Wee1 kinase differentially regulates maize CDKA2;1a and CDKB1;1

Mingyar N López‐Hernández; Estefany D Guerrero‐Molina; Ulises Martínez‐Ortega; Aurora Lara‐Núñez; Jorge M Vázquez‐Ramos

doi:10.1111/febs.70594

. 2026 May 29;293(21):6525–6551. doi: 10.1111/febs.70594

Wee1 kinase differentially regulates maize CDKA2;1a and CDKB1;1

Mingyar N López‐Hernández ¹, Estefany D Guerrero‐Molina ¹, Ulises Martínez‐Ortega ², Aurora Lara‐Núñez ¹, Jorge M Vázquez‐Ramos ^1,^✉

PMCID: PMC13731921 PMID: 42216427

Abstract

In eukaryotes, cyclin‐dependent kinase/cyclin (CDK/Cyc) complexes regulate cell cycle progression by phosphorylating hundreds of substrates. Full CDK activation requires the phosphorylation of a conserved threonine residue and association with a cyclin that helps discriminate between different substrates. Kinase activity of the CDK/cyclin complex is also negatively regulated by phosphorylation of two conserved residues in the CDK (T14 and Y15 in human CDK1). This regulatory mechanism is particularly important in vertebrates for ensuring successful mitosis and is mediated by Wee1 kinase, an enzyme also conserved in plants, in which Wee1 function has been poorly studied. To investigate the conservation of Wee1 function in maize, we have studied the effect of Wee1 on maize CDKA2;1a and CDKB1;1 in vitro, two of the main CDKs that control cell cycle progression in plants. Unlike results reported for A. thaliana, we found that maize Wee1 phosphorylated CDKB1;1, but interestingly, inhibited kinase activity of CDKA2;1a and CDKB1;1 independently of its kinase activity; this inhibition was substrate‐dependent. Previously, we reported that maize CDKs also participate in substrate recognition, and therefore, we suggest that Wee1 associates with CDKs and modifies their recognition of substrates. Additionally, CDKB1;1 phosphorylation by Wee1 inhibited autophosphorylation at the threonine residue necessary for its activation and also differentially affected substrate phosphorylation. Finally, both CDKA2;1a and CDKB1;1 acted on Wee1, differentially modifying its phosphorylation. Together, and differing from previous reports, our results show that in vitro, maize Wee1 modulates the kinase activity of CDKs through several mechanisms and does not only act as an inhibitor.

Keywords: kinase activity regulation, maize CDKs, Wee1

In eukaryotes, Wee1 kinase inhibits the kinase activity of CDK/Cyc complexes through phosphorylation of a conserved residue in the CDK moiety. Wee1 is also present in plants, but has been scarcely studied. We have studied maize Wee1 regulation of CDKA/CycD2;2a or CDKB/CycD2;2a complexes. Results indicate that Wee1 modulated the kinase activity of the complexes either dependently (a) or independently (b) of its kinase activity, and this was substrate‐dependent. Image generated with Biorender.com.

graphic file with name FEBS-293-6525-g005.webp

Abbreviations

CDK: cyclin‐dependent kinase
Cyc: cyclin

Introduction

In Eukaryotes, cell cycle progression requires the activity of protein kinases known as cyclin‐dependent kinases (CDKs) that, when bound to a cyclin (Cyc), phosphorylate a high number of substrates, thus allowing DNA replication during the S phase and the correct distribution of a complete genome complement to each of the two daughter cells during the M phase [1].

In human and yeast CDKs, the CDK monomer lacks activity, while the association to a cyclin favors its partial activation; however, full activation of the CDK/Cyc complex requires phosphorylation of a highly conserved threonine residue in CDKs (T160 in human CDK2). This phosphorylation is mediated by the CDK activating kinase (CAK), an enzyme belonging to the CDK family [2, 3, 4, 5].

Besides the activating phosphorylation, CDK activity can also be negatively regulated by phosphorylation of two highly conserved residues (T14 and Y15 in human CDK1). Y15 phosphorylation is due to the activity of the Wee1 kinase, present in all eukaryotes [6, 7, 8, 9, 10, 11, 12], while T14 phosphorylation, or the equivalent residue, is mediated by another member of the Wee1 kinase family, the membrane‐associated cdc2 inhibitory kinase specific for tyrosine and threonine (Myt1), that can also phosphorylate Y15 and is present only in vertebrates [13, 14]. In human CDK2, Y15 phosphorylation prevents ATP association to CDK in a compatible configuration with γ‐phosphate transference to the substrate; moreover, this phosphorylation represents a steric hindrance, both in charge and in space for substrate association to the CDK and its subsequent phosphorylation [15].

In vertebrates and some yeasts, Wee1 function is fundamental for regulating cell cycle progression, since Wee1 phosphorylation of CDK in the mitotic CDK/Cyc complexes inhibits kinase activity and therefore a premature start of mitosis. On the other hand, under replicative stress or DNA damage conditions, CDK phosphorylation by Wee1 stops cell cycle advance to allow DNA damage repair [16, 17, 18, 19].

This basic machinery controlling the cell cycle is conserved between plants and vertebrates [20, 21]. In plants, two types of CDKs directly control the cell cycle: type A CDKs, that conserve the PSTAIRE motif present in “universal” CDKs (Cdc28 in Saccharomyces cerevisiae, Cdc2 in Schizosaccharomyces pombe and CDK1 in animals), and type B CDKs, that are plant specific and contain variations of the PSTAIRE motif. Type A CDKs are classified in two subtypes: CDKA1 and CDKA2 [22]. In the model plant A. thaliana only CDKA1 is conserved, and this kinase controls entry into both S phase and mitosis [23, 24]. Function of type B CDKs was initially related to the control of the G2/M transition, in association to B‐type cyclins [24, 25], nonetheless, association of these CDKs to D‐type cyclins has also been reported both in vivo and in vitro [26, 27, 28, 29, 30]. Plant cyclins seem to act more indiscriminately than animal cyclins since in animals type D cyclins work preferentially in the G1/S transition whereas in plants cyclins D seem to also regulate the G2/M transition; therefore, the CDKB/CycD complexes could function throughout all the cell cycle [31, 32].

Cyclin association and phosphorylation of the residue equivalent to T160 of types A and B plant CDKs are also required for activation [30, 33, 34]. As in mammals, in plants activating phosphorylation is also mediated by a CAK, although we recently reported that maize CDKB1;1, co‐expressed in vitro together with CycD2;2a, autophosphorylates T197 (the equivalent to T160 in CDK2) [30].

In contrast to conservation of the activating phosphorylation function of plant and animal CDKs, the role of the inhibitory phosphorylation function is not clear. Wee1 mutants in A. thaliana did not show any significant phenotype or alteration in growth or in the cell cycle; however, they were hyper‐sensitive to the addition of urea that produces replicative stress. Furthermore, CDKA1, but not CDKB1, associated with Wee1, and under replication stress only CDKA1 was Wee1 phosphorylated [35].

Interestingly, tomato plants in which Wee1 expression was silenced were smaller as also were the fruits produced. This phenotype correlated with lower ploidy levels of cells in fruits and higher kinase activity of the Cyc/CDK complexes recovered from silenced plants [36]. The contrasting phenotypes observed between A. thaliana and tomato plants in response to a reduced Wee1 level suggest that Wee1 function in plants could be species‐dependent [35, 36, 37], though studies in plants are still scarce.

We previously observed a correlation between kinase activity of maize CDKA/CycD2;2a complexes and recognition by antibodies against the equivalent T160 and Y15 phosphorylations (considering human CDK2). CDKB1;1 was also identified by the antibody against Y15 phosphorylation, but not by the antibody against the T160 phosphorylation; however, CDKB1;1/CycD2;2a complexes were active during maize germination [29, 38]. In the absence of the CDK subunit protein (CKS), whose association is necessary for the full activation of the CDKB1;1/CycD2;2a complex, T197 phosphorylation of CDKB1;1 did not importantly modify CDKB1;1 activity [30], so it is possible that we measured basal activity of the complex; however, the activity in CDKB1;1/CycD2;2a complexes, despite being phosphorylated in Y15 of CDKB1;1, was noteworthy [29].

With the aim of understanding the conservation of function of Wee1 in plants and its role in regulating CDK activity, we have used maize as a model to study in vitro the effect of Wee1 on kinase activity of CDKA2;1 and CDKB1;1 kinases, both in association with CycD2;2a. Results indicate that kinase activity in both CDKs was inhibited independently of Wee1 kinase activity, although Wee1 bound to both and also phosphorylated them. Interestingly, Wee1 association had a differential effect on both CDKs. Wee1 association to the CDKA2;1a/CycD2;2a complex stimulated basal activity in a substrate‐dependent manner, whereas association to the CDKB1;1/CycD2;2a complex inhibited activity also in a substrate‐dependent manner. Additionally, phosphorylation of CDKB1;1 by Wee1 inhibited CDKB1;1 autophosphorylation in T197. Our results suggest that, in vitro, the association of maize Wee1 to CDKs modulates their activity in a substrate‐dependent manner, differently to the only inhibitory activity reported in previous reports.

Results

Maize Wee1 is a 530 amino acids protein

Previous studies reported a maize Wee1 protein consisting of 403 amino acids (aa), however, it was suggested that the cloned sequence could be only a portion of the complete gene [10]. By using BLAST (Basic Local Alignment Search Tool) and the aa sequence of A. thaliana Wee1, the complete sequence of maize Wee1 was found in Ensembl database (https://plants. ensembl.org/). The sequence corresponded to a protein of 530 aa. Aligning this sequence to that reported by Sun et al., [10] (alignment not shown) revealed that Sun's protein was cloned starting at C128 (Fig. 1). Wee1 sequences from other plants, mono or dicotyledonous, were also retrieved from the ensembl database, with sizes coinciding with that of the complete maize Wee1 (Fig. 1).

Fig. 1 — ZmWee1 protein size is conserved among plants. Amino acid sequence alignment of maize Wee1 (NP_001335045.1) (ZmWee1), sorghum (XP_021314934.1) (SbWee1), millet (XP_004951964.1) (SiWee1), rice (NP_001396726.1) (OsWee1), Arabidopsis (NP_171796.1) (AtWee1), tomato (NP_001234875.1) (SlWee1), canola (XP_013664877.2) (BnWee1), and soybean (NP_001237183.2) (GmWee1). The amino end sequence is shown without highlighting whereas the kinase domain is highlighted in yellow. ZmWee1 cysteine 128, and the equivalent cysteine in other plants, are marked in gray, and this was the starting point of Wee1 cloning reported by Sun *et al*., (1999). Highlighted in cyan is the proline rich region of maize Wee1. All amino acid sequences were obtained from the National Center for Biotechnology Information (NCBI) and the alignment was generated with BioEdit [76] using the ClustalW algorithm [77].

Amplifying Wee1 complete coding sequence (CDS) was difficult since it was found that within the first 400 bp the GC content was 72%, and 81% within the first 100 bp, whereas from nucleotide 400 onwards, GC content was only 48%. A forward primer was designed to avoid the amplification of the high complexity DNA in Wee1 cDNA (first 400 bp), which allowed amplification of the shorter version, while for the amplification of the complete sequence we added dimethyl sulfoxide (DMSO) in PCR reactions. Finally, both the complete sequence (Wee1) and that missing the first 400 bp (Wee1S) were cloned, fusing both sequences to a glutathione S transferase (GST) tag at the 5′ end.

The corresponding recombinant proteins were purified and analyzed by SDS/PAGE; Wee1S ran below the 75 kDa molecular mass marker (Fig. 2A, lower panel, lane 1), agreeing with the expected mass considering that Wee1S has a theoretical 45.6 kDa molecular mass plus the GST tag of 26 kDa. The complete Wee1 CDS, with a theoretical molecular mass of 85.4 kDa including the GST tag, appeared close to the 100 kDa marker (Fig. 2A, lower panel, lane 2). Maize Wee1 protein is rich in prolines from residue 80 to residue 107 (Fig. 1), a characteristic that confers proteins a twist that delays movement in SDS/PAGE. A similar behavior has been reported for the p53 transcription factor protein, also containing a proline patch, with a theoretical molecular mass of 43.7 kDa, but with a migration at 53 kDa (giving the protein its name) [39]. This proline patch is absent in Wee1S.

Wee 1 inhibits kinase activity in maize CDKA2;1a/CycD2;2a complexes, independently of its kinase activity

We previously described that by using a modified version of the robust co‐expression of cell cycle proteins developed by Harashima and Schnittger [34], maize T161 phosphorylated CDKA2;1a, in complex with maize CycD2;2a was obtained (pT161CDKA2;1a/CycD2;2a). This complex showed high activity on different substrates [30] and was used to evaluate the activity of both Wee1 and Wee1S.

Wee1S included at a 1 : 1 molar ratio with CDKA2;1a, in the assay to measure kinase activity of the pT161CDKA2;1a/CycD2;2a complex using histone H1 as substrate, did not modify CDKA activity, but if Wee1 was used instead, kinase activity in the complex was reduced (Fig. 2A, higher panel, lanes 3, 5, and 6). Interestingly, despite activity inhibition, CDKA2;1a seemed not to be phosphorylated by Wee1. If the amount of the inhibitors was doubled in the assay, Wee1S produced a modest inhibition, whereas Wee1 almost completely inhibited activity (Fig. 2A, higher panel, lanes 8 and 9); however, in neither case was CDKA2;1a phosphorylated. The GST tag by itself did not modify kinase activity (Fig. 2, higher panel, compare lanes 3, 4, and 7).

These results suggest that Wee1 inhibited CDKA2;1a kinase activity independently of its kinase activity and that inhibition required the N‐terminal region of Wee1 protein. The lack of phosphorylation was not due to the absence of kinase activity in any of the Wee1 versions as both could autophosphorylate themselves (Fig. 2A, higher panel, lanes 1 and 2) as has been reported elsewhere [40, 41]. Worth noting is that the radioactive label in both Wee1 versions increased when CDKA2;1a was added in the assays, suggesting that the latter phosphorylated Wee1 or that CDKA2;1a promoted Wee1 autophosphorylation (Fig. 2A, higher panel, compare lanes 1 and 2 with lanes 8 and 9).

The effect of Wee1 on the phosphorylation of two other substrates, CycD2;2a and the RB‐related protein, RBR, both efficiently phosphorylated by the pT161CDKA2;1a/CycD2;2a complex [30], was also evaluated. CycD2;2a has been shown to work as a substrate when added exogenously [30] and RBR is a classical substrate of the G1/S transition in both mammals and plants [42, 43]. We used a fragment of RBR consisting of the pocket domain and the carboxyl end (RBRPC), different to only the RBR carboxy end (RBRCT) used in subsequent assays, since RBRPC runs far from CDKA2;1a, allowing one to observe phosphorylation by Wee1. Wee1 was added in a 2 : 1 proportion since inhibition was higher at this concentration. When CycD2;2a was the substrate and Wee1 was added to the assay, phosphorylation was only marginally reduced (Fig. 2B, higher panel, compare lanes 2 and 3). If RBRPC was the substrate, Wee1 almost completely inhibited phosphorylation of a partial product of RBRPC but also decreased phosphorylation of the complete protein (Fig. 2B, higher panel, compare lanes 4 and 5). These results suggest that Wee1 inhibitory activity is substrate‐dependent. Again, CDKA2;1a was not phosphorylated by Wee1. The phosphorylated band below 37 kDa corresponded to autophosphorylation of a Wee1 partial product (Fig. 2B, higher panel, compare lane 1 with lanes 3 and 5).

