research.

Another limitation of this study is that most of the experiments used the HCT-116 cell line and its derivatives as a model system. The parental HCT-116 line is deficient in MLH1 and displays mismatch-repair deficiency/microsatellite instability-high (dMMR/MSI-H) phenotype [44]. MSI-H/dMMR tumors account for only a minority of colorectal cancers (approximately 10–20% overall and substantially less in metastatic disease) [45]. Therefore, findings obtained in an MLH1-deficient MSI-H model may not fully generalize to the majority of colorectal cancers, which are microsatellite stable (MSS) and mismatch-repair proficient (pMMR). Future work should validate the HDAC4–TUG1–miR-449a axis in MSS/pMMR CRC models (for example, HT29, SW480, LS180, or patient-derived xenografts/organoids) [46] to determine whether the mechanism and therapeutic effects of NaB are conserved across molecular subtypes. Such validation would strengthen translational relevance and support clinical extrapolation.

Abbreviations

Abbreviation

Definition

OXA

Oxaliplatin

CRC

Colorectal Cancer

NaB

Sodium butyrate

HDAC4

Histone Deacetylase 4

lncRNA TUG1

Long non-coding RNA - taurine up-regulated gene 1

NaB

Sodium Butyrate

NCCN

National Comprehensive Cancer Network

DFS

Disease Free Survival

qPCR

Quantitative real-time PCR

GEO

Gene Expression Omnibus

FISH

Fluorescence in situ Hybridization

siRNA

Small interfering RNA

WB

Western blot

CCK-8

Cell Counting Kit-8

HE

Hematoxylin eosin

IHC

Immunohistochemical

dMMR

Mismatch-repair deficiency

MSI-H

Microsatellite instability-high

MSS

Microsatellite stable

pMMR

Mismatch-repair proficient

Authors’ contributions

H.S.W and L.J. conceived and drafted the manuscript. W.Y.C and W.Y.H wrote and revised the manuscript. Z.J. performed the experiment. C.J. carried out the data analysis. W.Z. designed and drew figures. All authors reviewed the manuscript.

Funding

This work was supported by the Zhejiang Provincial Natural Science Foundation (No. TGY24H160001).

Data availability

The datasets generated during the current study are not publicly available but obtained from corresponding authors on reasonable request.

Declarations

Ethics approval and consent to participate

The animal study was approved by the IACUC of Laboratory Animal Management and Ethics Committee of Zhejiang Chinese Medical University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.