Since results indicate that inhibition of CDKA2;1a activity by Wee1 does not depend on CDK phosphorylation, a catalytically inactive Wee1 was generated to further confirm this. Catalytically inactive human and S. cerevisiae Wee1 mutants have been generated, substituting the catalytic lysines K328 and K473, respectively, since this lysine residue is necessary for correct positioning of ATP in the active site [44, 45, 46]. Alignment of sequences from human, S. cerevisiae, A. thaliana, and sorghum with the maize protein suggested that K309 in maize Wee1 should be the catalytic lysine (Fig. 3) and therefore K309 was substituted by an alanine. Differently to wild‐type Wee1, the Wee1 (K309A) mutant did not autophosphorylate (Fig. 4, higher panel, compare lanes 1 and 2), corroborating K309 requirement for kinase activity. This mutant, when included in the CDK kinase activity assay, and similar to wild‐type Wee1, inhibited activity of the pT161CDKA2;1a/CycD2;2a complex using histone H1 as substrate (Fig. 4, higher panel, compare lanes 3–5), indicating that Wee1 inhibits CDKA2;1a activity independently of its kinase activity.

Fig. 3 — Conservation of the catalytic lysine in maize Wee1. Alignment of the amino acid sequence of a region in HsWee1 (NP_001137448.1) (human), AtWee1 (NP_171796.1) (*A. thaliana*), ZmWee1 (NP_001335045.1) (maize), SbWee1 (XP_021314934.1) (Sorghum), Swe1p (NP_012348.1) (*S. cerevisiae*), and SpWee1 (NP_587933.1) (*S. pombe*) in which the catalytic lysine is localized. Highlighted in cyan, the conserved glycine rich loop, required for ATP binding. Marked in red, the conserved K328 and K473 amino acids in HsWee1 and Swe1p respectively, necessary for catalysis, colored in green, ZmWee1 catalytic lysine (K309), and colored in yellow, conservation of the catalytic lysines in the other sequences. All amino acid sequences were obtained from NCBI and the alignment was generated with BioEdit [76] using ClustalW algorithm [77].

Fig. 4 — Wee1 kinase activity is not required for inhibition of CDKA2;1a kinase activity. Autoradiography of wild‐type CDKA2;1a (lanes 3–5) or mutant (Y15F) (lanes 6–8) kinase activity (100 ng in each case) phosphorylated in T161 and in complex with CycD2;2a. Histone H1 (250 ng) was added as substrate (lanes 3–8). Reactions in lanes 4 and 7 received wild‐type GST‐Wee1 (514 ng), while reactions in lanes 5 and 8 received mutant GST‐Wee1(K309A) (514 ng), double the molar concentration (++) of CDKA2;1a (98 nm). In lanes 1 and 2, autophosphorylation of GST‐Wee1 wild type or mutant (K309A), respectively. Coomassie Blue‐stained gel used for autoradiography is included as loading control. Representative figures from two independent replicates.

Wee1 phosphorylates Y15 (or the equivalent residue) in CDKs of different species [8, 47, 48]. We previously obtained a maize CDKA2;1a mutant in Y15 [30], and so Wee1 wild‐type or mutant (K309A) proteins were used to inhibit kinase activity in non‐phosphorylatable Y15F CDKA2;1a when this protein was phosphorylated (and activated) in T161 and associated to CycD2;2a [pT161CDKA2;1a(Y15F)/CycD2;2a]. As already reported, the activity of the Y15F mutant over histone H1 was lower than that of wild‐type CDKA2;1a (Fig. 4, higher panel, compare lanes 3 and 6) [30], however, both the mutant (K309A) and the wild‐type versions of Wee1 inhibited the kinase activity of the Y15F mutant (Fig. 4, higher panel, compare lanes 6–8). Together, these results indicate that Wee1 does not require its kinase activity to inhibit CDKA2;1a kinase activity.

Wee1 phosphorylates CDKA2;1a when co‐expressed

We previously demonstrated that in the CDKA2;1a/CycD2;2a complex, CDK participates in substrate recognition [30], therefore substrates could interfere in CDKA2;1a phosphorylation by Wee1. For this purpose, CDKA2;1a phosphorylation by Wee1 was assayed when the CDK was phosphorylated in T161, associated to CycD2;2a and no substrate was added in the assay; only autophosphorylation of Wee1 fragments was observed (Fig. 5, higher panel, compare lanes 5 and 8), but no label at 32 kDa that would correspond to pT161 CDKA2;1a phosphorylation.

Fig. 5 — Wee1 does not phosphorylate CDKA2;1a *in vitro*. Autoradiography of GST‐Wee1 (514 ng) kinase activity (lanes 6–8) or of GST‐Cak1p (394 ng) kinase activity (lanes 9 and 10). As substrate, CDKA2;1a (100 ng) was added to reactions in lanes 6 and 9; CDKA2;1a (100 ng) associated to CycD2;2a to reactions in lanes 7 and 10, and CDKA2;1a (100 ng) phosphorylated on T161 and in complex with CycD2;2a in the reaction of lane 8. In lane 5, autophosphorylation of GST‐Wee1 (514 ng). In lanes 1, 2 and 3, kinase activity in CDKA2;1a (100 ng) alone (lane 1), in complex with CycD2;2a (lane 2) or phosphorylated in T161 and in complex with CycD2;2a (lane 3). Coomassie Blue‐stained gel used for autoradiography is included as loading control. Representative figures from two independent replicates.

In human cells, the association of cyclins to CDKs favored phosphorylation by Wee1 [49]; however, cyclins could also interfere with phosphorylation. To discard the possibility that CycD2;2a interfered with CDKA2;1a phosphorylation, the CDKA2;1a monomer was incubated with Wee1; however, there was no evidence of phosphorylation (Fig. 5, higher panel, compare lanes 5 and 6). Phosphorylation of CDKs in their activation loop modifies their structure [50] and this could interfere with Wee1 phosphorylation; however, non‐phosphorylated CDKA2;1a associated to CycD2;2a was not Wee1 phosphorylated either (Fig. 5, higher panel, compare lanes 5 and 7). Under the same assay conditions, Cak1p, the CAK from S. cerevisiae, readily phosphorylated CDKA2;1a alone or in complex with CycD2;2a (Fig. 5, higher panel, lanes 9 and 10), as previously reported [30]. In the absence of Wee1 or Cak1p, no phosphorylation was observed in CDKA2;1a alone, in complex with CycD2;2a, or phosphorylated in T161 and in complex with CycD2;2a (Fig. 5, lanes 1–3).

Protein association is not favored in vitro, for instance, human CDK2/CycA complex requires preincubation to observe kinase activity [51]. Even though Wee1 inhibition of kinase activity in CDKA2;1a suggests their association, Wee1 might not be associated properly to phosphorylate CDKA2;1a. When CDKA;1 and Wee1 from A. thaliana were co‐expressed in bacteria, CDKA;1 was recognized by an antibody against Y15 of CDK2 [34], suggesting that their co‐expression favored CDKA;1 phosphorylation. Thus, bacteria were co‐transformed with the plasmids coding for the CDKA2;1a/CycD2;2a complex and for Wee1. After complex purification, Wee1 also co‐purified (Fig. 6A, panel I, lanes 6 and 7). On the other hand, when CycD2;2a was not included in the co‐expression, Wee1 also co‐purified (Fig. 6B, panel I, lanes 6 and 7). The GST tag had no influence in these interactions (results not shown).

Fig. 6 — Wee1 associates to and phosphorylates CDKA2;1a when both proteins are expressed in *E. coli*. (A) Immunodetection of Wee1 (panel I), CycD2;2a (panel II) or CDKA2;1a (panel III) in purification fractions of CDKA2;1a His‐tag purified from co‐expression together with CycD2;2a and Wee1. Lane 1, bacterial lysate before starting induction; lane 2, bacterial lysate after induction; lanes 3, 4 and 5, insoluble, soluble and washing fractions, respectively; lanes 6 and 7, the first two eluates during purification. (B) Immunodetection of Wee1 (panel I) or CDKA2;1a (panel II) in purification fractions of CDKA2;1a His‐tag purified from co‐expression together with Wee1. Order is the same as in (A). (C) Wee1 phosphorylates CDKA2;1a on Y15. Immunodetection of association with Wee1 (wild type or K309A mutant, lanes 4, 6, 7 or 5, respectively) (panel I) and/or with CycD2;2a (panel II) of wild‐type CDKA2;1a (200 ng) (lanes 2 and 5–8) or mutant (Y15F) (lanes 3 and 4) purified by its His‐tag from co‐expression with CycD2;2a (lanes 2 and 3), CycD2;2a and wild‐type Wee1 (lanes 4 and 6), CycD2;2a and mutant Wee1 (K309A) (lane 5), wild‐type Wee1 (lane 7) or CycD2;2a and Cak1p (lane 8). CDKA2;1a monomer (200 ng) was loaded in the first lane. In panel III the phosphorylation state of wild‐type CDKA2;1a or mutant Y15F. In (A–C), CDKA2;1a was recognized by an antibody against its PSTAIRE sequence, while Wee1 was recognized by an antibody against its GST tag. In (A) and (C), CycD2;2a was recognized by an antibody against the MBP tag, and in (C) Y15 phosphorylation in CDKA2;1a was recognized by an antibody against the Y15 phosphorylated human CDK2. In (A), the fractions of the eluates were precipitated for concentration. In A and B, representative figures from three independent replicates; in C, representative figure from two independent replicates.

CDKA2;1a purified from co‐expression with CycD2;2a and Wee1 was recognized with an antibody against pY15CDK2 from human; not including CycD2;2a in the co‐expression reduced CDKA2;1a recognition (Fig. 6C, panel III, lanes 6 and 7). Y15 and neighbor amino acids are conserved between human CDK2 and maize CDKs (Fig. 7); therefore, antibody against pY15CDK2 probably identified CDKA2;1a phosphorylation by Wee1.

Fig. 7 — The Wee1 tyrosine phosphorylation target is conserved in CDKs. Alignment of amino termini of CDC2 (SPBC11B10.09) (*S. pombe*), CDK2 (ENSG00000123374) and CDK1 (ENSG00000170312) (human), AtCDKA;1 (AT3G48750) (*A. thaliana*), ZmCDKA;1 (Zm00001d053930), ZmCDKA2;1a (Zm00001d027373) and ZmCDKA2;1b (Zm00001d048497) (*Z. mays*), AtCDKB1;1 (AT3G54180), AtCDKB2;1 (AT1G76540), and AtCDKB2;2 (AT1G20930) (*A. thaliana*), ZmCDKB1;1 (Zm00001d044672) and ZmCDKB2;1 (Zm00001d031485) (*Z. mays*). Highlighted in yellow, the residue equivalent to Y15 in human CDK2, Wee1 phosphorylation target. Within a black inset, the PSTAIRE motif conserved in A‐type CDKs, or the PPTALRE motif conserved in B1‐type CDKs of *Z. mays* and *A. thaliana*. In gray, amino acids in CDKs with 100% identity with CDK2. CDC2 amino acid sequence was obtained from pombase database; CDK2 and CDK1 sequences from ensembl database and A. thaliana and maize CDK sequences from ensembl gramene database. Alignment was generated with BioEdit [76] using ClustalW algorithm [77].

On the other hand, CDKA2;1a alone, or in complex with CycD2;2a, was virtually not recognized by the pY15CDK2 antibody (Fig. 6C, panel III, lanes 1 and 2). To corroborate CDKA2;1a phosphorylation by Wee1 and antibody specificity, the CDKA2;1a/CycD2;2a complex was co‐expressed with mutant Wee1 (K309A); CDKA2;1a purified from this co‐expression was not recognized by the antibody (Fig. 6C, panel III, lane 5), confirming that Wee1 phosphorylated CDKA2;1a during co‐expression and that recognition was specific.

To further prove that Y15 in CDKA2;1a was the Wee1 phosphorylation target, the Y15F mutant was co‐expressed with CycD2;2a and Wee1. Y15F mutant purified from this co‐expression was not recognized by the anti‐pY15 antibody (Fig. 6C, panel III, lane 4). The loss of Wee1 phosphorylation was not due to a reduced association of CycD2;2a with mutant CDKA2;1a since both the wild type and the mutant (Y15F) CDKA2;1a associated to a similar amount of CycD2;2a (Fig. 6C, panel II, compare lanes 2 and 3). Additionally, Wee1 was more strongly associated with the Y15F mutant than with the wild‐type CDKA2;1a (Fig. 6C, panel I, compare lanes 4 and 6). Then, Wee1 phosphorylated CDKA2;1a at Y15 when the proteins were co‐expressed.

The antibody used to recognize pY15 in CDKA2;1a was specific since pY15 was only recognized when CDKA2;1a was co‐expressed with Wee1, but not when CDKA2;1a was co‐expressed with CycD2;2a and Cak1, which phosphorylates T161 in CDKA2;1a (Fig. 6C, panel III, lane 8) [30].

Wee1 differentially affects CDKA2;1a kinase activity

Compared with CDKA2;1a purified after co‐expression with CycD2;2a, CDKA2;1a purified after co‐expression with CycD2;2a and the wild type or the mutant version of Wee1 (K309A) did not seem to associate to a detectable amount of CycD2;2a (Fig. 6C, panel II, compare lanes 2, 5 and 6); only after increasing the amount of CDKA2;1a, CycD2;2a could be observed (Fig. 6A, panel II, lanes 6 and 7). If Cak1p was co‐expressed with the CDKA2;1a/CycD2;2a complex, the amount of CycD2;2a associated to CDKA2;1a was reduced, compared with expression without Cak1p (Fig. 6C, panel II, compare lanes 2 and 8). It is likely that in the co‐expression with Cak1p the amount of CycD2;2a in the bacterial soluble fraction was reduced [30]. Something similar may have happened when the CDKA2;1a/CycD2;2a complex was co‐expressed with Wee1; however, in this case, CycD2;2a associated less. This suggests that CycD2;2a and Wee1 competed for association to CDKA2;1a. This is supported by the fact that when CycD2;2a was not included in the co‐expression, the association of CDKA2;1a and Wee1 increased (Fig. 6C, panel I, compare lanes 6 and 7).

Competition between Wee1 and CycD2;2a could be the mechanism by which Wee1 reduces kinase activity in the CDKA2;1a/CycD2;2a complex, independently of Wee1 kinase activity. Addition of exogenous CycD2;2a to pT161CDKA2;1a/CycD2;2a complexes in the presence of Wee1 could revert Wee1 inhibition using histone H1 as substrate. Both the wild type and the mutant version (K309A) of Wee1 inhibited activity on histone H1 (Fig. 8A, higher panel, compare lanes 1–3), while addition of CycD2;2a to the pT161CDKA2;1a/CycD2;2a complex, in the absence of Wee1, decreased activity on histone H1, since both substrates competed for activity in the complex (Fig. 8A, higher panel, compare lanes 1 and 4) [30], but when CycD2;2a, histone, and the wild‐type or mutant versions of Wee1 were included, kinase activity on histone H1 was totally depressed, while activity on CycD2;2a remained virtually unchanged (Fig. 8A, higher panel, compare lanes 4–6). Therefore, exogenously added Wee1 does not seem to compete with CycD2;2a for CDKA2;1a association and further, Wee1 appears to affect CDKA2;1a differentially after their association, since the level of inhibition on both substrates was different.

Fig. 8 — Wee1 differentially modifies substrate phosphorylation. (A) Autoradiography of kinase activity in CDKA2;1a (100 ng) phosphorylated in T161 and in complex with CycD2;2a. Histone H1 (250 ng) was added as substrate in all reactions. To reactions in lanes 2 and 5, GST‐Wee1 (514 ng) was added, while to reactions in lanes 3 and 6, mutant Wee1 (K309A) (514 ng) was added, doubling the molar concentration (++) of CDKA2;1a (98 nm). To reactions in lanes 4–6, MBP‐CycD2;2a (230 ng) was also added to a molar concentration equivalent (+) to that of CDKA2;1a. (B) Immunodetection of CDKA2;1a (150 ng) kinase activity, in complex with CycD2;2a (lanes 1 and 4); in complex with CycD2;2a and wild‐type Wee1 (lanes 2 and 5) or in complex with CycD2;2a and the mutant Wee1(K309A) (lanes 3 and 6), when CDKA2;1a used ATP‐γ‐S to phosphorylate MBP‐CycD2;2a (348 ng) (lanes 1–3) or GST‐RBRCT (246 ng) (lanes 4–6). (C). The anti‐thiophosphate ester antibody is specific against CDKA2;1a phosphorylated substrates. Immunodetection of kinase activity of CDKA2;1a (150 ng) in complex with CycD2;2a and wild‐type Wee1 (lanes 1–4) or in complex with CycD2;2a (lanes 5–8), when CDKA2;1a used ATP‐γ‐S to phosphorylate MBP‐CycD2;2a (350 ng) (lanes 1–4) or GST‐RBRCT (246 ng) (lanes 5–8). In lanes 1 and 5 no ATP‐γ‐S was added and reactions were not treated with PNBM; in lanes 2 and 6 only ATP‐γ‐S was added; in lanes 3 and 7 proteins only received PNBM, while in lanes 4 and 8 ATP‐γ‐S was added and then proteins were treated with PNBM. (*) Asterisks indicate phosphorylation of RBRCT incomplete translation products. In (A) the Coomassie Blue stained gel used for autoradiography is included as a loading control. In (B and C) protein phosphorylation was recognized by an antibody against the thiophosphate ester (indicated as α‐PO3‐S‐R in figure) generated after proteins incorporating the thiophosphate were alkylated by PNBM. CDKA2;1a was recognized by an antibody against its PSTAIRE sequence and is included as a loading control, whereas membranes used for immunodetection were stained with Congo red and are included as loading controls for the substrates used. Representative figures from two independent replicates.

We previously demonstrated that in the pT161CDKA2;1a/CycD2;2a complex, CDKA2,1a participated in substrate recognition [30], so it was possible that Wee1 associated with CDKA2;1a and due to steric hindrance or to a conformational change affected the way CDKA2;1a recognizes substrates. To test this, the CDKA2;1a/CycD2;2a complex was purified together with either the wild type or the mutant version of Wee1. Instead of using radioactive label in these experiments (no longer sold by companies), ATP‐γ‐S and p‐nitrobenzylmesilate (PNBM) were used as described in Material and Methods and CycD2;2a was used as substrate. The CDKA2;1a/CycD2;2a complex used ATP‐γ‐S to label CycD2;2a; however, to our surprise, the association of wild type or mutant (K309A) Wee1 to the CDKA2;1a/CycD2;2a complex stimulated its activity on exogenous CycD2;2a (Fig. 8B, higher panel, compare lanes 1–3). Wee1 is a tyrosine kinase that apparently evolved from serine/threonine kinases [46] and could have phosphorylated CycD2;2a; however, neither version of Wee1 associated with or phosphorylated CycD2;2a (results not shown). When the substrate for the CDKA2;1a/CycD2;2a complex was RBRCT, association of Wee1 with the complex reduced its activity, whereas association of the Wee1(K309A) mutant almost completely eliminated its activity (Fig. 8B, higher panel, compare lanes 4–6). This result confirms that association of Wee1 with the CDKA2;1a/CycD2;2a complex was enough to inhibit its kinase activity, while the differential phosphorylation of substrates suggests that Wee1 modifies the way the complex recognizes substrates; since Wee1 did not associate with CycD2;2a, it is likely that Wee1 mainly affected CDKA2;1a.

Recognition of the thiophosphate ester in substrates phosphorylated by CDKA2;1a was specific, since the antibody only recognized thiophosphorylated substrates that were later alkylated by PNBM (Fig. 8C, higher panel, lanes 4 and 8). Substrates only thiophosphorylated, only treated with PNBM, or without modification were not recognized by the antibody (Fig. 8C, higher panel, lanes 1–3 and 5–7).

Wee1, independently of its kinase activity, inhibits CDKB1;1/CycD2;2a complex activity

The effect of Wee1 on the kinase activity of the CDKB1;1/CycD2;2a complex was also studied. We previously demonstrated the autophosphorylation in T197 of CDKB1;1 co‐expressed with CycD2;2a. Total activity of the CDKB1;1/CycD2;2a complex was achieved inducing the complex at 30 °C and adding the scaffolding protein CKS to the kinase activity assay; in addition, activity was higher towards exogenously added CycD2;2a, and to a lower extent towards RBRCT or histone H1 substrates [30]. Therefore, the effect of Wee1 on the activity of the CDKB1;1/CycD2;2a complex was assayed under these conditions.

As previously demonstrated GST‐CKS stimulated activity of the CDKB1;1/CycD2;2a complex (Fig. 9A, higher panel, compare lanes 1 and 2) [30]. The addition of Wee1 at an equimolar proportion with CDKB1;1 had a modest effect in the phosphorylation of CycD2;2a, however, differently to the almost null inhibition observed when CycD2;2a was the substrate for the pT161CDKA2;1a/CycD2;2a complex and Wee1 was included in a molar ratio of twice that of CDKA2;1a, if Wee1 was in a molar ratio of twice that of CDKB1, there was an evident inhibition of the phosphorylation; GST by itself had no effect (Fig. 9A, higher panel, compare lanes 2–5). Similar to inhibition of pT161CDKA2;1a/CycD2;2a complex by Wee1, when Wee1 was added to, and inhibited, the pT197CDKB1;1/CycD2;2a complex, CDKB1;1 was not phosphorylated, suggesting that inhibition was independent of Wee1 kinase activity. To further prove this, the Wee1 (K309A) mutant was used, showing also CDK inhibition in a concentration‐dependent manner, although inhibition was higher than with the wild‐type version (Fig. 9A, higher panel, compare lanes 4–7). Wee1 was recognized by the antibody when incubated in the presence of ATP‐γ‐S, in the absence of the pT197CDKB1;1/CycD2;2a complex, indicating autophosphorylation, so we discarded that Wee1 did not use ATP‐γ‐S to phosphorylate CDKB1;1.

The inhibitory capacity of Wee1 over the pT197CDKB1;1/CycD2;2a complex, using RBRCT as substrate, was also evaluated. As reported previously, in the absence of CKS RBRCT phosphorylation was weak, and after its addition RBRCT phosphorylation became evident, as well as that of a truncated product (Fig. 9B, higher panel, lanes 1 and 2) [30]. Interestingly, wild‐type Wee1 at a 2 : 1 molar ratio related to CDKB1;1 did not inhibit activity of the pT197CDKB1;1/CycD2;2a complex, while the Wee1 mutant (K309A) almost completely inhibited substrate phosphorylation. GST by itself had no effect (Fig. 9B, higher panel, lanes 2–5). Recognition of the thiophosphate ester in substrates phosphorylated by CDKB1;1 was specific, since the antibody only recognized thiophosphorylated substrates that were later alkylated by PNBM (Fig. 9C, higher panel, lanes 4 and 8).

These results suggest that similar to results with the CDKA2;1a/CycD2;2a complex, Wee1 could provoke a differential recognition of substrates by CDKB1;1.

Wee1 associates to, and phosphorylates, CDKB1;1

Analogous to the CDKA2;1a/CycD2;2a complex, Wee1 may have affected the activity of the CDKB1;1/CycD2;2a complex by means of its association. CDKB1;1 was co‐expressed with Wee1 and CycD2;2a, but only Wee1 association was observed (Fig. 10A, panels I and II, lanes 6 and 7); if in the co‐expression CycD2;2a was not included, Wee1 also co‐purified (Fig. 10B, panel I, lanes 6 and 7), suggesting that similar to CDKA2;1a, when CDKB1;1 was co‐expressed with CycD2;2a and Wee1, these last two proteins competed for association to CDKB1;1. The amount of protein was increased, and the amount of CycD2;2a associated to CDKB1;1 was compared whether Wee1 was included or not in the co‐expression; more CycD2;2a was associated to CDKB1;1 if Wee1 was not present (Fig. 10C, panel II, compare lanes 7 and 9).

Fig. 10 — Wee1 associates to and phosphorylates CDKB1;1. (A) Immunodetection of Wee1 (panel I), CycD2;2a (panel II) or CDKB1;1 (panel III) in purification fractions of His‐tag purified CDKB1;1 from co‐expression together with CycD2;2a and Wee1. Lane 1, bacterial lysate before starting induction; lane 2, bacterial lysate after induction; lanes 3, 4, and 5, insoluble, soluble and washing fractions, respectively; lanes 6 and 7, the first two purification eluates. (B) Immunodetection of Wee1 (panel I) or CDKB1;1 (panel II) in purification fractions of His‐tag purified CDKB1;1 from co‐expression together with Wee1. Order is the same as in (A). (C) Wee1 phosphorylates CDKB1;1. Immunodetection of association with Wee1 (wild type or mutant K309A, lanes 3, 4, 5, and 9 or 2 and 8, respectively) (panel I) and/or with CycD2;2a (panel II) of wild‐type CDKB1;1 (250 ng) (lanes 1–4 and 6–9) or mutant (K60A) (lane 5) purified by its His‐tag from co‐expression at 30 °C (lanes 1–6) or at 37 °C (lanes 7–9) with CycD2;2a (lanes 1 and 7), CycD2;2a and mutant Wee1(K309A) (lanes 2 and 8), CycD2;2a and wild‐type Wee1 (lanes 3, 5, and 9), wild‐type Wee1 (lane 4) or CycD2;2a and Cak1p (lane 6). In panels III and IV, the phosphorylation state of wild‐type CDKB1;1 or mutant K60A. In (A–C), CDKB1;1 was recognized by an antibody against the PSTAIRE sequence, while Wee1 was recognized by an antibody against its GST tag. In (A and C), CycD2;2a was recognized by an antibody against the MBP tag. In (C) phosphorylation of CDKB1;1 in T197 (panel III) was recognized by an antibody against human CDK2 phosphorylated in T160, while phosphorylation by Wee1 (panel IV) was recognized by an antibody against the Y15 phosphorylated human CDK2. (*) Proteins used in lanes 1–6 were purified after co‐expression at 30 °C. In A and B, representative figures from three independent replicates; in C, representative figure from two independent replicates.

It was previously demonstrated that when the CDKB1;1/CycD2;2a complex was co‐expressed with GST‐Cak1p, the amount of CycD2;2a associated to CDKB1;1 decreased, perhaps because the amount of CycD2;2a in the bacterial soluble fraction was reduced [30]. Something similar seemed to happen when Wee1 was included in the co‐expression of the CDKB1;1/CycD2;2a complex, as the amount of CycD2;2a was also reduced in the bacterial soluble fraction (Fig. 10A, panel II, lane 4). However, there was an association between CDKB1;1 and CycD2;2a whether Wee1 wild type or mutant (K309A) was in the co‐expression (Fig. 10C, panel II, lanes 8 and 9); conversely, if CDKA2;1a instead of CDKB1;1 was included in the co‐expression, CycD2;2a association was not detected (Fig. 6C, lanes 5 and 6), suggesting that CycD2;2a and Wee1 compete for association to CDKA2;1a but not to CDKB1;1.

In the CDKB1;1/CycD2;2a co‐expression at 30 °C, the association of the cyclin to CDKB1;1 was reduced perhaps also due to a lower amount of CycD2;2a in the bacterial soluble fraction (Fig. 10C, panel II, compare lanes 1 and 7) [30]; if Wee1 wild type or mutant were also included, both associated to CDKB1;1 at a level similar to that observed in the co‐expression at 37 °C (Fig. 10C, panel I, lanes 2, 3, 8 and 9); however, the association of CycD2;2a to CDKB1;1 was not importantly modified by the presence of any of the Wee1 versions, or if Cak1p was included instead of Wee1 (Fig. 10C, panel II, compare lanes 1–3 and 6). These results support the idea that CycD2;2a and Wee1 do not compete for associating to CDKB1;1.

On the other hand, association of Wee1 to CDKB1;1 appeared to require either CDKB1;1 catalytic activity or the conformational change produced by the autophosphorylation since the catalytically inert CDKB1;1 (K60A) mutant [30], associated to a lower amount of Wee1 (Fig. 10C, panel I, compare lanes 3 and 5).

The equivalent to Y15 phosphorylation in CDKB1;1 could be detected in vivo with an antibody against the human pY15 CDK2 [38], however, no phosphorylation in CDKB1;1 was observed when recombinant Wee1 was exogenously added to CDKB1;1/CycD2;2a complexes. Since Y15 phosphorylation was detected in CDKA2;1a when co‐expressed with CycD2;2a and Wee1, CDKB1;1 phosphorylation was evaluated after its co‐expression with CycD2;2a and Wee1; under these conditions, CDKB1;1 was recognized by the antibody, but not if the K309A Wee1 mutant was used instead of the wild‐type protein or if Wee1 was not added (Fig. 10C, panel IV, lanes 7–9).

The amount of CDKB1;1 purified after co‐expression at 37 °C with CycD2;2 and Wee1 was very low (Fig. 10A, panel III, lanes 6 and 7); if co‐expression was carried out at 30 °C the amount increased (M. N. López‐Hernández, unpublished result). CDKB1;1 purified from co‐expression at 30 °C together with CycD2;2a and Wee1 was better recognized by the anti‐pY15 antibody than CDKB1;1 purified from co‐expression at 37 °C (Fig. 10C, panel IV, compare lanes 3 and 9). If only CDKB1;1 and Wee1 were co‐expressed at 30 °C, CDKB1;1 was phosphorylated at a similar level to that when co‐expressed with CycD2;2a and Wee1 (Fig. 10C, panel IV, compare lanes 3 and 4), different from CDKA2;1a, that required CycD2;2a in the co‐expression. A similar result was observed when this experiment was performed at 37 °C (M. N. López‐Hernández, unpublished result). On the other hand, CDKB1;1 (K60A) mutant was poorly phosphorylated when co‐expressed with CycD2;2a and Wee1 at 30 °C (Fig. 10C, panel IV, lane 5), possibly due to weaker Wee1 association with CDKB1;1. In the co‐expression of CycD2;2a, CDKB1;1 and Wee1 (K309A) at 30 °C, CDKB1;1 was not recognized by the anti‐pY15 antibody, as expected (Fig. 10C, panel IV, compare lanes 1 and 2).

Phosphorylation of human CDK2 by Wee1 interferes with the correct positioning of ATP in CDK2 [15], on the other hand, CDKB1;1 autophosphorylates in the activation loop when co‐expressed with CycD2;2a [30], therefore, Wee1 phosphorylation of CDKB1;1 could interfere with autophosphorylation. Using an antibody against pT160 in CDK2 that recognizes phosphorylation of T197 in CDKB1;1 [30], the effect of Wee1 on CDKB1;1 autophosphorylation was followed. Neither phosphorylation of CDKB1;1 by Wee1, nor their association perturbed its autophosphorylation. The Wee1 (K309A) mutant had no effect either (Fig. 10C, panel III, lanes 7–9).

As stated above, phosphorylation of CDKB1;1 by Wee1 at 37 °C was low, and this would explain why CDKB1;1 autophosphorylation in T197 was not modified when Wee1 was included in the co‐expression, furthermore, at 37 °C the level of CDKB1;1 autophosphorylation is low too, however, at 30 °C autophosphorylation importantly increases (Fig. 10C, panel III, compare lanes 1 and 7) [30] and also Wee1 phosphorylation of CDKB1;1 is higher. Autophosphorylation of CDKB in the CDKB1;1/CycD2;2a complex co‐expressed with Wee1 at 30 °C was evaluated. Co‐expression with the mutant Wee1 did not modify CDKB1;1 autophosphorylation importantly, however, the wild‐type version of Wee1 importantly decreased CDKB1;1 autophosphorylation (Fig. 10C, panel III, compare lanes 2 and 3). Both the wild‐type and mutant versions of Wee1 bound CDKB1;1, suggesting that it was Wee1 phosphorylation of CDKB1;1 that inhibited its autophosphorylation.

CDKB1;1 phosphorylation has a substrate‐dependent effect on kinase activity

The way in which the association of Wee1 to the CDKB1;1/CycD2;2 complex, and how the changes in phosphorylation status of CDKB1;1 after co‐expression at 30 °C with CycD2;2a and Wee1, affect its kinase activity were studied. The purified complex containing Wee1 was less effective in phosphorylating CycD2;2, while if instead of wild‐type Wee1, the K309A mutant was co‐purified, activity in the complex was similar to that in the CDKB1;1/CycD2;2 complex purified from co‐expression at 30 °C (Fig. 11, compare lanes 1–3). These results indicate that, differently to exogenous addition of Wee1, co‐expression of this promoted CDKB1;1 phosphorylation and reduction of its autophosphorylation, although both, the exogenous addition of Wee1 or its co‐expression promoted a decrease in CycD2;2a phosphorylation.

Fig. 11 — CDKB1;1 autophosphorylation affects kinase activity in a substrate‐dependent manner. Immunodetection of CDKB1;1 (150 ng) kinase activity, phosphorylated on T197 and in complex with CycD2;2a (lanes 1 and 4); Wee1 phosphorylated and in complex with CycD2;2a and wild‐type Wee1 (lanes 2 and 5) or phosphorylated in T197 and in complex with CycD2;2a and mutant Wee1(K309A) (lanes 3 and 6), when CDKB1;1 used ATP‐γ‐S to phosphorylate MBP‐CycD2;2a (348 ng) (lanes 1–3) or GST‐RBRCT (246 ng) (lanes 4–6) (*) Asterisks indicate phosphorylation of incomplete RBRCT translation products. Protein phosphorylation was recognized by an antibody against the thiophosphate (indicated as α‐PO3‐S‐R in figure) ester generated after proteins incorporating the thiophosphate were alkylated by PNBM. CDKB1;1 was recognized by an antibody against the PSTAIRE sequence and is included as a loading control, whereas membrane used for immunodetection was stained with Congo red and is included as a loading control of the substrates used. Representative figures from two independent replicates.

The Wee1 mutant did not inhibit activity probably because it associated less effectively to CDKB1;1, compared to the wild‐type Wee1 (Fig. 10C, panel I, compare lanes 2 and 3). Complex inhibition by co‐expressed Wee1 was due either to a reduced CDKB1;1 autophosphorylation, to Wee1 association and/or to Wee1 phosphorylation of CDKB1;1.

Increasing the temperature of co‐expression of CDKB1;1/CycD2;2a complex from 30 to 37 °C produced a reduction on T197 CDKB1;1 autophosphorylation (Fig. 10C, panel III, compare lanes 1 and 7), similar to that produced by inclusion of Wee1 in the CDKB1;1/CycD2;2a co‐expression (Fig. 10C, panel III, compare lanes 1 and 4). However, we previously reported that the reduction of kinase activity by increasing the temperature of co‐expression of CDKB1;1/CycD2;2a complex was not as large as the reduction of activity observed by the inclusion of Wee1 in the co‐expression of the CDKB1;1/CycD2;2a complex, suggesting that the activity of the latter was influenced by a decrease in autophosphorylation at T197, Wee1 phosphorylation, or its association to CDKB1;1.

The mutant version of Wee1 copurifying with the CDKB1;1/CycD2;2a complex did not inhibit CycD2;2a phosphorylation; therefore, when CycD2;2a was a substrate for the CDKB1;1/CycD2;2a/Wee1 complex, besides a decrease of CDKB1;1 autophosphorylation, possibly only Wee1 phosphorylation on CDKB1;1 contributed to reduce complex activity.

Of interest, when RBRCT was the substrate, neither association of Wee1 to CDKB1;1, nor a decrease in T197 autophosphorylation of CDKB1;1 or Wee1 phosphorylation of CDKB1;1 seemed to modify substrate phosphorylation, since activity in the CDKB1;1/CycD2;2a complex was similar to activity of the CDKB1;1/CycD2;2a complex purified from co‐expression with the wild type or mutant version of Wee1 (Fig. 11, compare lanes 4–6). For CycD2;2a phosphorylation, modification of activity in the CDKB1;1/CycD2;2a/Wee1 complex could be due to Wee1 phosphorylation of CDKB1;1 and a decrease of T197 autophosphorylation; however, neither of these affected RBRCT phosphorylation, suggesting that the effect of Wee1 phosphorylation and CDKB1;1 autophosphorylation are substrate‐dependent.

Maize CDKs differentially affect Wee1

Wee1 was more strongly phosphorylated when added exogenously to CDKA2;1a complexes than when the latter were not in the assay, suggesting phosphorylation by CDKA2;1a. In addition, Wee1 wild type showed a higher phosphorylation signal than the mutant version. This weaker signal in the Wee1 K309A mutant might be due to competition with the substrate added for CDKA2;1a activity. However, a similar result was observed after incubation in the absence of substrate, except that a truncated product, between 50 and 75 kDa, of both versions of Wee1 was importantly phosphorylated under these conditions (Fig. 12A, compare lanes 1 and 2 with lanes 8 and 9). This fragment was Wee1‐specific since incubation of the pT161CDKA2;1a/CycD2;2a complex in the absence of Wee1 eliminated this band (Fig. 12A, lane 7); in addition, recognition of Wee1 (or its fragment) by the antibody against the thiophosphate ester depended on the addition of ATP‐γ‐S and PNBM (Fig. 12C, lanes 1–4).

Fig. 12 — Maize CDKs act differentially on Wee1. (A) Immunodetection of autophosphorylation and/or phosphorylation of wild‐type Wee1 (381 ng) (lanes 4, 5 and 8) or mutant (K309A) (lanes 6 and 9). Wee1 was incubated with CDKB1;1 (150 ng) phosphorylated in T197 and in complex with CycD2;2a (lanes 4–6) or CDKA2;1a (100 ng) phosphorylated in T161 and in complex with CycD2;2a (lanes 7–9). GST‐CKS (225 ng) was also included in lanes 3, 5 and 6. Autophosphorylation of wild‐type Wee1 or mutant (K309A) is shown in lanes 1 and 2, respectively; lanes 3 and 7 show autophosphorylation and/or phosphorylation associated to pT197CDKB1;1/CycD2;2a or pT161CDKA2;1a/CycD2;2a complexes, respectively. (B) Effect of CDKB1;1 on Wee1 autophosphorylation. Immunodetection of wild‐type Wee1 (381 ng) autophosphorylation (lanes 3–7), if the kinase activity assay contained 300 ng (++) (lane 7) or 150 ng (+) CDKB1;1 in complex with CycD2;2a (lanes 3 and 4); mutant CDKB1;1 (K60A) (150 ng) in complex with CycD2;2a (lane 5) or CDKB1;1 monomer (150 ng) (lane 6). Lanes 1 and 2, autophosphorylation of wild‐type GST‐Wee1 or mutant (K309A), respectively. (**) CDKB1;1/CycD2;2a complexes used in lanes 3 and 7 were purified after co‐expression at 30 °C. (C) The antibody against the thiophosphate ester recognizes Wee1 phosphorylation. Immunodetection of autophosphorylation and/or phosphorylation of GST‐Wee1 (381 ng) (lanes 1–8) if the assay contained CDKB1;1 (150 ng) phosphorylated in T197 and in complex with CycD2;2a (lanes 1–4) or CDKA2;1a (100 ng) phosphorylated in T161 and in complex with CycD2;2A (lanes 5–8). In lane 9, autophosphorylation of GST‐Wee1. No ATP‐γ‐S was included in lanes 1 and 5 and reactions were not treated with PNBM; in lanes 2 and 6 only ATP‐γ‐S was included; in lanes 3 and 7 proteins were only treated with PNBM, while in lanes 4, 8 and 9 ATP‐γ‐S was added and then proteins were treated with PNBM. (*) Asterisks in (A and C) indicate alkylation of a truncated product of wild‐type GST‐Wee1 or mutant (K309). Protein phosphorylation was recognized by an antibody against the thiophosphate ester (indicated as α‐PO3‐S‐R in figure) generated after proteins incorporating the thiophosphate were alkylated by PNBM. CDKB1;1 or CDKA2;1a was recognized by an antibody against the PSTAIRE sequence and were included as loading controls, whereas membranes used for immunodetection were stained with Congo red and are included as loading controls for Wee1. Representative figures from two independent replicates.

A 50 kDa band was also recognized in the wild‐type or mutant versions of Wee1 and recognition was not modified by adding the pT161CDKA2;1a/CycD2;2a complex (Fig. 12A, compare lanes 1 and 2 with lanes 8 and 9). When the pT161CDKA2;1a/CycD2;2a complex and wild‐type Wee1, previously treated or not with ATP‐γ‐S, were incubated with the antibody, the 50 kDa band was not recognized; however, this reappeared when only PNBM was added (Fig. 12C, lanes 5–7), suggesting that a cysteine in Wee1 was alkylated by PNBM and then recognized by the antibody.

Incubation of Wee1 wild type with the pT197CDKB1;1/CycD2;2a complex reduced Wee1 autophosphorylation, more evident in the complete protein than in the truncated product. As was stated above, CKS is necessary for kinase activity of pT197CDKB1;1/CycD2;2a complex; however, decrease in Wee1 autophosphorylation was independent of CKS association to the complex (Fig. 12A, compare lanes 1, 4, and 5). When the pT197CDKB1;1/CycD2;2a complex and Wee1 wild type were incubated, the 50 kDa truncated product was also recognized, as it was when the pT161CDKA2;1a/CycD2;2a complex was incubated with Wee1 wild type. Recognition was not associated to any other protein in the complex, since in the absence of Wee1, no other protein was recognized (Fig. 12A, lane 3). Recognition of the truncated, 50 kDa Wee1 product was due to alkylation of a cysteine, since after incubation of the pT197CDKB1;1/CycD2;2a complex and Wee1 wild type with PNBM, in the absence of ATP‐γ‐S, the truncated product was observed, but not if only ATP‐γ‐S was added. In addition, including ATP‐γ‐S in the assay and then PNBM caused recognition of Wee1 complete and of the truncated 75–50 kDa product; bands corresponded to Wee1 autophosphorylation, since recognition was similar to Wee1 recognition in the absence of the pT197CDKB1;1/CycD2;2a complex (Fig. 12C, lanes 1–4 and 9). Differently to the results observed with the pT161CDKA2;1a/CycD2;2a complex, the mutant version of Wee1 incubated with the pT197CDKB1;1/CycD2;2a complex was not phosphorylated, since the antibody only recognized the truncated Wee1 product (~ 50 kDa) that was unspecifically alkylated (Fig. 12A, lane 6).

In summary, experiments show that CDKA2;1a and CDKB1;1, associated to CycD2;2a act differently on Wee1: while the pT161ACDKA2;1a/CycD2;2a complex phosphorylates Wee1, the pT197CDKB1,1/CycD2;2a complex does not, and negatively regulates autophosphorylation.

Xenopus laevis Wee1 is phosphorylated by CDK1 to negatively regulate its activity [9], however, the pT197CDKB1;1/CycD2;2a complex does not seem to phosphorylate Wee1, although it may be that our method was not sensitive enough. To rule out this possibility, the CDKB1;1/CycD2;2a complex containing the CDKB1;1(K60A) mutant, lacking kinase activity [30], was incubated in the presence of Wee1 wild type. The CDKB1;1(K60A)/CycD2;2a complex inhibited autophosphorylation at a similar level as the wild‐type complex (Fig. 12B, compare lane 1 with lanes 3 and 5). This suggests that inhibition of Wee1 autophosphorylation did not depend on CDKB1;1 catalytic activity. We tested if an increase in the amount of the pT197CDKB1;1/CycD2;2a complex would favor inhibition of Wee1 autophosphorylation; however, duplicating the amount of complex incubated with Wee1 did not increase autophosphorylation inhibition (Fig. 12B, compare lane 1 with lanes 3 and 7). On the other hand, monomeric CDKB1;1 did not inhibit importantly Wee1 autophosphorylation (Fig. 12B, compare lanes 1 and 6). Of interest was that in Wee1 incubated with the pT197CDKB1;1/CycD2;2a complex purified from co‐expression at 37 °C, autophosphorylation decreased similarly to complex co‐expression at 30 °C (Fig. 12B, compare lanes 1, 3, and 4). The level of autophosphorylation at T197 of CDKB1;1 in the CDKB1;1/CycD2;1 complex expressed at different temperatures was different; however, in both complexes CDKB1;1 was associated with CycD2;2a. The association of cyclins with CDKs produces a CDK conformational change [50], so inhibiting Wee1 autophosphorylation may require a conformational change in CDKB1;1 promoted by the association to CycD2;2a.

Discussion

In plants, cell cycle regulating proteins have been importantly diversified. While in humans the Cyclin D family is composed of three members, Arabidopsis and maize families comprise 14 and 17 members, respectively [52, 53]. The same is observed for other regulators such as CDKs [22]. This is not the case for Wee1, that has been conserved as a monocopy gene throughout evolution, suggesting a fundamental role for plant development, since genes that participate in “house‐keeping” functions tend to have low duplicity [54].

In many organisms Wee1 has been broadly studied, both at genetic and biochemical levels, however in plants, Wee1 has been scarcely studied, and the existing studies have been performed mainly at the genetic level, and so, in this work we have studied in vitro the effect of ZmWee1 on maize CDKA2;1a and CDKB1;1 kinase activity, both in association with maize CycD2;2a.

Wee1 inhibitory activity

Since A. thaliana plants in which the phosphorylation target of Wee1 in CDKA is mutated can still respond to replicative stress, in a similar way to wild type plants but differently to Wee1 mutant plants, it was suggested that Wee1 might function as a stoichiometric inhibitor, in a nonphosphorylation‐dependent manner, by directly binding to CDK [55], similar to reports in S. cerevisiae where the catalytically inactive equivalent of Wee1 protein kinase (Swe1p) inhibited Cdc28p kinase activity in vitro [45]. However, in vivo Y15 in Cdc28p was phosphorylated, suggesting that Swe1p mutation did not affect its kinase activity [56]. In this work, we find that the catalytically inert maize Wee1 kinase (K309A) did not autophosphorylate and when co‐expressed with CDKA2;1a or CDKB1;1, together with CycD2;2a, no equivalent Y15 phosphorylation could be detected in CDKs, indicating that in the K309A mutant Wee1 kinase activity was eliminated. Therefore, when the Wee1(K309A) mutant inhibited CDKB1;1, or wild‐type or mutant (Y15F) CDKA2;1a kinase activities, it did so independently of its kinase activity, a mechanism not shown previously for Wee1 kinase; thus, our in vitro results support the hypothesis that Wee1 could act as a stoichiometric inhibitor in vivo, a mechanism that may be conserved in plants.

Results suggest that Wee1 competed with CycD2;2a for CDKA2;1a association when proteins were co‐expressed; however, in vitro exogenous addition of CycD2;2a did not revert Wee1 inhibition of kinase activity of the CDKA2;1a/CycD2;2a complex. We modeled the association of CDKA2;1a with CycD2;2a or Wee1 and observed that both proteins associated with the same region of CDKA2;1a (Fig. 13), suggesting that Wee1 could compete with CycD2;2a for association with CDKA2;1a. Interestingly, the model predicts that Wee1 interacts mainly by its amino end, consistent with our experiments that indicate that Wee1's amino end is important for inhibition.

Fig. 13 — CycD2;2a and Wee1 interact in the same region of CDKA2;1. Protein–protein docking of CDKA2;1a (in cyan) and CycD2;2a (in purple) or CDKA2;1a and Wee1 (in orange) modeled using ClusPro [75]. The most abundant cluster models, respectively, were aligned with pymol [78].

We previously reported that in maize CDKA2;1a/CycD2;2a and CDKB1;1/CycD2;2a complexes, the CDK in the complex participated in substrate recognition [30]. In this work it was observed that when Wee1 was added exogenously to CDKA2;1a/CycD2;1a or CDKB1;1/CycD2;2a complexes, or was co‐expressed with them, Wee1 affected differentially the phosphorylation of the substrates tested, and therefore a possible mechanism by which Wee1 inhibited CDK kinase activity, independently of its kinase activity, was by association to the CDK, and depending on how much this associated region participated in recognition of the substrate, the effect of Wee1 on CDK kinase activity was more or less important. Contrary to expectations, Wee1 stimulated basal activity of the CDKA2;1a/CycD2;2a complex. At low concentrations p21, a stoichiometric inhibitor of kinase activity in human CDK/Cyc complexes, stabilizes active complexes and stimulates their activity [57]. Maize Wee1 does not seem to associate with CycD2;2 (López‐Hernández MN, unpublished result), and also Wee1 only stimulated basal activity of the complex when CycD2;2a was the substrate but not when the substrate was RBR carboxy‐terminal, suggesting that Wee1 did not stimulate CDK complexes by a mechanism similar to that of p21; perhaps association of Wee1 to CDKA2;1 could induce a conformation in CDKA2;1a structure that favors CycD2;2a recognition.

Although Wee1 could compete with cyclins for CDK association as a mechanism for CDK inhibition, this mechanism might not be a general one as Wee1 did not seem to compete with CycD2;2 for association to CDKB1;1. Since competition was evident particularly after Wee1 co‐expressed with the CDKA2;1a/CycD2;2a complex, it is possible that such mechanism requires high Wee1 concentrations.

Wee1 accumulates during the endoreplicative stage of maize endosperm development, in which the DNA is duplicated repeatedly without cell division, but phosphorylation by Wee1 of the CDKs controlling mitosis could not be detected, and so it was suggested that Wee1, by means of its catalytic activity, could function redundantly with a non‐catalytic inhibitor to inhibit mitotic CDKs and induce endoreplication [10, 58]. Here we show that Wee1 behaved as an inhibitor independently of its kinase activity, suggesting that Wee1 alone would be capable of inducing endoreplication during maize endosperm development. Endoreplication requires the inhibition of phosphorylation of substrates that promote mitosis without affecting the phosphorylation of substrates that will promote DNA replication [58]; here we show that Wee1 can inhibit substrate phosphorylation in a differential and specific manner, perhaps indicating a way by which Wee1 could regulate the differential phosphorylation of substrates to promote endoreplication.

Since Wee1 associates to both CDKs studied here, it was not possible to clearly determine the role of CDK phosphorylation by Wee1; nevertheless, in certain cases phosphorylation of CDKs by Wee1 seemed irrelevant. For instance, when Wee1 phosphorylated CDKA2;1a in the CDKA2;1a/CycD2;2a complex, basal kinase activity of the complex on CycD2;2a appeared not to be modified by phosphorylation, while it could have been when RBRCT was the substrate, suggesting that the resulting kinase activity of CDK‐Cyc complexes after Wee1 phosphorylation might be substrate‐dependent, independently that Wee1 association to CDKs could interfere with phosphorylation activity. Interrupting the association of Wee1 to CDK without modifying CDK phosphorylation by Wee1 would be a useful way to understand mechanistically the relevance of this phosphorylation, besides studying a wider range of substrates. In vivo, an important number of proteins associate to CDK/Cyc complexes, and this could modify the action of Wee1 on these complexes; therefore, in the future, it will be necessary to study Wee1 in vivo.

Wee1 activity on CDKB1;1

There were no reports of phosphorylation of B‐type CDKs by Wee1 in higher plants, although conservation of the equivalent Y15 residue of human CDK2 in all B‐type CDKs in A. thaliana and other plants suggests its existence. However, recent studies demonstrated that Wee1 function in A. thaliana might not be conserved. When AtWee1 was induced in tobacco, the protein behaved as a dominant negative affecting the activity of CDKB1 but not that of CDKA;1 [59], and therefore it is possible that in A. thaliana, Wee1 lost the capacity to regulate CDKB. A recent phylogenetic analysis has shown that Wee1 in Brassica napus and A. thaliana, both belonging to the Brassicaceae family, had a high divergence, consistent with substitution of amino acids in the functional domains [60].

Unlike A. thaliana, we previously detected Wee1 phosphorylation on maize CDKB1;1 [38], and in this work, we corroborated that maize Wee1 associated to and phosphorylated CDKB1;1, and opposite to CDKA2;1a, CDKB1;1 did not require association to CycD2;2a for efficient phosphorylation. Also, contrasting with CDKA2;1a, CDKB1;1 autophosphorylated in T197 [30] and this phosphorylation decreased after phosphorylation by Wee1; previous experiments indicated that CDKB1;1 autophosphorylates during its translation [30], and then one possibility is that Wee1 phosphorylated the nascent CDKB1;1 peptide, restricting T197 autophosphorylation. Human Wee1 did not phosphorylate CDK1 monomer; however, Wee1 lacking its regulatory N‐terminal domain phosphorylated CDK1 monomer and also a peptide containing Y15, not phosphorylated by the complete version of Wee1 [48, 61]. Perhaps maize Wee1 lacks or lost this regulatory control and behaves similarly to human Wee1 without the N‐terminal domain.

In A. thaliana, two of the three CAKs homologous to human CDK7 were phosphorylated by Wee1, and the activity of one of them was negatively regulated by co‐expression with Wee1 [62]. As stated above, maize Wee1 negatively regulated CDKB1;1 autophosphorylation in T197, which is, together with CKS association, very important for CDKB1;1 activation [30], and then in plants Wee1 could be regulating CDK activity at the level of activation, different to humans, in which regulation of CDKs by Wee1 is at the level of their catalysis. We have previously reported that Wee1 phosphorylation of CDKB1;1 is active during maize germination, while T197 phosphorylation is not [38], suggesting that during germination Wee1 maintains low levels of T197 phosphorylation.

During maize germination CDKB1;1 co‐immunoprecipitated with Wee1 (E. D. Guerrero‐Molina, unpublished results) and CycD2;2 co‐immunoprecipitated with CDKB1;1 [29], which suggests that the three proteins could be in the same complex; on the other hand, we previously reported that immunopurified CDKB1;1/CycD2;2a complexes phosphorylated the RBR carboxy end, even though CDKB1;1 had been Wee1 phosphorylated and no T197 phosphorylation was present [38]. In this work we report that differently from CycD2;2a, when the RBR carboxy end was the substrate of the CDKB1;1/CycD2;2a/Wee1 complex, neither a decrease in T197 autophosphorylation nor phosphorylation by Wee1 or its association affected substrate phosphorylation. This suggests that the mechanism we described in vitro may also occur in vivo. Otherwise, the described mechanism implies that the manner in which phosphorylation by Wee1 modifies CDKB1;1 activity could be different from that reported for human CDK2, in which phosphorylation by Wee1 interfered with the correct positioning of ATP [15]. It is likely that phosphorylation of CDKB1;1 by Wee1 affected regions in the protein that participate differentially in substrate recognition, although the association of Wee1 to CDKB1;1 could also have modified the effect of Wee1 phosphorylation on CDKB1;1 activity.

Regulation of Wee1 by CDKs

Wee1 regulated differentially CDKA2;1a and CDKB1;1, but these also acted differentially on Wee1. In human and X. laevis Wee1, two organisms in which Wee1 has been thoroughly studied, phosphorylation of Wee1 by CDKs promotes Wee1 degradation through the proteasome or its inactivation; the activating phosphorylation of Wee1 is not common and none is mediated by a CDK [63, 64], and so it is possible that phosphorylation of Wee1 by CDKA2;1a mainly promotes its inactivation.

Phosphorylation by CDKA2;1a of full length Wee1 protein was weak, but phosphorylation of incomplete Wee1 protein products was stronger. This suggests that in vivo Wee1 phosphorylation by CDKA2;1a would be regulated by conformational changes in the protein, likely due to association to other proteins inducing such conformational change that favors phosphorylation by CDKA2;1a. In human Wee1, phosphorylation of S123 and S139, both mediated by a CDK, regulates association to Plx1 (Polo‐like protein), a protein important for mitosis that phosphorylates Wee1 to promote its degradation [65]. A similar mechanism could exist for maize CDKA2;1a and Wee1.

It was not evident that Wee1 was a substrate of CDKB1;1, despite both CDKs associated with the same cyclin, indicating, as previously demonstrated, that in the studied complexes the CDK moiety participates in substrate discrimination [30, 34]. However, even though the CDKB1;1/CycD2;2a complex did not phosphorylate Wee1, results suggest that the association of the complex to Wee1 partially inhibited its activity and it might be that CDKB1;1 requires the conformational change produced by its association with CycD2;2a to inhibit Wee1 activity. Interestingly, when the amount of the CDKB1;1/CycD2;2a complex was increased to produce a higher inhibition of Wee1 autophosphorylation, the result was a slight reversal of the observed inhibition when the complex was added in a 1 : 1 relationship to Wee1. Reports indicate that in the interaction of proteins that constitute a trimeric complex, when one of the proteins acts as a bridge in interaction with the others, an excess of the bridge protein could work against the formation of the trimeric complex [66]. It is clear that CDKB1;1, purified from co‐expression with CycD2;2a, did not totally associate with the cyclin. It is thus possible that CDKB1;1 monomers competed for association with Wee1 with the CDKB1;1/CycD2;2a complexes, partially reverting inhibition of Wee1 activity when there was an excess of the complex. This could also explain why inhibition of Wee1 activity was only partial when the complex was used in a 1 : 1 proportion.

We ignore the reason of Wee1 autophosphorylation in maize; however, in X. laevis and in human, Wee1 autophosphorylation favors its activation [64]; a possibility is that in maize inhibition of Wee1 autophosphorylation promotes its inactivation, although it is also possible that the CDKB1;1/CycD2;2a complex directly interferes with the sites of autophosphorylation in Wee1, without affecting the phosphorylation of other substrates.

Altogether, our results show that in vitro, independently of its kinase activity, maize Wee1 modulated and not only inhibited kinase activity in CDK/CycD2;2a complexes, as has been previously reported for Wee1 in different organisms. This type of regulation appears to depend on the association of Wee1 with the CDKs, perhaps by modifying the way in which the CDKs recognize their substrates. On the other hand, Wee1 also phosphorylated the CDKs under study, and this differentially affected substrate phosphorylation by the CDKs. These findings indicate that Wee1 could modulate kinase activity of the CDKs by at least two mechanisms. In vivo studies must be conducted to evaluate the implications of the mechanisms here described for cell cycle control in maize.

Materials and methods

Vectors for recombinant protein expression

Wee1 and Wee1S coding sequences were amplified from cDNA obtained from the basal end of a maize cob (stage R2) using the primer pairs FwdWee1‐ RevWee1 and Fwd2Wee1‐ RevWee1 (Table 1), respectively, including 3% DMSO in the Wee1 amplification reaction. Amplified sequences were ligated to the pENTR vector (Invitrogen, Waltham, Massachusetts, United States) using the cloning kit pENTR/D‐TOPO (Invitrogen). Resultant constructs recombined with the pDEST15 vector using the mix of the LR clonase II enzyme (Invitrogen) to obtain the pDEST15*Wee1 and pDEST15*Wee1S vectors, coding for GST‐Wee1 and GST‐Wee1S, respectively.

Table 1.

Primers used for amplification and mutagenesis of coding sequences.

Primer name	Sequence (5′ > 3′)
Fwd Wee1	`CACCATGCTGAGGACCAAGACCC`
Fwd2 Wee1	`CACCTTCTGCACCCCGGACTACAT`
Rev Wee1	`CTACTTCGATGAGGCCTTGT`
FwdWee1K309A	`TGCTGTTGCACGGAGCATCAAGCAATTGCATAATGATATGGAAAGGAGGCAAG`
RevWee1K309A	`GCTCCGTGCAACAGCATACAAGCACCCGTCTATCCTATTCAGAACTTTGAAC`

Open in a new tab

Wee1 K309A mutant was generated by site‐directed mutagenesis [67] starting from the pDEST15*Wee1 construct using FwdWee1K309A and RevWee1K309A as primers (Table 1). Correct cloning of the coding sequences and of the mutagenesis process were confirmed by sequencing.

Protein expression

Plasmids coding for His‐CDKA, His‐CDKB1;1 and the His‐CDKA2;1a/CycD2;2a‐MBP and His‐CDKB1;1/CycD2;2a‐MBP complexes, that include the wild‐type version of CDKs, as well as complexes that included the mutants CDKA2;1a(Y15A) or CDKB1;1(K60A), previously obtained [30], were transformed in the E. coli Tuner strain (DE3) (Novagene, Darmstadt, Germany); plasmids coding for GST‐Wee1, GST‐Wee1S and the GST‐RBRPC and GST‐RBRCT substrates [68] were transformed in the E. coli Rosetta2 strain (DE3) (Novagene). Plasmids coding for the MBP‐CycD2;2a substrate [30], the GST‐CKS scaffolding protein (García‐Ramírez, unpublished results), GST‐Cak1p kinase [30] and GST protein (GE Healthcare, Illinois, United States) were transformed in the E. coli Tuner strain (DE3).

For co‐expression of the His‐CDKA2;1a/CycD2;2a‐MBP or His‐CDKB1;1/CycD2;2a‐MBP complexes containing GST‐Wee1, wild type or mutant (K309A), E. coli Tuner strain cells (DE3) (Novagene) were co‐transformed with 100 ng of the plasmid coding for each complex plus 100 ng of the plasmid containing every version of GST‐Wee1. For co‐transformation of GST‐Wee1, wild type or mutant (K309A), with CDK‐CycD2;2a complexes containing mutants CDKA2;1a(Y15F) or CDKB1;1(K60A), the same amounts of plasmid were used as those used for co‐transformation of plasmids containing the wild‐type versions of CDKs.

Recombinant protein expression was induced starting with transformed bacteria, inoculating LB broth containing the corresponding antibiotic with 1% of a pre‐culture. Bacteria grew at 37 °C up to a OD₆₀₀ between 0.6 and 0.8, recombinant protein expression was induced by adding IPTG (0.05 mm for Tuner or 0.3 mm for Rosseta2 strain) (4 h at 37 °C), then bacteria were harvested at 2600 g (10 min at 4 °C). Cak1p was induced as reported by Kaldis et al., (1996). For induction at 30 °C, cultures were grown for 3 h at 37 °C, then growth continued at 30 °C for 1.5 h; finally, expression of complexes was induced by adding IPTG (0.05 mm) (18 h at 30 °C).

Protein purification

Purification of monomeric CDKs, or in complex with CycD2;2a‐MBP and/or GST‐Wee1, was performed as reported previously [30]. Briefly, the bacterial pellet was resuspended in 1X LEW buffer (50 mm NaH₂PO₄ pH 8.0, 300 mm NaCl) with 10% (v/v) glycerol, bacteria were lysed, and DNA was fragmented by sonication. 1% (v/v) Triton X‐100 was added, and the lysate was incubated at 4 °C for 20 min with shaking; the resultant soluble fraction was filtered and incubated with Ni‐NTA Agarose resin (Qiagen, Hilden Düsseldorf, Germany) with shaking for 1 h at 4 °C. Resin was washed with 1X LEW buffer containing 25 mm imidazole, 5 mm β‐mercaptoethanol, 1% (v/v) Triton X‐100, and 5% (v/v) glycerol. Finally, recombinant proteins were eluted from the resin with LEW 1X buffer containing 250 mm imidazole and 5% (v/v) glycerol. Purified proteins were dialyzed twice for 4 h at 4 °C with agitation against 50 mm Tris/HCl pH 7.4 buffer containing 150 mm NaCl, 10 mm MgCl₂, 0.5 mm DTT, and 5% (v/v) glycerol. Dialyzed proteins were frozen in liquid N₂ and stored at −72 °C.

Purification of GST tag‐containing proteins was performed using a glutathione agarose (GE) resin according to the manufacturer's instructions, while MBP‐CycD2;2 was purified with an amylose agarose resin (NEB, Ipswich, Massachusetts, United States) according to the manufacturer's instructions.

The amount of protein was estimated semiquantitatively as in Harashima & Schnittger [34] using BSA standards of 1000, 750, 500, 250 and 125 ng per lane. For image acquisition, a ChemiDoc was used (Bio‐Rad, Hercules, California, United States) and acrylamide gels were analyzed and quantified using the Image Lab software (Bio‐Rad).

Kinase activity assays

Kinase activity of CDKs or Wee1 was measured as reported previously [30]. Briefly, the indicated amount of every kinase was added to kinase buffer (50 mm Tris/HCl pH 7.4, 50 mm NaCl, 10 mm MgCl₂, 1 mm EGTA and 0.5 mm DTT), together with the indicated amount of substrate. A mixture of non‐labeled ATP and [γ³²P] ATP was added (Perkin Elmer, Waltham, Massachusetts, United States), and reactions were incubated at 30 °C for 30 min. Protein loading buffer was added [2% (w/v) SDS, 2 mm β‐mercaptoethanol, 4% (v/v) glycerol, 40 mm Tris/HCl pH 6.8, 0.005% (w/v) bromophenol blue] and reactions were incubated at 85 °C for 10 min. Proteins were separated in a 10% polyacrylamide gel with SDS (SDS/PAGE) and then were stained with Coomassie blue. Gels were dried and exposed to an Imaging K screen (Kodak, Rochester, New York, United States), that was developed in a Molecular Imager FX (Bio‐Rad). If instead of [γ³²P] ATP in reactions ATP‐γ‐S was used, reactions were prepared according to Allen et al., [69] with slight modifications, briefly, 200 μm ATP‐γ‐S was added to the mixture of kinase and substrate in kinase buffer, reactions were incubated for 15 min at 30 °C and were stopped by adding 20 mm EDTA. Proteins were alkylated with 0.3 mm p‐nitrobenzylmesilate (PNBM) for 1 h at room temperature and then were denatured and separated by SDS/PAGE; finally, proteins were transferred to PVDF membranes (Millipore, Burlington, Massachusetts, United States) to detect the thiophosphate ester in the phosphorylated substrates by western blot.

Western blot

Proteins in purification fractions, in the purification eluates or after kinase activity assays with ATP‐γ‐S, were separated in 10% polyacrylamide gels by SDS/PAGE, then were transferred to PVDF membranes through a wet blotting system (Bio‐Rad) according to the manufacturer's instructions. For detection of CDKs, GST tag or MBP tag, membranes were blocked with 10% (w/v) skimmed milk in 1X PBS (300 mm NaCl, 4.3 mm Na₂HPO₄, 1.47 mm KH₂PO₄, 2.7 mm KCl, pH 7.4) containing Tween‐20 (0.2% v/v). A 1 : 30 000 dilution of antibody against the PSTAIRE sequence (sc‐53; Santa Cruz Biotechnology, Dallas, Texas, United States), conserved in A‐type CDKs of maize (Fig. 7), was used to identify CDKA2;1a, while a 1 : 3000 dilution of antibody against the PSTAIRE sequence was used to identify PPLTARE sequence conserved in maize CDKB1;1 (Fig. 7). Antibodies against MBP (E8032S; NEB) and GST (sc‐459; Santa Cruz) were used at 1 : 50 000 and 1 : 30 000 dilutions respectively. Antibodies were dissolved in 1X PBS containing 0.2% (v/v) Tween‐20. The thiophosphate ester in thiophosphorylated substrates was identified with anti‐thiophosphate ester antibody (ab92570; Abcam, Cambridge, United Kingdom) at a 1 : 20 000 dilution. For this antibody, membranes were treated as indicated by the manufacturer. Briefly, membranes were blocked with a solution of 5% (w/v) skimmed milk in 1X TBS (20 mm Tris, 20 mm NaCl, pH 7.4) with 0.05% (v/v) Tween‐20 and then were incubated with the primary antibody diluted in 1X TBS containing 0.05% (v/v) Tween‐20. For identifying phosphorylation of CDKs with the antibodies against pY15 of CDK1 (#9111; Cell signaling Technology, Danvers, Massachusetts, United States) or pT160 of CDK2 (sc‐101656; Santa Cruz Biotechnology), membranes were blocked with 1X PBS containing 0.2% (v/v) Tween‐20 and 30% (v/v) fetal bovine serum (FBS). In both cases, the primary antibody was diluted (1 : 5000) in 1X PBS with 0.2% (v/v) Tween‐20 and 30% (v/v) FBS. Membranes were incubated with the secondary anti‐rabbit antibody coupled to a peroxidase (sc‐2004; Santa Cruz Biotechnology) diluted in 1X PBS containing 0.2% (v/v) Tween‐20, except for membranes incubated with the anti‐thiophosphate antibody, for which the secondary antibody was diluted in 1X TBS with 0.05% (v/v) Tween‐20. Finally, membranes were incubated with Clarity Western ECL Blotting Substrate (Bio‐Rad) and images were acquired with a ChemiDoc (Bio‐Rad) using the Image Lab software (Bio‐Rad). If more than one protein was identified in membranes, after developing with the first antibody, the membranes were stripped according to Yeung & Stanley [70] and were probed with the second antibody.

In silico protein interactions

CDKA2;1a, CycD2;2a, and Wee1 structures were predicted by alphafold [71] through ColabFold implementation. Models with major interface Predicted Template Modeling (ipTM) and minor error in the interaction zone were selected. To correct steric collisions and optimize local geometry, the models were subjected to standard structural relaxation.

The partial unfolded conformation of Wee1 by alphafold was solved by accelerated molecular dynamics (aMD) with AMBER22 [72]. The system was prepared in implicit solvent using the force field ff14SB and the model GB‐Neck2 (igb = 8), followed by minimization and 1 ns equilibrium under Langevin thermic control. Then, a phase of production of 500 ns aMD was performed, using acceleration parameters calculated from a brief preliminary simulation of classical dynamics. An integration step of 2 fs, SHAKE restriction and the appropriate non‐linking cuts for the implicit model were applied. The trajectories were exported to xtc format for its analysis in GROMACS [73].

aMD was validated by the analysis of protein secondary structure evolution during a total trajectory of 500 ns. Previous to the analysis, the trajectories were aligned using the protein backbone to delete global rigid movements. The secondary structure assignation was performed with the DSSP algorithm [74]. DSSP analysis was applied to all simulation photograms.

Finally, the folded Wee1 model, CDKA2;1a and CycD2;2a structures predicted by alphafold [70] were used to predict associations. The interactions between Wee1‐CDKA2;1a and CycD2;2a‐CDKA2;1a were predicted in ClusPro [75]. CDKA2;1a was used as receptor, and Wee1 and CycD2;2a as ligands in a double‐blind rigid‐body docking. The models were selected from the most abundant cluster based on Root Mean Square Deviation (RMSD) and energy minimization.

Conflict of interest

The authors declare no conflict of interest.

Author contributions

MNL‐H and JMV‐R designed the research; JMV‐R and AL‐N supervised the project and secured the funding; MNL‐H, EDG‐M, and UM‐O performed experiments; MNL‐H, JMV‐R and AL‐N analyzed experiments and interpreted results; MNL‐H and JMV‐R wrote the manuscript; MNL‐H, JMV‐R and AL‐N commented, edited, and revised the manuscript.

Acknowledgements

We thank Dr. Elpidio García‐Ramírez for providing pGEX4T‐2*ZmCKS plasmid, technical assistance, discussion, and analysis of results; Dra. Rosario Muñoz Clares from Laboratorio de Estructura, Función y Evolución de Proteínas, Departamento de Bioquímica, Facultad de Química, UNAM for discussion and analysis of results; Dra. Adriana Garay Arroyo from Laboratorio de Genética Molecular, Desarrollo y Evolución de Plantas, Departamento de Ecología Funcional, Instituto de Ecología, UNAM for discussion and analysis of results.

This work was supported by Secihti Grant CB220661, PAPIIT‐UNAM grants IN215316, IN201322, IN211423, and IN205219, PAIP‐UNAM. MNLH received Secihti PhD grant 720345.

Data availability statement

The data that support the findings of this study are available from the corresponding author (jorman@unam.mx) upon reasonable request.

References

1. Morgan DO (2007) The Cell Cycle: Principles of Control. New Science Press, London. [Google Scholar]
2. Gu Y, Rosenblatt J & Morgan DO (1992) Cell cycle regulation of CDK2 activity by phosphorylation of Thr160 and Tyr15. EMBO J 11, 3995–4005. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Solomon MJ, Lee T & Kirschner MW (1992) Role of phosphorylation in p34cdc2 activation: identification of an activating kinase. Mol Biol Cell 3, 13–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Poon RY, Yamashita K, Adamczewski JP, Hunt T & Shuttleworth J (1993) The cdc2‐related protein p40MO15 is the catalytic subunit of a protein kinase that can activate p33cdk2 and p34cdc2. EMBO J 12, 3123–3132. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Morgan DO (1995) Principles of CDK regulation. Nature 374, 131–134. [DOI] [PubMed] [Google Scholar]
6. Nurse P (1975) Genetic control of cell size at cell division in yeast. Nature 256, 547–551. [DOI] [PubMed] [Google Scholar]
7. Igarashi M, Nagata A, Jinno S, Suto K & Okayama H (1991) Wee1(+)‐like gene in human cells. Nature 353, 80–83. [DOI] [PubMed] [Google Scholar]
8. Campbell SD, Sprenger F, Edgar BA & O'Farrell PH (1995) Drosophila Wee1 kinase rescues fission yeast from mitotic catastrophe and phosphorylates drosophila Cdc2 in vitro. Mol Biol Cell 6, 1333–1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Mueller PR, Coleman TR & Dunphy WG (1995) Cell cycle regulation of a xenopus Wee1‐like kinase. Mol Biol Cell 6, 119–134. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Sun Y, Dilkes BP, Zhang C, Dante RA, Carneiro NP, Lowe KS, Jung R, Gordon‐Kamm WJ & Larkins BA (1999) Characterization of maize (Zea mays L.) Wee1 and its activity in developing endosperm. Proc Natl Acad Sci USA 96, 4180–4185. [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Sorrell DA, Marchbank A, McMahon K, Dickinson JR, Rogers HJ & Francis D (2002) A WEE1 homologue from Arabidopsis thaliana . Planta 215, 518–522. [DOI] [PubMed] [Google Scholar]
12. Gonzalez N, Hernould M, Delmas F, Gévaudant F, Duffe P, Causse M et al. (2004) Molecular characterization of a WEE1 gene homologue in tomato (Lycopersicon esculentum mill.). Plant Mol Biol 56, 849–861. [DOI] [PubMed] [Google Scholar]
13. Mueller PR, Coleman TR, Kumagai A & Dunphy WG (1995) Myt1: a membrane‐associated inhibitory kinase that phosphorylates Cdc2 on both threonine‐14 and tyrosine‐15. Science 270, 86–90. [DOI] [PubMed] [Google Scholar]
14. Liu F, Stanton JJ, Wu Z & Piwnica‐Worms H (1997) The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex. Mol Cell Biol 17, 571–583. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Welburn JPI, Tucker JA, Johnson T, Lindert L, Morgan M, Willis A, Noble MEM & Endicott JA (2007) How tyrosine 15 phosphorylation inhibits the activity of cyclin‐dependent kinase 2‐cyclin a. J Biol Chem 282, 3173–3181. [DOI] [PubMed] [Google Scholar]
16. Krek W & Nigg EA (1991) Mutations of p34cdc2 phosphorylation sites induce premature mitotic events in HeLa cells: evidence for a double block to p34cdc2 kinase activation in vertebrates. EMBO J 10, 3331–3341. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Lundgren K, Walworth N, Booher R, Dembski M, Kirschner M & Beach D (1991) Mik1 and wee1 cooperate in the inhibitory tyrosine phosphorylation of cdc2. Cell 64, 1111–1122. [DOI] [PubMed] [Google Scholar]
18. Matsuoka S, Huang M & Elledge SJ (1998) Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science 282, 1893–1897. [DOI] [PubMed] [Google Scholar]
19. Do K, Doroshow JH & Kummar S (2013) Wee1 kinase as a target for cancer therapy. Cell Cycle 12, 3159–3164. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Dewitte W & Murray JAH (2003) The plant cell cycle. Annu Rev Plant Biol 54, 235–264. [DOI] [PubMed] [Google Scholar]
21. Inzé D & De Veylder L (2006) Cell cycle regulation in plant development. Annu Rev Genet 40, 77–105. [DOI] [PubMed] [Google Scholar]
22. Dudits D, Cserhti M, Miskolczi P & Horvth GV (2007) The growing family of plant cyclin‐dependent kinases with multiple functions in cellular and developmental regulation. In En: Cell Cycle Control and Plant Developmentpp. 1–30. Blackwell Publishing Ltd, Oxford, UK. [Google Scholar]
23. Reichheld J‐P, Vernoux T, Lardon F, Van Montagu M & Inzé D (1999) Specific checkpoints regulate plant cell cycle progression in response to oxidative stress. Plant J 17, 647–656. [Google Scholar]
24. Menges M & Murray JAH (2002) Synchronous Arabidopsis suspension cultures for analysis of cell‐cycle gene activity. Plant J 30, 203–212. [DOI] [PubMed] [Google Scholar]
25. Boudolf V, Barrôco R, Engler J d A, Verkest A, Beeckman T, Naudts M, Engler JA, Inzé D & de Veylder L (2004) B1‐type cyclin‐dependent kinases are essential for the formation of stomatal complexes in Arabidopsis thaliana . Plant Cell 16, 945–955. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Boudolf V, Lammens T, Boruc J, Van Leene J, Van Den Daele H, Maes S et al. (2009) CDKB1;1 forms a functional complex with CYCA2;3 to suppress endocycle onset. Plant Physiol 150, 1482–1493. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Kono A, Umeda‐Hara C, Lee J, Ito M, Uchimiya H & Umeda M (2003) Arabidopsis D‐type cyclin CYCD4;1 is a novel cyclin partner of B2‐type cyclin‐dependent kinase. Plant Physiol 132, 1315–1321. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Kawamura K, Murray JAH, Shinmyo A & Sekine M (2006) Cell cycle regulated D3‐type cyclins form active complexes with plant‐specific B‐type cyclin‐dependent kinase in vitro. Plant Mol Biol 61, 311–327. [DOI] [PubMed] [Google Scholar]
29. Godínez‐Palma SK, García E, Sánchez M d l P, Rosas F & Vázquez‐Ramos JM (2013) Complexes of D‐type cyclins with CDKs during maize germination. J Exp Bot 64, 5661–5671. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. López‐Hernández MN & Vázquez‐Ramos JM (2023) Maize CDKA2;1a and CDKB1;1 kinases have different requirements for their activation and participate in substrate recognition. FEBS J 290, 2463–2488. [DOI] [PubMed] [Google Scholar]
31. Schnittger A, Schöbinger U, Bouyer D, Weinl C, Stierhof Y‐D & Hülskamp M (2002) Ectopic D‐type cyclin expression induces not only DNA replication but also cell division in Arabidopsis trichomes. Proc Natl Acad Sci USA 99, 6410–6415. [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Koroleva OA, Tomlinson M, Parinyapong P, Sakvarelidze L, Leader D, Shaw P & Doonan JH (2004) CycD1, a putative G1 cyclin from Antirrhinum majus, accelerates the cell cycle in cultured tobacco BY‐2 cells by enhancing both G1/S entry and progression through S and G2 phases. Plant Cell 16, 2364–2379. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Harashima H, Shinmyo A & Sekine M (2007) Phosphorylation of threonine 161 in plant cyclin‐dependent kinase a is required for cell division by activation of its associated kinase: phosphorylation of T161 is required for CDKA activation. Plant J 52, 435–448. [DOI] [PubMed] [Google Scholar]
34. Harashima H & Schnittger A (2012) Robust reconstitution of active cell‐cycle control complexes from co‐expressed proteins in bacteria. Plant Methods 8, 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. De Schutter K, Joubès J, Cools T, Verkest A, Corellou F, Babiychuk E et al. (2007) Arabidopsis WEE1 kinase controls cell cycle arrest in response to activation of the DNA integrity checkpoint. Plant Cell 19, 211–225. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Gonzalez N, Gévaudant F, Hernould M, Chevalier C & Mouras A (2007) The cell cycle‐associated protein kinase WEE1 regulates cell size in relation to endoreduplication in developing tomato fruit: WEE1 and cell size control in tomato. Plant J 51, 642–655. [DOI] [PubMed] [Google Scholar]
37. Dissmeyer N, Weimer AK, De Veylder L, Novak B & Schnittger A (2010) The regulatory network of cell‐cycle progression is fundamentally different in plants versus yeast or metazoans. Plant Signal Behav 5, 1613–1618. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Godínez‐Palma SK (2015) Regulación de los complejos ciclinas D‐CDKs durante la germinación de maíz. PhD thesis, Universidad Nacional Autónoma de México: México.
39. Levine AJ & Oren M (2009) The first 30 years of p53: growing ever more complex. Nat Rev Cancer 9, 749–758. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Katayama K, Fujita N & Tsuruo T (2005) Akt/protein kinase B‐dependent phosphorylation and inactivation of WEE1Hu promote cell cycle progression at G2/M transition. Mol Cell Biol 25, 5725–5737. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Murakami MS, Copeland TD & Vande Woude GF (1999) Mos positively regulates Xe‐Wee1 to lengthen the first mitotic cell cycle of xenopus. Genes Dev 13, 620–631. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Hinds PW, Mittnacht S, Dulic V, Arnold A, Reed SI & Weinberg RA (1992) Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell 70, 993–1006. [DOI] [PubMed] [Google Scholar]
43. Boniotti MB & Gutierrez C (2001) A cell‐cycle‐regulated kinase activity phosphorylates plant retinoblastoma protein and contains, in Arabidopsis, a CDKA/cyclin D complex: phosphorylation of plant retinoblastoma protein. Plant J 28, 341–350. [DOI] [PubMed] [Google Scholar]
44. McGowan CH & Russell P (1993) Human Wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr15. EMBO J 12, 75–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
45. McMillan JN, Sia RA, Bardes ES & Lew DJ (1999) Phosphorylation‐independent inhibition of Cdc28p by the tyrosine kinase Swe1p in the morphogenesis checkpoint. Mol Cell Biol 19, 5981–5990. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Squire CJ, Dickson JM, Ivanovic I & Baker EN (2005) Structure and inhibition of the human cell cycle checkpoint kinase, Wee1A kinase: an atypical tyrosine kinase with a key role in CDK1 regulation. Structure 13, 541–550. [DOI] [PubMed] [Google Scholar]
47. Honda R, Ohba Y & Yasuda H (1992) The cell cycle regulator, human p50weel, is a tyrosine kinase and not a serine/tyrosine kinase. Biochem Biophys Res Commun 186, 1333–1338. [DOI] [PubMed] [Google Scholar]
48. Parker LL, Atherton‐Fessler S & Piwnica‐Worms H (1992) P107wee1 is a dual‐specificity kinase that phosphorylates p34cdc2 on tyrosine 15. Proc Natl Acad Sci USA 89, 2917–2921. [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Booher RN, Holman PS & Fattaey A (1997) Human Myt1 is a cell cycle‐regulated kinase that inhibits Cdc2 but not Cdk2 activity. J Biol Chem 272, 22300–22306. [DOI] [PubMed] [Google Scholar]
50. Wood DJ & Endicott JA (2018) Structural insights into the functional diversity of the CDK‐cyclin family. Open Biol 8, 180112. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Pan ZQ, Amin A & Hurwitz J (1993) Characterization of the in vitro reconstituted cyclin a or B1‐dependent cdk2 and cdc2 kinase activities. J Biol Chem 268, 20443–20451. [PubMed] [Google Scholar]
52. Oakenfull EA, Riou‐Khamlichi C & Murray JAH (2002) Plant D‐type cyclins and the control of G1 progression. Philos Trans R Soc Lond Ser B Biol Sci 357, 749–760. [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Buendía‐Monreal M, Rentería‐Canett I, Guerrero‐Andrade O, Bravo‐Alberto CE, Martínez‐Castilla LP, García E & Vázquez‐Ramos JM (2011) The family of maize D‐type cyclins: genomic organization, phylogeny and expression patterns. Physiol Plant 143, 297–308. [DOI] [PubMed] [Google Scholar]
54. Lehti‐Shiu MD & Shiu S‐H (2012) Diversity, classification and function of the plant protein kinase superfamily. Philos Trans R Soc Lond Ser B Biol Sci 367, 2619–2639. [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Dissmeyer N, Weimer AK, Pusch S, De Schutter K, Alvim Kamei CL, Nowack MK et al. (2009) Control of cell proliferation, organ growth, and DNA damage response operate independently of dephosphorylation of the Arabidopsis Cdk1 homolog CDKA;1. Plant Cell 21, 3641–3654. [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Harvey SL, Charlet A, Haas W, Gygi SP & Kellogg DR (2005) Cdk1‐dependent regulation of the mitotic inhibitor Wee1. Cell 122, 407–420. [DOI] [PubMed] [Google Scholar]
57. LaBaer J, Garrett MD, Stevenson LF, Slingerland JM, Sandhu C, Chou HS, Fattaey A & Harlow E (1997) New functional activities for the p21 family of CDK inhibitors. Genes Dev 11, 847–862. [DOI] [PubMed] [Google Scholar]
58. Grafi G & Larkins BA (1995) Endoreduplication in maize endosperm: involvement of m phase‐‐promoting factor inhibition and induction of s phase – related kinases. Science 269, 1262–1264. [DOI] [PubMed] [Google Scholar]
59. Siciliano I, Lentz Grønlund A, Ševčíková H, Spadafora ND, Rafiei G, Francis D, Herbert RJ, Bitonti MB, Rogers HJ & Lipavská H (2019) Expression of Arabidopsis WEE1 in tobacco induces unexpected morphological and developmental changes. Sci Rep 9, 8695. [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Détain A, Redecker D, Leborgne‐Castel N & Ochatt S (2021) Structural conservation of WEE1 and its role in cell cycle regulation in plants. Sci Rep 11, 23862. [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Parker LL, Sylvestre PJ, Byrnes MJ 3rd, Liu F & Piwnica‐Worms H (1995) Identification of a 95‐kDa WEE1‐like tyrosine kinase in HeLa cells. Proc Natl Acad Sci USA 92, 9638–9642. [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Shimotohno A, Ohno R, Bisova K, Sakaguchi N, Huang J, Koncz C et al. (2006) Diverse phosphoregulatory mechanisms controlling cyclin‐dependent kinase‐activating kinases in Arabidopsis: regulation of CDK‐activating kinases. Plant J 47, 701–710. [DOI] [PubMed] [Google Scholar]
63. Matheson CJ, Backos DS & Reigan P (2016) Targeting WEE1 kinase in cancer. Trends Pharmacol Sci 37, 872–881. [DOI] [PubMed] [Google Scholar]
64. Perry JA & Kornbluth S (2007) Cdc25 and Wee1: analogous opposites? Cell Div 2, 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
65. López‐Hernández MN, Guerrero‐Molina ED, Romero‐Rodríguez S & Vázquez‐Ramos JM (2024) Función y regulación del modulador negativo del ciclo celular Wee1, una visión histórica y avances más recientes. Rev Educ Bioquim 43, 245–265. [Google Scholar]
66. Bray D & Lay S (1997) Computer‐based analysis of the binding steps in protein complex formation. Proc Natl Acad Sci USA 94, 13493–13498. [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Liu H & Naismith JH (2008) An efficient one‐step site‐directed deletion, insertion, single and multiple‐site plasmid mutagenesis protocol. BMC Biotechnol 8, 91. [DOI] [PMC free article] [PubMed] [Google Scholar]
68. Zamora‐Zaragoza J (2014) Caracterización de la ciclina CycD6;1 de maíz y sus interacciones con otros reguladores del ciclo celular. MSc thesis, Universidad Nacional Autónoma de México: México.
69. Allen JJ, Li M, Brinkworth CS, Paulson JL, Wang D, Hübner A, Chou WH, Davis RJ, Burlingame AL, Messing RO et al. (2007) A semisynthetic epitope for kinase substrates. Nat Methods 4, 511–516. [DOI] [PMC free article] [PubMed] [Google Scholar]
70. Yeung Y‐G & Stanley ER (2009) A solution for stripping antibodies from polyvinylidene fluoride immunoblots for multiple reprobing. Anal Biochem 389, 89–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
71. Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Žídek A, Potapenko A et al. (2021) Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589. [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Case DA, Aktulga HM, Belfon K, Cerutti DS, Cisneros GA, Cruzeiro VWD, Forouzesh N, Giese TJ, Götz AW, Gohlke H et al. (2023) AmberTools. J Chem Inf Model 63, 6183–6191. [DOI] [PMC free article] [PubMed] [Google Scholar]
73. Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE & Berendsen HJC (2005) GROMACS: fast, flexible, and free. J Comput Chem 26, 1701–1718. [DOI] [PubMed] [Google Scholar]
74. Touw WG, Baakman C, Black J, te Beek TAH, Krieger E, Joosten RP et al. (2015) A series of PDB‐related databanks for everyday needs. Nucleic Acids Res 43, D364–D368. [DOI] [PMC free article] [PubMed] [Google Scholar]
75. Kozakov D, Hall DR, Xia B, Porter KA, Padhorny D, Yueh C, Beglov D & Vajda S (2017) The ClusPro web server for protein‐protein docking. Nat Protoc 12, 255–278. [DOI] [PMC free article] [PubMed] [Google Scholar]
76. Hall TA (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser 41, 95–98. [Google Scholar]
77. Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
78. The PyMOL molecular graphics System. Version 3.0 Schrödinger, LLC. https://www.pymol.org/support.html

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author (jorman@unam.mx) upon reasonable request.

[febs70594-bib-0001] 1. Morgan DO (2007) The Cell Cycle: Principles of Control. New Science Press, London. [Google Scholar]

[febs70594-bib-0002] 2. Gu Y, Rosenblatt J & Morgan DO (1992) Cell cycle regulation of CDK2 activity by phosphorylation of Thr160 and Tyr15. EMBO J 11, 3995–4005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0003] 3. Solomon MJ, Lee T & Kirschner MW (1992) Role of phosphorylation in p34cdc2 activation: identification of an activating kinase. Mol Biol Cell 3, 13–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0004] 4. Poon RY, Yamashita K, Adamczewski JP, Hunt T & Shuttleworth J (1993) The cdc2‐related protein p40MO15 is the catalytic subunit of a protein kinase that can activate p33cdk2 and p34cdc2. EMBO J 12, 3123–3132. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0005] 5. Morgan DO (1995) Principles of CDK regulation. Nature 374, 131–134. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0006] 6. Nurse P (1975) Genetic control of cell size at cell division in yeast. Nature 256, 547–551. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0007] 7. Igarashi M, Nagata A, Jinno S, Suto K & Okayama H (1991) Wee1(+)‐like gene in human cells. Nature 353, 80–83. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0008] 8. Campbell SD, Sprenger F, Edgar BA & O'Farrell PH (1995) Drosophila Wee1 kinase rescues fission yeast from mitotic catastrophe and phosphorylates drosophila Cdc2 in vitro. Mol Biol Cell 6, 1333–1347. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0009] 9. Mueller PR, Coleman TR & Dunphy WG (1995) Cell cycle regulation of a xenopus Wee1‐like kinase. Mol Biol Cell 6, 119–134. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0010] 10. Sun Y, Dilkes BP, Zhang C, Dante RA, Carneiro NP, Lowe KS, Jung R, Gordon‐Kamm WJ & Larkins BA (1999) Characterization of maize (Zea mays L.) Wee1 and its activity in developing endosperm. Proc Natl Acad Sci USA 96, 4180–4185. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0011] 11. Sorrell DA, Marchbank A, McMahon K, Dickinson JR, Rogers HJ & Francis D (2002) A WEE1 homologue from Arabidopsis thaliana . Planta 215, 518–522. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0012] 12. Gonzalez N, Hernould M, Delmas F, Gévaudant F, Duffe P, Causse M et al. (2004) Molecular characterization of a WEE1 gene homologue in tomato (Lycopersicon esculentum mill.). Plant Mol Biol 56, 849–861. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0013] 13. Mueller PR, Coleman TR, Kumagai A & Dunphy WG (1995) Myt1: a membrane‐associated inhibitory kinase that phosphorylates Cdc2 on both threonine‐14 and tyrosine‐15. Science 270, 86–90. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0014] 14. Liu F, Stanton JJ, Wu Z & Piwnica‐Worms H (1997) The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex. Mol Cell Biol 17, 571–583. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0015] 15. Welburn JPI, Tucker JA, Johnson T, Lindert L, Morgan M, Willis A, Noble MEM & Endicott JA (2007) How tyrosine 15 phosphorylation inhibits the activity of cyclin‐dependent kinase 2‐cyclin a. J Biol Chem 282, 3173–3181. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0016] 16. Krek W & Nigg EA (1991) Mutations of p34cdc2 phosphorylation sites induce premature mitotic events in HeLa cells: evidence for a double block to p34cdc2 kinase activation in vertebrates. EMBO J 10, 3331–3341. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0017] 17. Lundgren K, Walworth N, Booher R, Dembski M, Kirschner M & Beach D (1991) Mik1 and wee1 cooperate in the inhibitory tyrosine phosphorylation of cdc2. Cell 64, 1111–1122. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0018] 18. Matsuoka S, Huang M & Elledge SJ (1998) Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science 282, 1893–1897. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0019] 19. Do K, Doroshow JH & Kummar S (2013) Wee1 kinase as a target for cancer therapy. Cell Cycle 12, 3159–3164. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0020] 20. Dewitte W & Murray JAH (2003) The plant cell cycle. Annu Rev Plant Biol 54, 235–264. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0021] 21. Inzé D & De Veylder L (2006) Cell cycle regulation in plant development. Annu Rev Genet 40, 77–105. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0022] 22. Dudits D, Cserhti M, Miskolczi P & Horvth GV (2007) The growing family of plant cyclin‐dependent kinases with multiple functions in cellular and developmental regulation. In En: Cell Cycle Control and Plant Developmentpp. 1–30. Blackwell Publishing Ltd, Oxford, UK. [Google Scholar]

[febs70594-bib-0023] 23. Reichheld J‐P, Vernoux T, Lardon F, Van Montagu M & Inzé D (1999) Specific checkpoints regulate plant cell cycle progression in response to oxidative stress. Plant J 17, 647–656. [Google Scholar]

[febs70594-bib-0024] 24. Menges M & Murray JAH (2002) Synchronous Arabidopsis suspension cultures for analysis of cell‐cycle gene activity. Plant J 30, 203–212. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0025] 25. Boudolf V, Barrôco R, Engler J d A, Verkest A, Beeckman T, Naudts M, Engler JA, Inzé D & de Veylder L (2004) B1‐type cyclin‐dependent kinases are essential for the formation of stomatal complexes in Arabidopsis thaliana . Plant Cell 16, 945–955. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0026] 26. Boudolf V, Lammens T, Boruc J, Van Leene J, Van Den Daele H, Maes S et al. (2009) CDKB1;1 forms a functional complex with CYCA2;3 to suppress endocycle onset. Plant Physiol 150, 1482–1493. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0027] 27. Kono A, Umeda‐Hara C, Lee J, Ito M, Uchimiya H & Umeda M (2003) Arabidopsis D‐type cyclin CYCD4;1 is a novel cyclin partner of B2‐type cyclin‐dependent kinase. Plant Physiol 132, 1315–1321. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0028] 28. Kawamura K, Murray JAH, Shinmyo A & Sekine M (2006) Cell cycle regulated D3‐type cyclins form active complexes with plant‐specific B‐type cyclin‐dependent kinase in vitro. Plant Mol Biol 61, 311–327. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0029] 29. Godínez‐Palma SK, García E, Sánchez M d l P, Rosas F & Vázquez‐Ramos JM (2013) Complexes of D‐type cyclins with CDKs during maize germination. J Exp Bot 64, 5661–5671. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0030] 30. López‐Hernández MN & Vázquez‐Ramos JM (2023) Maize CDKA2;1a and CDKB1;1 kinases have different requirements for their activation and participate in substrate recognition. FEBS J 290, 2463–2488. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0031] 31. Schnittger A, Schöbinger U, Bouyer D, Weinl C, Stierhof Y‐D & Hülskamp M (2002) Ectopic D‐type cyclin expression induces not only DNA replication but also cell division in Arabidopsis trichomes. Proc Natl Acad Sci USA 99, 6410–6415. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0032] 32. Koroleva OA, Tomlinson M, Parinyapong P, Sakvarelidze L, Leader D, Shaw P & Doonan JH (2004) CycD1, a putative G1 cyclin from Antirrhinum majus, accelerates the cell cycle in cultured tobacco BY‐2 cells by enhancing both G1/S entry and progression through S and G2 phases. Plant Cell 16, 2364–2379. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0033] 33. Harashima H, Shinmyo A & Sekine M (2007) Phosphorylation of threonine 161 in plant cyclin‐dependent kinase a is required for cell division by activation of its associated kinase: phosphorylation of T161 is required for CDKA activation. Plant J 52, 435–448. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0034] 34. Harashima H & Schnittger A (2012) Robust reconstitution of active cell‐cycle control complexes from co‐expressed proteins in bacteria. Plant Methods 8, 23. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0035] 35. De Schutter K, Joubès J, Cools T, Verkest A, Corellou F, Babiychuk E et al. (2007) Arabidopsis WEE1 kinase controls cell cycle arrest in response to activation of the DNA integrity checkpoint. Plant Cell 19, 211–225. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0036] 36. Gonzalez N, Gévaudant F, Hernould M, Chevalier C & Mouras A (2007) The cell cycle‐associated protein kinase WEE1 regulates cell size in relation to endoreduplication in developing tomato fruit: WEE1 and cell size control in tomato. Plant J 51, 642–655. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0037] 37. Dissmeyer N, Weimer AK, De Veylder L, Novak B & Schnittger A (2010) The regulatory network of cell‐cycle progression is fundamentally different in plants versus yeast or metazoans. Plant Signal Behav 5, 1613–1618. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0038] 38. Godínez‐Palma SK (2015) Regulación de los complejos ciclinas D‐CDKs durante la germinación de maíz. PhD thesis, Universidad Nacional Autónoma de México: México.

[febs70594-bib-0039] 39. Levine AJ & Oren M (2009) The first 30 years of p53: growing ever more complex. Nat Rev Cancer 9, 749–758. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0040] 40. Katayama K, Fujita N & Tsuruo T (2005) Akt/protein kinase B‐dependent phosphorylation and inactivation of WEE1Hu promote cell cycle progression at G2/M transition. Mol Cell Biol 25, 5725–5737. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0041] 41. Murakami MS, Copeland TD & Vande Woude GF (1999) Mos positively regulates Xe‐Wee1 to lengthen the first mitotic cell cycle of xenopus. Genes Dev 13, 620–631. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0042] 42. Hinds PW, Mittnacht S, Dulic V, Arnold A, Reed SI & Weinberg RA (1992) Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell 70, 993–1006. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0043] 43. Boniotti MB & Gutierrez C (2001) A cell‐cycle‐regulated kinase activity phosphorylates plant retinoblastoma protein and contains, in Arabidopsis, a CDKA/cyclin D complex: phosphorylation of plant retinoblastoma protein. Plant J 28, 341–350. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0044] 44. McGowan CH & Russell P (1993) Human Wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr15. EMBO J 12, 75–85. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0045] 45. McMillan JN, Sia RA, Bardes ES & Lew DJ (1999) Phosphorylation‐independent inhibition of Cdc28p by the tyrosine kinase Swe1p in the morphogenesis checkpoint. Mol Cell Biol 19, 5981–5990. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0046] 46. Squire CJ, Dickson JM, Ivanovic I & Baker EN (2005) Structure and inhibition of the human cell cycle checkpoint kinase, Wee1A kinase: an atypical tyrosine kinase with a key role in CDK1 regulation. Structure 13, 541–550. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0047] 47. Honda R, Ohba Y & Yasuda H (1992) The cell cycle regulator, human p50weel, is a tyrosine kinase and not a serine/tyrosine kinase. Biochem Biophys Res Commun 186, 1333–1338. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0048] 48. Parker LL, Atherton‐Fessler S & Piwnica‐Worms H (1992) P107wee1 is a dual‐specificity kinase that phosphorylates p34cdc2 on tyrosine 15. Proc Natl Acad Sci USA 89, 2917–2921. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0049] 49. Booher RN, Holman PS & Fattaey A (1997) Human Myt1 is a cell cycle‐regulated kinase that inhibits Cdc2 but not Cdk2 activity. J Biol Chem 272, 22300–22306. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0050] 50. Wood DJ & Endicott JA (2018) Structural insights into the functional diversity of the CDK‐cyclin family. Open Biol 8, 180112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0051] 51. Pan ZQ, Amin A & Hurwitz J (1993) Characterization of the in vitro reconstituted cyclin a or B1‐dependent cdk2 and cdc2 kinase activities. J Biol Chem 268, 20443–20451. [PubMed] [Google Scholar]

[febs70594-bib-0052] 52. Oakenfull EA, Riou‐Khamlichi C & Murray JAH (2002) Plant D‐type cyclins and the control of G1 progression. Philos Trans R Soc Lond Ser B Biol Sci 357, 749–760. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0053] 53. Buendía‐Monreal M, Rentería‐Canett I, Guerrero‐Andrade O, Bravo‐Alberto CE, Martínez‐Castilla LP, García E & Vázquez‐Ramos JM (2011) The family of maize D‐type cyclins: genomic organization, phylogeny and expression patterns. Physiol Plant 143, 297–308. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0054] 54. Lehti‐Shiu MD & Shiu S‐H (2012) Diversity, classification and function of the plant protein kinase superfamily. Philos Trans R Soc Lond Ser B Biol Sci 367, 2619–2639. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0055] 55. Dissmeyer N, Weimer AK, Pusch S, De Schutter K, Alvim Kamei CL, Nowack MK et al. (2009) Control of cell proliferation, organ growth, and DNA damage response operate independently of dephosphorylation of the Arabidopsis Cdk1 homolog CDKA;1. Plant Cell 21, 3641–3654. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0056] 56. Harvey SL, Charlet A, Haas W, Gygi SP & Kellogg DR (2005) Cdk1‐dependent regulation of the mitotic inhibitor Wee1. Cell 122, 407–420. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0057] 57. LaBaer J, Garrett MD, Stevenson LF, Slingerland JM, Sandhu C, Chou HS, Fattaey A & Harlow E (1997) New functional activities for the p21 family of CDK inhibitors. Genes Dev 11, 847–862. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0058] 58. Grafi G & Larkins BA (1995) Endoreduplication in maize endosperm: involvement of m phase‐‐promoting factor inhibition and induction of s phase – related kinases. Science 269, 1262–1264. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0059] 59. Siciliano I, Lentz Grønlund A, Ševčíková H, Spadafora ND, Rafiei G, Francis D, Herbert RJ, Bitonti MB, Rogers HJ & Lipavská H (2019) Expression of Arabidopsis WEE1 in tobacco induces unexpected morphological and developmental changes. Sci Rep 9, 8695. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0060] 60. Détain A, Redecker D, Leborgne‐Castel N & Ochatt S (2021) Structural conservation of WEE1 and its role in cell cycle regulation in plants. Sci Rep 11, 23862. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0061] 61. Parker LL, Sylvestre PJ, Byrnes MJ 3rd, Liu F & Piwnica‐Worms H (1995) Identification of a 95‐kDa WEE1‐like tyrosine kinase in HeLa cells. Proc Natl Acad Sci USA 92, 9638–9642. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0062] 62. Shimotohno A, Ohno R, Bisova K, Sakaguchi N, Huang J, Koncz C et al. (2006) Diverse phosphoregulatory mechanisms controlling cyclin‐dependent kinase‐activating kinases in Arabidopsis: regulation of CDK‐activating kinases. Plant J 47, 701–710. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0063] 63. Matheson CJ, Backos DS & Reigan P (2016) Targeting WEE1 kinase in cancer. Trends Pharmacol Sci 37, 872–881. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0064] 64. Perry JA & Kornbluth S (2007) Cdc25 and Wee1: analogous opposites? Cell Div 2, 12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0065] 65. López‐Hernández MN, Guerrero‐Molina ED, Romero‐Rodríguez S & Vázquez‐Ramos JM (2024) Función y regulación del modulador negativo del ciclo celular Wee1, una visión histórica y avances más recientes. Rev Educ Bioquim 43, 245–265. [Google Scholar]

[febs70594-bib-0066] 66. Bray D & Lay S (1997) Computer‐based analysis of the binding steps in protein complex formation. Proc Natl Acad Sci USA 94, 13493–13498. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0067] 67. Liu H & Naismith JH (2008) An efficient one‐step site‐directed deletion, insertion, single and multiple‐site plasmid mutagenesis protocol. BMC Biotechnol 8, 91. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0068] 68. Zamora‐Zaragoza J (2014) Caracterización de la ciclina CycD6;1 de maíz y sus interacciones con otros reguladores del ciclo celular. MSc thesis, Universidad Nacional Autónoma de México: México.

[febs70594-bib-0069] 69. Allen JJ, Li M, Brinkworth CS, Paulson JL, Wang D, Hübner A, Chou WH, Davis RJ, Burlingame AL, Messing RO et al. (2007) A semisynthetic epitope for kinase substrates. Nat Methods 4, 511–516. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0070] 70. Yeung Y‐G & Stanley ER (2009) A solution for stripping antibodies from polyvinylidene fluoride immunoblots for multiple reprobing. Anal Biochem 389, 89–91. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0071] 71. Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Žídek A, Potapenko A et al. (2021) Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0072] 72. Case DA, Aktulga HM, Belfon K, Cerutti DS, Cisneros GA, Cruzeiro VWD, Forouzesh N, Giese TJ, Götz AW, Gohlke H et al. (2023) AmberTools. J Chem Inf Model 63, 6183–6191. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0073] 73. Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE & Berendsen HJC (2005) GROMACS: fast, flexible, and free. J Comput Chem 26, 1701–1718. [DOI] [PubMed] [Google Scholar]

[febs70594-bib-0074] 74. Touw WG, Baakman C, Black J, te Beek TAH, Krieger E, Joosten RP et al. (2015) A series of PDB‐related databanks for everyday needs. Nucleic Acids Res 43, D364–D368. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0075] 75. Kozakov D, Hall DR, Xia B, Porter KA, Padhorny D, Yueh C, Beglov D & Vajda S (2017) The ClusPro web server for protein‐protein docking. Nat Protoc 12, 255–278. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0076] 76. Hall TA (1999) BioEdit: a user‐friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser 41, 95–98. [Google Scholar]

[febs70594-bib-0077] 77. Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]

[febs70594-bib-0078] 78. The PyMOL molecular graphics System. Version 3.0 Schrödinger, LLC. https://www.pymol.org/support.html

PERMALINK

Wee1 kinase differentially regulates maize CDKA2;1a and CDKB1;1

Mingyar N López‐Hernández

Estefany D Guerrero‐Molina

Ulises Martínez‐Ortega

Aurora Lara‐Núñez

Jorge M Vázquez‐Ramos

Abstract

Abbreviations

Introduction

Results

Maize Wee1 is a 530 amino acids protein

Fig. 1.

Fig. 2.

Wee 1 inhibits kinase activity in maize CDKA2;1a/CycD2;2a complexes, independently of its kinase activity

Fig. 3.

Fig. 4.

Wee1 phosphorylates CDKA2;1a when co‐expressed

Fig. 5.

Fig. 6.

Fig. 7.

Wee1 differentially affects CDKA2;1a kinase activity

Fig. 8.

Wee1, independently of its kinase activity, inhibits CDKB1;1/CycD2;2a complex activity

Fig. 9.

Wee1 associates to, and phosphorylates, CDKB1;1

Fig. 10.

CDKB1;1 phosphorylation has a substrate‐dependent effect on kinase activity

Fig. 11.

Maize CDKs differentially affect Wee1

Fig. 12.

Discussion

Wee1 inhibitory activity

Fig. 13.

Wee1 activity on CDKB1;1

Regulation of Wee1 by CDKs

Materials and methods

Vectors for recombinant protein expression

Table 1.

Protein expression

Protein purification

Kinase activity assays

Western blot

In silico protein interactions

Conflict of interest

Author contributions

Acknowledgements

Data availability statement

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases