Skip to main content
NCBI home page
Science Advances logoLink to Science Advances
. 2026 Nov 4;12(45):eaeg5744. doi: 10.1126/sciadv.aeg5744

Self-charged toothbrush facilitates tooth healthcare maintenance

Yanhui Lu 1,†, Jia Song 1,2,3,†, Xiaopei Chi 2,4,†, Wenjing Li 4, Liping Wu 1, Yusi Guo 2,4, Qun Cui 1, Xiaona Zheng 1,2, Yunyang Bai 2,4, Boon Chin Heng 1,2, Xiaoyu Han 2,4, Xuehui Zhang 1,2,3,5,*, Xuliang Deng 2,3,4,*
PMCID: PMC13733809  PMID: 42981395

Abstract

Toothbrushes have undergone no substantive improvements beyond their mechanical function for about 1118 years to date. Conventional toothbrushes often fail to establish an antibacterial environment on the tooth surface, allowing bacteria to recover and recolonize. Here, we developed an innovative self-charged toothbrush that integrates daily tooth brushing with piezoelectric functionality, synergizing both optimal mechanical properties and stable electrical activity. The self-charged toothbrushes can generate reactive oxygen species to disrupt bacterial membrane integrity and diminish bacterial adhesion by combining static antibacterial inhibition through surface potential with dynamic piezoelectric stimulation. Clinical evaluation revealed that the localized piezoelectric stimulation of self-charged toothbrushes can mitigate plaque formation and gingival inflammation. Mechanistic studies further revealed that the self-charged toothbrushes induced oxidative damage to the oral pathogenic bacterial membranes, thereby impairing the ATP-binding cassette transporter pathway. Hence, this study developed a concept of piezoelectric PVDF toothbrushes that combine physical cleaning with sustained antibacterial effect, thus highlighting the potential of self-charged materials in advancing oral healthcare.

INTRODUCTION

Brushing teeth is the most widely used means of maintaining oral health on a daily basis. A toothbrush exerts localized mechanical cleaning of the tooth surface, thereby regularly controlling dental plaque and preserving oral hygiene (1–4). The history of the toothbrush can be traced back to the Tang Dynasty in China in the 10th century AD, and it has a history of about 1118 years to date (5, 6). From the use of bone-handled animal bristles in ancient times to the adoption of standardized nylon monofilaments in modern times, the improvement and evolution of toothbrushes have always revolved around enhancing mechanical friction efficiency and optimizing their form and mechanical structure (7–9). Although traditional toothbrush design has long focused on mechanical debridement, recent innovations have introduced antibacterial and ion-releasing variants as functional enhancements that extend beyond simple friction-based cleaning.

As a structurally complex biofilm, dental plaque is characterized by the presence of an extracellular polymeric substance matrix that protects the resident bacteria (10–13). This makes it difficult for conventional tooth brushing to completely remove oral pathogenic bacteria from deep layers and proximal areas through mechanical force and friction alone (14, 15). Moreover, conventional tooth brushing often fails to establish a lasting antibacterial environment on the tooth surface, allowing bacteria to rapidly recover and recolonize within hours after cleaning (16–18). This functional limitation in achieving local and sustained control of dental plaque highlights the necessity and potential value of developing a novel toothbrushing system that integrates efficient mechanical removal of dental plaque with long-lasting antibacterial effect. Oral cleaning tools with better cleaning performance have been developed, such as antibacterial toothbrushes and ionic toothbrushes (19, 20). The design of antibacterial toothbrush was typically based on the incorporation of chemical-based antibacterial agents (i.e., metal ions) into the toothbrush monofilament matrix, but the long-term stability of the antibacterial effect is not guaranteed (21, 22). Although ionic toothbrushes achieve cleaning functions through electric ions rather than just mechanical action, they rely on external batteries (23).

In response to the current technical bottlenecks in oral health care, we proposed a self-charged toothbrush monofilament design strategy based on the catalytic effects of piezoelectric materials by taking advantage of the common stress stimulation and ferroelectric-piezoelectric catalysis (Fig. 1) (24–26). The self-charged toothbrushes designed by polyvinylidene fluoride (PVDF) featured excellent therapeutic biological safety, optimized mechanical properties, and stable piezoelectric activity. It effectively inhibits bacterial adhesion through surface potential in the static state. Compared with existing conventional toothbrushes, when the self-charged toothbrush is flicked up and down during brushing, the monofilaments are stress-activated upon bending, achieving mechanical removal of dental plaque and also generating reactive oxygen species (ROS) through piezoelectric catalysis to destroy the bacterial membrane locally. These findings thus provide new insights into the tooth health care applications of piezoelectric materials for local dental plaque control strategies.

Fig. 1. Surface potential and piezo-catalytic effects for combating bacteria and enhancing tooth cleaning.

Fig. 1.

Open in a new tab

(A) Toothbrush monofilaments resist bacterial adhesion via their surface potential. (B) Proposed piezo-catalytic effect-based tooth cleaning method, whereby piezoelectric materials replace traditional nylon in the toothbrush to generate ROS via piezo-catalysis to enhance teeth cleaning. (C) P1: the original electrostatic balance state of the self-charged toothbrush; P2: the release of screening charges under compressive stress, which combine with water molecules to produce reactive species; P3: the modified electrostatic balance state under maximum compressive stress; P4: the adsorption of charges from the surrounding electrolyte under reduced compressive stress. The charges in the electrolyte with opposite polarity to the adsorbed charges will participate in the redox reaction to produce ROS.

RESULTS

Design, construction, and characterization of the self-charged PVDF monofilaments

Existing toothbrush designs are fundamentally limited to mechanical action for plaque removal. Hence, we engineered a self-charged PVDF-based monofilament to transcend this basic function. The design not only fulfills standard tooth brushing requirements but also leverages the piezoelectric effect to provide an on-demand antibacterial function during daily use. It was demonstrated that annealing treatment can effectively enhance the electrical properties of piezoelectric materials (27–29). Following the national standards of the People’s Republic of China (GB 19432-2013), PVDF monofilaments with diameters of 0.16 (PVDF-0.16) and 0.24 mm (PVDF-0.24) were fabricated through a melt spinning extrusion method, followed by annealing at 120°C and subsequent processing into toothbrushes via automated hair grafting (Fig. 2A). Scanning electron microscopy (SEM) images showed PVDF-0.16 and PVDF-0.24 exhibited a similar smooth surface as nylon monofilaments on the market (Nylon; 0.15 mm), without burrs (Fig. 2B). The monofilament bending recovery rates of PVDF-0.16 (78.40%) and PVDF-0.24 (83.33%) met the national standard requirement (60%) (Fig. 2C). In addition, mechanical tests showed that both PVDF monofilaments exhibited higher tensile strength and elastic modulus than nylon, with strength improving as diameter increased (Fig. 2D and fig. S1, A and B).

Fig. 2. Characterization of the physicochemical and electrical properties of the PVDF monofilaments.

Fig. 2.

Open in a new tab

(A) Schematic diagram of self-charged toothbrush preparation. (B) Representative SEM images of the PVDF monofilaments. (C) Quantitative analysis of monofilament bending recovery rate before simulated aging [n = 3, means ± SEM, ns, not significant, one-way analysis of variance (ANOVA)]. (D) Stress-strain curve of the toothbrush monofilaments. (E) XRD patterns of PVDF monofilaments with varying diameters. Peaks of the polar β-phase were marked with a frame. (F) Piezoelectric hysteresis loop of PVDF-0.24. (G) Output voltage of the PVDF monofilaments. (H) EPR spectra of free radicals •OH and i •O2− over different monofilaments. (I) Representative image of a self-charged toothbrush. (J) Quantitative analysis of gross bundle bending force (n = 5, means ± SEM, ****P < 0.0001, one-way ANOVA).

The characterization of piezoelectric properties comprehensively and rigorously confirmed the piezoelectric effects of self-charged PVDF monofilaments. A higher content of polar β-phase, as indicated by x-ray diffraction spectroscopy (XRD), was observed in the PVDF-0.24 versus the PVDF-0.16 group (Fig. 2E). Piezoresponse force microscopy demonstrated clear amplitude, phase signals, and local piezoelectric hysteresis loops in the self-charged PVDF monofilaments (Fig. 2F and fig. S1, C and D). In addition, the piezoelectric constant d33 (fig. S1E) and output voltage (Fig. 2G) were also significantly improved with the increase of monofilament diameter. As the reactive species of •OH and •O2− are necessary for piezo-catalysis effect, the generation of •OH and •O2− was verified by the electron paramagnetic resonance (EPR) technique and the signature peaks of both DMPO-•O2− (Fig. 2H, left) and DMPO-•OH (Fig. 2H, right) were detected. Moreover, PVDF is a ferroelectric material. As expected, the self-charged PVDF monofilaments exhibited stable surface potentials (fig. S1F). Subsequently, the self-charged PVDF monofilaments were automated to plant bristles to exercise the toothbrush function (Fig. 2I). Strength testing showed that the gross bundle bending force of toothbrushes with PVDF-0.16 and PVDF-0.24 was less than 6 N, which fitted within the category of soft bundle, and the gross bundle tension of both types of self-charged toothbrushes was greater than 15 N, in line with national standards (Fig. 2J and fig. S1G). These results thus demonstrated that we successfully fabricated self-charged toothbrushes with good piezoelectric and mechanical properties.

A good toothbrush should display some durability and retain its function during regular use (30). Therefore, durability was evaluated through simulated three-month use (fig. S2A). SEM showed that the PVDF monofilaments remained intact with minimal burring, unlike nylon filaments, which developed obvious burrs (fig. S2, B and C). Meanwhile, tooth surface roughness was examined, and the results showed that there were no substantial changes in the PVDF-0.16 and PVDF-0.24 groups. Tooth surface roughness did not increase significantly after brushing with PVDF brushes, indicating no damage to enamel integrity (fig. S2, D to F). In addition, the normal functioning of self-charged toothbrushes also depends on their stable electrical and mechanical properties. The signature peaks of both DMPO-•O2− (fig. S2G, top) and DMPO-•OH (fig. S2G, bottom) were also detected after 3 months of practical usage conditions. As shown in fig. S2 (H to L), the monofilament bending recovery rate, gross bundle strength, elastic modulus, and tensile strength of PVDF-0.16 and PVDF-0.24 groups remained above Nylon levels and within functional limits after simulated use. To assess the mechanical and electrical stability of self-charged toothbrushes after actual use, evaluations of surface integrity, mechanical, and electrical properties were carried out. The results indicated that the monofilament surface remained largely intact, with no observable signs of hydrolysis or degradation (fig. S3A). As shown in fig. S3 (B and C), the self-charged toothbrushes remained soft, and the monofilament bending recovery rate still met the GB/T 19342-2024 standard. In addition, the surface potential and output voltage of the self-charged toothbrushes remained stable after 3-month use (fig. S3, D to E). Together, our data indicated that self-charged toothbrushes were able to meet the regular 3-month oral cleaning needs and did not damage the integrity of the tooth surface when used for a long period of time.

The self-charged toothbrush monofilaments achieve in vitro antibacterial and dental plaque removal

Piezoelectric materials have been widely reported to effectively inhibit bacterial activity (31–33). Considering their excellent piezoelectric properties, we further verified the antibacterial and dental plaque removal functions of the self-charged toothbrush monofilaments against key oral pathogens Streptococcus mutans (S. mutans) and Porphyromonas gingivalis (P. gingivalis) (34, 35). Live (green)/dead (red) staining of S. mutans and P. gingivalis was performed, and the fluorescent microscopy images showed that the proportions of live bacteria on the PVDF-0.16 and PVDF-0.24 groups were decreased, while the proportions of dead bacteria were significantly increased, with sterilization rates of 52.80% (PVDF-0.24, S. mutans), 45.88% (PVDF-0.16, S. mutans), 9.29% (Nylon, S. mutans), 78.21% (PVDF-0.24, P. gingivalis), 56.57% (PVDF-0.16, P. gingivalis), and 8.41% (Nylon, P. gingivalis) (Fig. 3, A to C). Meanwhile, when the toothbrush monofilaments were in the simulated brushing deformation state and cocultured with bacteria, the bacterial growth in the PVDF-0.16 and PVDF-0.24 groups was restrained compared with that in the Nylon group (fig. S4, A and B). To isolate the piezoelectric contribution from mechanical effects, we included unpoled PVDF groups tested under identical dynamic conditions. Colony-forming unit (CFU) counting demonstrated that the unpoled PVDF exhibited significantly lower antibacterial activity than the poled PVDF under the same mechanical disturbance (fig. S4, C and D).

Fig. 3. Self-charged toothbrushes inhibit oral pathogenic bacteria activity through surface potential and piezoelectric effect.

Fig. 3.

Open in a new tab

(A) Live and dead staining images of S. mutans and P. gingivalis after cocultivation with toothbrush monofilaments. (B) Quantitative analysis of the efficiency of inhibiting S. mutans was calculated by fluorescence intensity of Red/(Red+Green) (n = 6, means ± SEM, ***P = 0.0003 and ****P < 0.0001, one-way ANOVA). (C) Quantitative analysis of the efficiency of inhibiting P. gingivalis was calculated by fluorescence intensity of red/(red + green) (n = 5, means ± SEM, ****P < 0.0001, one-way ANOVA). (D) Intracellular ROS levels of S. mutans and P. gingivalis after cocultivation with toothbrush monofilaments were assessed by DCFH-DA staining. (E) Quantitative analysis of S. mutans ROS concentration was calculated by fluorescence intensity (n = 5, means ± SEM, ****P < 0.0001, one-way ANOVA). (F) Quantitative analysis of P. gingivalis ROS concentration was calculated by fluorescence intensity (n = 5, means ± SEM, ****P < 0.0001, one-way ANOVA). (G) SEM images of S. mutans and P. gingivalis after co-cultivation with toothbrush monofilaments. Yellow arrows indicate the crumpling and destructive changes on S. mutans, while red arrows indicate the crumpling and destructive changes on P. gingivalis. (H) SEM images of bacteria on the surface of monofilaments after 1 month in a humid environment. (I) Schematic representation of bacterial inhibition activity of self-charged toothbrushes.

To further investigate the potential antibacterial mechanisms, dichlorodihydrofluorescein diacetate (DCFH-DA) was used to detect bacterial ROS. Higher green fluorescence intensities of DCFH-DA were detected in both the PVDF-0.16 and PVDF-0.24 groups, as compared to the Nylon group (Fig. 3, D to F), proving that the accumulation of toxic ROS inside the cells contributed to bacterial death. Moreover, SEM showed that the membranes of S. mutans and P. gingivalis exhibited normal morphologies in the Nylon group, while wrinkles and deformation could be spotted in both the PVDF-0.16 and PVDF-0.24 groups. To validate the role of surface potentials, bacteria were cocultured with the monofilaments under fully static conditions. As shown in fig. S4E, clear areas of inhibition appeared around the PVDF-0.16 and PVDF-0.24 groups, which might be related to the surface polarization residual potential, whereas no apparent areas of inhibition were produced around the Nylon group. In addition, the antibacterial effects of the self-charged toothbrush decreased somewhat under fully static conditions. However, its antibacterial function remained strong (fig. S4, F to I) compared with the nylon monofilaments. To verify whether the self-charged toothbrush can suppress bacterial adhesion under real-world application conditions, the daily used toothbrushes were placed in a humid bathroom environment, and the self-charged toothbrushes exhibited markedly less bacterial adhesion than Nylon after 1 month (Fig. 3H). In conclusion, our findings thus demonstrated that the self-charged toothbrush monofilaments elicited antibacterial effects via ROS generation by surface potential and piezoelectric deformation (Fig. 3I).

The excellent antibacterial and mechanical properties of self-charged monofilaments thus enable their application in toothbrushes. For in vitro evaluation of their dental plaque removal efficacy, we established biofilms on bovine tooth surfaces with human-derived oral plaque containing multiple common bacterial species to evaluate the dental plaque removal (36) efficacy of the self-charged toothbrushes (fig. S5A). The results showed that self-charged toothbrushes exhibited better effects than traditional nylon toothbrushes, with a removal efficiency of more than 99% (fig. S5, B and C). In addition, biosafety is a critical requirement for determining the application potential of biomedical materials. The cell viability was also assessed by Cell Counting Kit-8 (CCK-8) assay, and the results showed that all groups exhibited little cytotoxicity (fig. S5D). To conduct further assessments of biocompatibility, the fibroblasts were cocultured with monofilaments for 7 days. According to the live (green)/dead (red) staining images, the morphology of the fibroblasts remained intact, and no obvious dead cells could be observed, with no significant differences among the PVDF-0.16, PVDF-0.24, Nylon, and blank groups (fig. S5E).

Self-charged toothbrushes demonstrate an advantage in plaque control

For efficacy evaluation of self-charged toothbrushes in promoting tooth health, we recruited volunteers for a 3-month clinical efficacy evaluation of toothbrushes. Of the 135 persons who underwent screening, 115 were enrolled in the clinical efficacy evaluation (fig. S6). Volunteers underwent oral examinations, and the plaque was collected for testing at baseline, after 1 month of use and after 3 months of use (Fig. 4A).

Fig. 4. Self-charged toothbrushes demonstrate potential in promoting tooth health.

Fig. 4.

Open in a new tab

(A) Schematic depiction of the clinical efficacy evaluation recruitment and evaluation process for self-charged toothbrushes. (a) Recruitment of volunteers for the initial oral examination and collection of oral plaque. (b) Volunteers were followed up with 1 and 3 months of checkups and dental plaque collection. (B) Quantitative analysis of the recovery rates of plaque index in volunteers after 1 and 3 months of using designated toothbrushes [(PVDF-0.16) n = 30, (PVDF-0.24) n = 25, (Nylon-0.15) n = 28, (Nylon-0.20) n = 26, means ± SEM, ****P < 0.0001, two-way ANOVA]. (C) Quantitative analysis of the recovery rates of gingival index in volunteers after 1 and 3 months of using designated toothbrushes [(PVDF-0.16) n = 30, (PVDF-0.24) n = 25, (Nylon-0.15) n = 28, (Nylon-0.20) n = 26, means ± SEM, *P = 0.0413, **P = 0.0052 and ****P < 0.0001, two-way ANOVA]. (D) Quantitative analysis of the recovery rates of bleeding index in volunteers after 1 and 3 months of using designated toothbrushes [(PVDF-0.16) n = 30, (PVDF-0.24) n = 25, (Nylon-0.15) n = 28, (Nylon-0.20) n = 26, means ± SEM; *P < 0.05 and ****P < 0.0001, two-way ANOVA]. (E) Heatmap of relative flora abundance after 1 and 3 months of using self-charged toothbrushes.

All volunteers received the same oral brushing instructions when they were enrolled in the study. Therefore, the Hawthorne effect existed equally among each group and canceled each other out, without affecting the reliability of comparison between groups (37). The results of oral examinations confirmed that the levels of plaque, gingival inflammation and bleeding in the PVDF-0.16 and PVDF-0.24 groups were all significantly reduced over the duration of efficacy evaluation (baseline to month 3) (Fig. 4, B to D). A greater reduction in dental plaque was seen between baseline and month 1, while a smaller improvement in gingival inflammation and bleeding levels. As the efficacy evaluation progressed to month 3, the extent of improvement across plaque, gingival inflammation, and bleeding converged to a similar level. This suggested that the potential mechanism of self-charged toothbrushes began with plaque control, with sustained plaque management leading to gradual gingival inflammation improvements.

S. mutans and Actinomycetes associated with dental caries along with P. gingivalis and Prevotella intermedia associated with periodontitis are all prevalent within dental plaque (38, 39). Notably, we observed that the relative abundance of these bacteria mentioned above decreased progressively as the self-charged toothbrushes were used for longer periods of time by 16S ribosomal RNA (rRNA) gene sequencing. Figure 4E and fig. S7 (A and B) showed that the relative abundance of S. mutans generally tended to decrease with increasing duration of usage in the PVDF-0.16 and PVDF-0.24 groups. Similarly, the relative abundance of P. gingivalis in the PVDF-0.16 and PVDF-0.24 groups exhibited a similar trend, whereas there was no significant decrease of the aforementioned pathogenic bacteria in the Nylon-0.15 and Nylon-0.20 groups (fig. S7, C and D). Together, these results demonstrated a potential advantage of the self-charged toothbrushes in promoting tooth health.

Self-charged toothbrushes impair the ABC transporter pathway to induce oxidative damage on pathogenic oral bacteria

To further investigate the effects of self-charged toothbrushes on the oral microbiome, we next performed metagenome sequencing of human dental plaques. Notably, the use of self-charged toothbrushes effectively maintained microbial α-diversity (Fig. 5A) and preserved β-diversity similar to baseline with prolonged usage, suggesting the potential of self-charged toothbrushes in restoring oral microbiome to a more normalized state (fig. S8, A to D). At the species level, the relative abundance of pathogenic oral bacteria was significantly decreased (fig. S8, E to H). Specifically, caries-associated S. mutans and periodontal disease–associated Fusobacterium polymorphum were reduced after 1 month, while S. mutans and periodontal disease–associated P. gingivalis decreased in abundance after 3 months of self-charged toothbrush usage (Fig. 5, B to E, and fig. S8, I to L). In contrast, the relative abundance of nonpathogenic bacteria including Lactobacillus rhamnosus (LGG) and Streptococcus salivarius (S. salivarius) increased with the usage of the self-charged toothbrushes (Fig. 5, F to I, and fig. S8, M to P).

Fig. 5. Self-charged toothbrushes effectively reduce the relative abundance of oral pathogenic bacteria.

Fig. 5.

Open in a new tab

(A) Quantitative analysis of oral plaque alpha diversity in volunteers after 1 and 3 months of using designated toothbrushes (n = 12, means ± SEM, two-way ANOVA). (B to I) Quantitative analysis of different oral bacterial species in volunteers after 3 months of using self-charged toothbrushes (n = 12, means ± SEM, *P < 0.05 and **P < 0.01, paired samples t test). (J) LEfSe analysis of significantly different functions enriched by KEGG analysis of oral plaque samples after 3 months of using PVDF-0.16. (K) LEfSe analysis of significantly different functions enriched by KEGG analysis of oral plaque samples after 3 months of using PVDF-0.24. (L and M) Predictive analysis of oral pathogens and functional association modeling.

To evaluate significant functional changes over time, Kyoto Encyclopedia Genes and Genomes (KEGG) enrichment analysis was carried out. Notably, the bacterial secretion system was down-regulated, and the peroxisome proliferator–activated receptor (PPAR) signaling pathway was up-regulated after 1 month of using a self-charged toothbrush (fig. S9, A and B). Furthermore, the bacterial secretion system remained down-regulated after 3 months in both self-charged toothbrush groups (fig. S9, C and D). It has been reported that the activation of PPARs signaling pathway is involved in suppressing inflammation (40), whereas the bacterial secretion system plays an important role in bacterial information exchange (41). Subsequently, linear discriminant analysis effect size (LEfSe) analysis further revealed that after 1 month of using self-charged toothbrushes, significant differential functions were mainly enriched in signal transduction and PPAR signaling pathways (fig. S9, E and F), whereas after 3 months, they were mainly enriched in the ATP-binding cassette (ABC) transporters (Fig. 5, J and K). ABC transporters constitute one of the largest families of membrane proteins and are of great interest in understanding virulence and drug resistance (42, 43). Last, the model prediction indicated that oral disease–related flora correlated most strongly with the function of the ABC transporters pathway in both types of self-charged toothbrushes (Fig. 5, L and M). It was reported that intrinsic differences in membrane architecture and oxidative stress defense systems exist between pathogenic and nonpathogenic bacteria. Because of the different tolerances of pathogenic and nonpathogenic bacteria to oxidative stress, the decline in microbiota abundance is relative and eventually leads to the establishment of a new microbiota homeostasis. Pathogenic oral bacteria such as S. mutans and P. gingivalis have relatively fragile membrane structures and less robust antioxidant defenses, rendering them inherently more sensitive to oxidative challenge. In contrast, nonpathogenic bacteria such as Streptococcus oralis exhibit enhanced oxidative stress tolerance, arising from more stable membrane organization and superior capacity in detoxifying ROS through antioxidant enzyme systems (44–46). These findings suggested that the self-charged toothbrushes may improve tooth health by impairing the ABC transporters pathway, thereby reducing the bacterial adhesion and pathogenicity.

To verify whether the transmembrane transport functions of both the oral commensal and pathogenic bacteria are affected by the self-charged toothbrushes, we selected nonpathogenic bacteria LGG and S. salivarius as well as the oral pathogenic bacterial species S. mutans and P. gingivalis for further verification. Subsequent reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay verified that the genes related to the ABC pathway of S. mutans and P. gingivalis were silenced in the self-charged toothbrush groups (Fig. 6, A and B), while their expression in LGG and S. salivarius showed no difference between the self-charged toothbrush groups and the nylon toothbrush groups (Fig. 6, C and D). Membrane transporter systems are responsible for the uptake and efflux of ions, thereby regulating membrane potential and bacterial survival (47, 48). By using the fluorescent membrane-potential indicator dye DiOC2, we found hyperpolarization of membrane potential in S. mutans and P. gingivalis cultured with self-charged toothbrushes (Fig. 6, E and F). To assess whether restoring ABC transporter function can attenuate self-charged toothbrush-mediated killing of S. mutans and P. gingivalis, N-acetylcysteine (NAC) was applied to cocultures with S. mutans and P. gingivalis and the self-charged toothbrush monofilaments under simulated brushing conditions. The RT-qPCR results showed that in the presence of NAC, the ROS-mediated down-regulation of ABC transporter-related genes was largely abrogated; specifically, the transcript levels of key ABC transporter components did not decrease significantly compared to untreated controls (fig. S10, A and B). Moreover, the bactericidal effect of the self-charged toothbrushes was markedly attenuated under antioxidant treatment, as evidenced by improved bacterial viability (fig. S10, C to E). Hence, our results demonstrated that self-charged toothbrushes triggered intracellular ROS production in oral pathogenic bacteria, leading to oxidative damage to the bacterial membranes, disruption of the ABC transporters pathway, and a subsequent reduction in bacterial adhesion and pathogenicity.

Fig. 6. Self-charged toothbrushes induce oxidative damage on oral pathogenic bacteria membrane and impair the ABC transporter pathway.

Fig. 6.

Open in a new tab

(A to D) RT-qPCR analysis of genes related to ABC transporters in S. mutans, P. gingivalis, S. salivarius and LGG cultured with the different toothbrushes (n = 3, means ± SEM; *P < 0.05, **P < 0.01, and ***P = 0.0002, one-way ANOVA). (E and F) Flow cytometric analysis of the membrane potentials of S. mutans and P. gingivalis cultured with the different toothbrushes. Membrane potentials were calculated on the basis of the fluorescence intensities of red/green (n = 3, means ± SEM, ***P < 0.001 and ****P < 0.0001, one-way ANOVA).

DISCUSSION

Piezoelectrical biomaterials exhibit much potential for clinical applications because of their unique capacity for tuning electrical properties via modulation of annealing parameters and stress (27, 49). The efficacy of piezoelectric biomaterials in combating bacterial infection has been widely demonstrated (50–52). Nevertheless, little is known about the role of piezoelectric biomaterials in toothbrush application and tooth health promotion.

Our present study reported that a self-charged toothbrush combated pathogenic oral bacteria such as S. mutans and P. gingivalis via piezoelectric bactericidal effects, thereby showing antimicrobial activity. The self-charged toothbrush displayed good biosafety, stable piezoelectric and mechanical properties suitable for daily oral cleaning. Mechanistically, piezoelectric stimulation triggered intracellular ROS production in pathogenic bacteria, leading to oxidative damage to the bacterial membranes, impairing the ABC transporters pathway, and subsequently reducing bacterial adhesion and pathogenicity. These in vitro findings were corroborated by clinical data: After months of use, the self-charged toothbrushes significantly reduced the plaque index and suppressed the relative abundance of oral pathogens within dental plaques, indicating sustained antimicrobial activity even under real-world intermittent conditions.

Nevertheless, the prolonged in vitro co-incubation model does not fully recapitulate the brief, intermittent mechanical stimulation of actual brushing, which is followed by salivary rinsing, dietary exposure, and plaque regrowth. Future studies using intermittent brushing-mimicking models are warranted to evaluate bacterial recovery kinetics and further consolidate the advantages of this self-charged toothbrush in promoting tooth health. Moreover, while the present study compared the self-charged toothbrushes with conventional nylon toothbrushes, further comparisons with commercially available electric, sonic, or antimicrobial-coated alternatives are essential for fully establishing the translational advantage of the piezoelectric approach over existing oral care technologies.

Together, our findings confirmed the antimicrobial effects of self-charged toothbrushes against oral pathogenic bacteria within dental plaques and indicated that self-charged toothbrushes had potential in plaque removal. Longer-term follow-ups will be carried out in the future to confirm the continuous benefits of self-charged toothbrushes and their advantages in promoting tooth health.

MATERIALS AND METHODS

Material and image graphics preparation

The PVDF monofilaments were obtained from Nantong Ntec Monofilament Technology Co Ltd. Subsequently, monofilaments with different diameters were obtained by melt extrusion technology with PVDF. For crystallites improvement and surface charge polarization, the monofilaments were annealed at 120°C respectively for 2 hours. To make sure the tips of monofilaments were rounded, physical mechanical grinding was carried out by combining rotation with the undulation of a specific circular grinding disc. The image graphics in Figs. 1, 2A, 3 (A and I), and 4A, and figs. S2A and S5A were made by blender and photoshop software.

Structural characterization

Microstructures were characterized by an SEM (ZEISS Merlin). Mechanical properties of PVDF monofilaments were assessed using a universal mechanical testing machine (WDW3020, China). The phase structure of PVDF monofilaments was determined by XRD (Bruker D8) with Cu Kα radiation (λ = 1.5406 Å, 2θ = 20° to 60°). Voltages were measured by an electrometer (Keithley). The piezoelectric coefficient (d33) was measured by a piezoelectric coefficient meter (ZJ-3AN, IACAS). The piezoresponse force microscopy (PFM, Multimode 8, Bruker) was used to characterize the electric performance of the materials, while the reactive species created by the piezocatalyst were detected by the EPR technique with a Bruker EMX-10/12 spectrometer.

Antibacterial assay

A custom brushing machine was used to control the toothbrushes to move at a fixed angle and frequency. The specific parameters are as follows: The round-trip frequency is 100 r/min, and the total mass of the toothbrush and the mechanical rod are adjusted to (150 ± 2) g. S. mutans (S. mutans, ua159) and P. gingivalis (P. gingivalis, American Type Culture Collection 33277) diluted into 107 CFU/ml were suspended into brain heart infusion (BHI) broth and BHI broth supplemented with 1% (w/v) hemin and 0.1% (w/v) vitamin K1 respectively and cocultured with the toothbrushes for 24 hours at 37°C in an incubator. At every subsequent 3-hour time point, the optical density (OD) values were measured at 600 nm, which were plotted to obtain bacterial growth curves. To verify the antibacterial effects of the surface potential of materials, 50 μl of diluted bacterial solution with a titer of 5 × 104 CFU/ml was evenly coated on BHI solid culture plate, and the monofilament samples were placed on the culture plate to be attached for 24 hours at 37°C within an incubator containing an atmosphere of 5% CO2. Then, the plates were taken out and photographed.

Clinically, the recommended brushing duration is 2 to 3 min each time, twice daily, with toothbrushes being typically replaced every 3 months. This amounted to a cumulative brushing time of ∼9 hours over the entire service life. To evaluate live and dead bacteria adhering to the material together with bacteria removal after the simulated brushing process, we specifically set the coculture duration of S. mutans and P. gingivalis to 9 hours to better simulate the total brushing time over 3 months of routine use. Subsequently, the samples were stained using the Live/Dead Bacterial Staining Kit (DMAO/EthD-III). Images were captured using a confocal laser scanning microscope (Leica). To observe bacterial adhesion and morphological changes, the samples were also observed under a field-emission SEM (FE-SEM; S-4800, Hitachi). ROS indicator dye DCFH-DA (10 × 10−6 M) was used to stain the bacteria for 15 min in the dark, after which the bacteria were photographed under a confocal laser scanning microscope (Leica). Adhesive cell numbers were obtained by counting the bacterial colony numbers in the agar plates. The collected monofilament specimens were placed in tubes containing 1 ml of sterile phosphate-buffered saline (PBS) and vortexed for 60 s to detach adherent bacteria. The resulting suspension was then serially diluted 10-fold, and a 100-μl aliquot of the 10−3 dilution was spread onto BHI agar plates. The plates were then incubated at 37°C for 24 hours before colony counting. To verify the antibacterial effect of the self-charged toothbrush under real-world application conditions, the daily used toothbrushes were placed in a humid bathroom environment for 1 month and observed under FE-SEM (S-4800, Hitachi).

For the biofilm culture, an ex vivo human biofilm model collected from patients was used (36, 53). The biofilm samples were transferred and cultured on healthy bovine tooth enamel samples. The samples were cultured in LB medium supplemented with 1% (w/v) glucose via static incubation at 37°C for 48 hours. Then, the LB medium was removed, and the samples were subjected to brushing for 3 min and stained using the Live/Dead Bacterial Staining Kit (DMAO/EthD-III). To evaluate the effects of surface potential, the S. mutans and P. gingivalis were cocultured with the monofilaments under fully static conditions for 9 hours at 37°C within an incubator containing an atmosphere of 5% CO2. The samples were stained using the Live/Dead Bacterial Staining Kit (DMAO/EthD-III) and ROS indicator dye DCFH-DA (10 × 10−6 M), respectively. The images were captured using a confocal laser scanning microscope (Leica). For the NAC treatment on bacteria, the toothbrushes were controlled by a custom brushing machine to move at a fixed angle and frequency. Subsequently, the bacterial suspensions were mixed with toothbrushes and NAC (1 mM). These were then statically incubated at 37°C for 9 hours, and the cells were then washed twice with PBS to remove extracellular NAC and resuspended with fresh BHI, followed by quantification of ROS and bacterial activity.

Cytotoxicity testing

Different toothbrushes that had been used for 3 months were controlled by the custom brushing machine and cocultured with fibroblast cells (L-929, provided by the Shanghai Institute of Cell Biology, Chinese Academy of Sciences, 1.2 × 104 cells per well) at 37°C within an incubator containing a humidified atmosphere of 5% CO2. At specific time points (1, 2, or 3 days), CCK-8 (Solarbio, China) solution was added to the wells to be tested and then incubated at 37°C for 1 hours. The absorbance was measured at 450 nm to assess cell activity according to the OD values. The biocompatibility of monofilaments was also assessed with L929 fibroblasts and live/dead staining. Briefly, at specific time points, live/dead staining solutions were added to the samples to be tested, followed by the imaging of these samples under a confocal laser scanning microscope (Leica) after 15-min incubation.

Simulated aging and wear testing

A digital dry bath (Tuohe, JXH-200) was used to perform a 9-hour simulated thermal cycling, with each thermal cycle (25° to 37° to 25°C) taking ∼3 min to complete. Meanwhile, the toothbrushes were placed in the water bath of the aforementioned device, and the simulated brushing motion was controlled by the instrument. The samples were then naturally dried, and the mechanical, electric properties of the toothbrushes were assessed. To test the abrasion of toothbrush and tooth surface after the simulated 3 months of brushing, the samples were collected and analyzed by FE-SEM (FE-SEM, S-4800, Hitachi).

Clinical efficacy evaluation design and procedure

Ethical approval for this study was obtained from the Peking University Hospital of Stomatology Ethics Committee ref.: PKUSSIRB-202392140. The study was registered on Chinese Clinical Trial Registry with reference number ChiCTR2300078294. Participants were provided with a participant information sheet (PIS), the study details and the details of the PIS were explained to the participants, and written informed consent was obtained. Adult participants with gingivitis or caries whom were admitted to Peking University Hospital of Stomatology were screened for eligibility. The inclusion criteria include the following: (i) male or female individuals aged 18 or above; (ii) be proficient in using the manual brushing method independently; (iii) the Turesky modified Quigley-Hein plaque index examination was used, and the baseline dental plaque index score was greater than 1.5; (iv) baseline examination showed at least 20 sites of gingival bleeding; (v) at least 16 natural teeth (except for crown restorations) should remain; (vi) informed consent provided by the subjects. This study adopted a randomized controlled trial, and the sample size calculation was performed using G*Power software based on data from a preliminary experiment. A two-sided significance level (α) of 0.05, a statistical power (1 − β) of 0.90, and an anticipated dropout rate of 10% were set. The sealed envelope method was used to randomize the eligible participants, and they were assigned to use either the PVDF-0.16, PVDF-0.24, Nylon-0.15, or Nylon-0.20 toothbrushes. During the course of this study, work relocation, inability to commit to the study appointments, or switching dentifrices was considered as exclusion criteria. Being diagnosed with an advanced periodontal disease or other diseases that affect soft or hard oral tissues, having orthodontic appliances that interfere with clinical assessments, having periodontal treatment 6 months before the start of the study, being pregnant or breastfeeding, and smoking were also considered as exclusion criteria. At the start of the study, the human subjects were instructed how to brush teeth twice a day, receiving a full-mouth oral examination with the gingival index, bleeding index, and plaque index being recorded. Subsequently, supragingival dental plaque was collected from either six sites within the participants by a sterile swab. Samples from the same participant were pooled in a cryopreservation tube and placed into dry ice for flash freezing. These samples and clinical recordings correspond to the reference baseline. At this point, participants used our issued toothbrushes and fluoride-free toothpaste for daily oral cleaning. After 1 and 3 months, participants received full mouth oral examination, and the other two samples from the same sites were taken and processed by the same procedure. Participants were asked to visit the clinic at least 12 hours after their last toothbrushing, meal, or drink (any beverage other than water).

16S rRNA gene sequencing

RNA was extracted using the Ambion mirVana miRNA isolation kit (Thermo Fisher Scientific, Carlsbad, CA), with the extraction protocol being modified to include enzymatic digestion with lysozyme, lysostaphin, and mutanolysin plus bead beating. DNA was eluted from the organic phase of the RNA extraction, followed by ethanol precipitation. Specific primers with barcodes were synthesized according to the designated sequencing region. Samples were amplified, quantified, normalized, and pooled using TransStart Fastpfu DNA polymerase (AP221-02, TransGen). The PCR products were detected and quantified by the QuantiFluor -ST Blue Fluorescence Quantification System (Promega), followed by mixing in the appropriate ratio according to the sequencing amount required for each sample. The Illumina library was constructed, followed by sequencing and analyzing the microarrays on a NextSeq 2000 sequencer. On the basis of the ASV (Amplicon sequence variant) representative sequences and abundance information obtained from sequencing, statistical or visual analysis of species taxonomy, community diversity analysis, as well as species difference analysis and correlation analysis were performed.

Metagenome sequencing

Total DNA was isolated from the sample using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. DNA concentration and integrity were assessed by a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and agarose gel electrophoresis, respectively. DNA was fragmented by S220 Focused-ultrasonicators (Covaris, USA) and cleaned up by Agencourt AMPure XP beads (Beckman Coulter Co., USA). Then, the libraries were constructed using TruSeq Nano DNA LT Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. The libraries were sequenced on an Illumina NovaSeq 6000 platform, and 150–base pair (bp) paired-end reads were generated. Sequences in the FastQ file were trimmed and filtered using Trimmomatic (v 0.36). Metagenome assembly was performed using MEGAHIT (v 1.1.2) after getting valid reads. Gaps within scaffolds were used as breakpoint to interrupt the scaffold into new contigs (scaftig), and these new scaftigs with length >500 bp were retained. Open reading frame prediction of assembled scaffolds using prodigal (v 2.6.3) software was performed and translated into amino acid sequences. The nonredundant gene sets were built for all predicted genes using CDHIT (v 4.5.7). The clustering parameters were 95% identity and 90% coverage. The longest gene was selected as the representative sequence of each gene set. Clean reads of each sample were aligned against the nonredundant gene set (95% identity) using bowtie2 (v 2.2.9) software, and the abundance information of the gene in the corresponding sample was counted. The taxonomy of the species was obtained as a result of the corresponding taxonomy database of the NR Library, and the abundance of the species was calculated using the corresponding abundance of the genes. To construct the abundance profile on the corresponding taxonomy level, abundance statistics were performed at each level of domain, kingdom, phylum, class, order, family, genus, and species. The gene set representative sequence (amino acid sequence) was annotated with NR, KEGG, eggNOG, SWISSPROT, and GO databases with an e value of 1 × 10−5 using DIAMOND (v 0.9.7). The principal components analysis and plotting of the taxonomy abundance spectrum or functional abundance spectrum were carried out using R software (v 3.2.0). Then, the R package was used to analyze significant differences between different groups, while the LEfSe method was used to compare the taxonomy abundance spectrum or functional abundance spectrum.

Bacterial membrane potential detection

S. mutans and P. gingivalis were cultured with self-charged toothbrushes at 37°C for 24 and 48 hours, respectively. The bacterial cells were then collected and incubated with a fluorescent membrane-potential indicator dye DiOC2(3) according to the manufacturer’s protocol (BacLight Bacterial Membrane Potential Kit, Invitrogen). Flow cytometry assay was performed, and red/green ratios were calculated using mean fluorescence intensities.

Transcriptome analysis of bacteria

S. mutans and P. gingivalis were cultured with self-charged toothbrushes at 37°C for 24 and 48 hours, respectively. The bacteria were collected and washed gently with PBS, and lysozyme (1 mg/ml) was added to digest the bacterial wall. Bacterial RNA was extracted using a spin column RNA extraction kit (MolPure Bacterial RNA Kit, Yeasen Biotechnology) and then subjected to transcriptome sequencing and RT-qPCR. RT-qPCR was performed on a 7500HT Fast Real-Time PCR machine and the primer sequences used were as follows:

ABC transporter permease (PGN_RS06310) (forward: CATCGGAGCCGTTATCACTATC; reverse: GAGACACATAACCGTGGAAGAA), ABC domain-containing protein (PGN_RS06510) (forward: GCTTCGGCTATTACAGTCA; reverse: TCGGCGTATATTGCTTCTC), ABC transporter permease (FG342_RS00895) (forward: GACGATTCCTTCATTGGCATTG; reverse: TTCCGCAACCGACTCATC), ABC domain-containing protein (FG342_RS11755) (forward: TACTGCCGTGAACTTGAC; reverse: TATTGGTGTGCTGTGCTT), ABC transporter permease (I6L88_RS02610) (forward: TATCGCTGGAGTACTTGGAA; reverse: TTTAGCTGCTACACGTGATG), peptide ABC transporter substrate-binding protein (I6L88_RS07710) (forward: GGTCTTGCTGTTGAGTCT; reverse: CTGAGGAGTCGGTGATTC), ABC transporter permease (SALIVA_RS07760) (forward: CAGTCGGTCTTCATTCCTA; reverse: CGCAATCATAGCAGCAATA), peptide ABC transporter substrate-binding protein (SALIVA_RS09230) (forward: ATTACGCCGCACAACTTA; reverse: CACCAGACCACTCATCAC), FG342_RS11870 (forward: GCTGTCTGGTCTGTAACT; reverse: CAGGCGGAATGCTTAATG), I6L88_RS09910 (forward: ATACATAGCCGACCTGAGA; reverse: TCCATTGCCGAAGATTCC), SALIVA_RS09150 (forward: CTTGCTCTTCTTGGATGA; reverse: CCGTTACCTCACCTACTA), and 16S ribosomal (PGN_RS01015) (forward: CGTGAAGGAAGACTGTCCTAAG; reverse: CGGAGTTAGCCGATGCTTATT).

Statistical analysis

The Shapiro-Wilk test was used to assess the normality of distributions. Statistical analyses were carried out using paired sample t test or one-way analysis of variance (ANOVA), followed by Bonferroni-corrected post hoc tests for multiple comparison. For the longitudinal analysis, a two-way repeated-measures ANOVA, followed by Bonferroni-corrected post hoc tests for multiple comparison was performed. The thresholds of statistical significance were set at *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Acknowledgments

Funding:

This work was supported by National Natural Science Foundation of China 82221003 (to X.D.), 52273258 (to X.Z.) and 82301076 (to J.S.); the National Key R&D Program of China 2022YFA1207304 (to X.D.); the Beijing Municipal Science & Technology Commission no. Z241100009024056 (to X.D.); the the Beijing Natural Science Foundation L244021 (to X.Z.); the Hainan Provincial Natural Science Foundation of China 826ZD1024 (to X.Z.); the Central Government Guidance Funding for Local Science and Technology Projects in Shanxi Province YDZJSX2024D075 (to X.Z.); the Heilongjiang Provincial Key R&D Program Project 2024ZX12C08 (to X.Z.); the Non-profit Central Research Institute Fund of The Chinese Academy of Medical Sciences 2023-PT320-09 (to X.D.); the Sanjin Talent Program of Shanxi Province SJYC2025548 (to X.Z.); the Program for New Clinical Techniques and Therapies of Peking University School and Hospital of Stomatology PKUSSNCT-23B07 (to X.C.); the Young Elite Scientists Sponsorship Program of the Beijing High Innovation Plan 20250810 (to J.S.); and the Joint Program on Health Science & Technology Innovation of Hainan Province WSJK2026QN014 (to J.S.).

Author contributions:

Conceptualization: X.Z. and X.D. Methodology: W.L., Q.C., and X.Z. Formal analysis: J.S., X.C., L.W. Investigation: W.L., L.W., Y.G., Y.B., and X.H. Visualization: Y.L. and J.S. Supervision: X.Z. and X.D. Validation: Y.L., J.S., and X.C. Data curation: Y.L., J.S., and X.C. Writing—original draft: Y.L., J.S., and X.C. Writing—review and editing: B.C.H., X.Z., and X.D. Funding acquisition: J.S., X.C., X.Z., and X.D. Resources: Y.G. and Y.B. Project administration: Y.G., Q.C., and X.Z.

Competing interests:

The authors declare that they have no competing interests.

Data, code, and materials availability:

This study did not generate new materials. The 16S rRNA gene sequencing data that supported the findings in this study has been deposited in the SRA database with the accession code PRJNA1478187 (www.ncbi.nlm.nih.gov/sra/PRJNA1478187), and the Metagenome sequencing data that supported the findings in this study have been deposited in the Genome Sequence Archive (GSA) with the accession code CRA045170 (https://ngdc.cncb.ac.cn/gsa/browse/CRA045170). All data and code needed to evaluate and reproduce the results in the paper are present in the paper and/or the Supplementary Materials.

Supplementary Materials

This PDF file includes:

Figs. S1 to S10

sciadv.aeg5744_sm.pdf (23.3MB, pdf)

REFERENCES

  • 1.Mazhari F., Boskabady M., Moeintaghavi A., Habibi A., The effect of toothbrushing and flossing sequence on interdental plaque reduction and fluoride retention: A randomized controlled clinical trial. J. Periodontol. 89, 824–832 (2018). [DOI] [PubMed] [Google Scholar]
  • 2.Yaacob M., Worthington H. V., Deacon S. A., Deery C., Walmsley A. D., Robinson P. G., Glenny A.-M., Powered versus manual toothbrushing for oral health. Cochrane Database Syst. Rev. 2014, CD002281 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Poole D. F., Newman H. N., Dental plaque and oral health. Nature 234, 329–331 (1971). [DOI] [PubMed] [Google Scholar]
  • 4.Waldron C., Nunn J., Mac Giolla Phadraig C., Comiskey C., Guerin S., van Harten M. T., Donnelly-Swift E., Clarke M. J., Oral hygiene interventions for people with intellectual disabilities. Cochrane Database Syst. Rev. 5, CD012628 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Xiaowan Y., Gang L., Bone toothbrush handles in chinese tang dynasty ash pits. J. Hist. Dent. 72, 162–164 (2024). [DOI] [PubMed] [Google Scholar]
  • 6.Wu Q. P., The textual research on the evolution of the toothbrush shape in ancient China. Zhonghua Yi Shi Za Zhi 42, 131–139 (2012). [PubMed] [Google Scholar]
  • 7.Axe A., Mueller W. D., Rafferty H., Lang T., Gaengler P., Impact of manual toothbrush design on plaque removal efficacy. BMC Oral Health 23, 796 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Turssi C. P., Kelly A. B., Hara A. T., Toothbrush bristle configuration and brushing load: Effect on the development of simulated non-carious cervical lesions. J. Dent. 86, 75–80 (2019). [DOI] [PubMed] [Google Scholar]
  • 9.Mamat N., Mani S. A., Danaee M., T-shaped toothbrush for plaque removal and gingival health in children: A randomized controlled trial. BMC Oral Health 22, 113 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jakubovics N. S., Goodman S. D., Mashburn-Warren L., Stafford G. P., Cieplik F., The dental plaque biofilm matrix. Periodontol. 2000 86, 32–56 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Listgarten M. A., The structure of dental plaque. Periodontol. 2000 5, 52–65 (1994). [DOI] [PubMed] [Google Scholar]
  • 12.Pihlstrom B. L., Michalowicz B. S., Johnson N. W., The Periodontal diseases. Lancet 366, 1809–1820 (2005). [DOI] [PubMed] [Google Scholar]
  • 13.Hasan M. I., Aggarwal S., Matrix matters: How extracellular substances shape biofilm structure and mechanical properties. Colloids Surf. B Biointerfaces 246, 114341 (2025). [DOI] [PubMed] [Google Scholar]
  • 14.Lv X., Feng Z., Luo J., Liu Z., Lu J., Han S., Wang K., Zhang L., Effects of caffeic acid phenethyl ester against multi-species cariogenic biofilms. Folia Microbiol. 68, 977–989 (2023). [DOI] [PubMed] [Google Scholar]
  • 15.Dukanovic Rikvold P., Skov Hansen L. B., Meyer R. L., Jørgensen M. R., Tiwari M. K., Schlafer S., The effect of enzymatic treatment with mutanase, beta-glucanase, and DNase on a saliva-derived biofilm model. Caries Res. 58, 68–76 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Petersilka G. J., Ehmke B., Flemmig T. F., Antimicrobial effects of mechanical debridement. Periodontol. 2000 28, 56–71 (2002). [DOI] [PubMed] [Google Scholar]
  • 17.Teles F. R., Teles R. P., Uzel N. G., Song X. Q., Torresyap G., Socransky S. S., Haffajee A. D., Early microbial succession in redeveloping dental biofilms in periodontal health and disease. J. Periodontal Res. 47, 95–104 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Uzel N. G., Teles F. R., Teles R. P., Song X. Q., Torresyap G., Socransky S. S., Haffajee A. D., Microbial shifts during dental biofilm re-development in the absence of oral hygiene in periodontal health and disease. J. Clin. Periodontol. 38, 612–620 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Oh M. J., Babeer A., Liu Y., Ren Z., Wu J., Issadore D. A., Stebe K. J., Lee D., Steager E., Koo H., Surface topography-adaptive robotic superstructures for biofilm removal and pathogen detection on human teeth. ACS Nano 16, 11998–12012 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ikawa T., Mizutani K., Sudo T., Kano C., Ikeda Y., Akizuki T., Kobayashi H., Izumi Y., Iwata T., Clinical comparison of an electric-powered ionic toothbrush and a manual toothbrush in plaque reduction: A randomized clinical trial. Int. J. Dent. Hyg. 19, 93–98 (2021). [DOI] [PubMed] [Google Scholar]
  • 21.Zhao S., Adamiak J. W., Bonifay V., Mehla J., Zgurskaya H. I., Tan D. S., Defining new chemical space for drug penetration into Gram-negative bacteria. Nat. Chem. Biol. 16, 1293–1302 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang P., You Q., Liu Y., Miao H., Dong W. F., Li L., Combating infections from drug-resistant bacteria: Unleashing synergistic broad-spectrum antibacterial power with high-entropy MXene/CDs. Colloids Surf. B Biointerfaces 238, 113874 (2024). [DOI] [PubMed] [Google Scholar]
  • 23.Toshniwal S. H., Reche A., Bajaj P., Maloo L. M., Status quo in mechanical plaque control then and now: A review. Cureus 14, e28613 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang H., Mu N., He Y., Zhang X., Lei J., Yang C., Ma L., Gao Y., Ultrasound-controlled MXene-based Schottky heterojunction improves anti-infection and osteogenesis properties. Theranostics 13, 1669–1683 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liao Y., Li B., Zhao Z., Fu Y., Tan Q., Li X., Wang W., Yin J., Shan H., Tang B. Z., Huang X., Targeted theranostics for tuberculosis: A rifampicin-loaded aggregation-induced emission carrier for granulomas tracking and anti-infection. ACS Nano 14, 8046–8058 (2020). [DOI] [PubMed] [Google Scholar]
  • 26.Sun Y., Sun X., Li X., Li W., Li C., Zhou Y., Wang L., Dong B., A versatile nanocomposite based on nanoceria for antibacterial enhancement and protection from aPDT-aggravated inflammation via modulation of macrophage polarization. Biomaterials 268, 120614 (2021). [DOI] [PubMed] [Google Scholar]
  • 27.Zhang C., Liu W., Cao C., Zhang F., Tang Q., Ma S., Zhao J., Hu L., Shen Y., Chen L., Modulating surface potential by controlling the β phase content in poly (vinylidene fluoridetrifluoroethylene) membranes enhances bone regeneration. Adv. Healthc. Mater. 7, e1701466 (2018). [DOI] [PubMed] [Google Scholar]
  • 28.Hu Z., Tian M., Nysten B., Jonas A. M., Regular arrays of highly ordered ferroelectric polymer nanostructures for non-volatile low-voltage memories. Nat. Mater. 8, 62–67 (2009). [DOI] [PubMed] [Google Scholar]
  • 29.Mahdi R. I., Gan W. C., Abd Majid W. H., Hot plate annealing at a low temperature of a thin ferroelectric P(VDF-TrFE) film with an improved crystalline structure for sensors and actuators. Sensors 14, 19115–19127 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hogan L. M., Daly C. G., Curtis B. H., Comparison of new and 3-month-old brush heads in the removal of plaque using a powered toothbrush. J. Clin. Periodontol. 34, 130–136 (2007). [DOI] [PubMed] [Google Scholar]
  • 31.Huang Y., Wan X., Su Q., Zhao C., Cao J., Yue Y., Li S., Chen X., Yin J., Deng Y., Zhang X., Wu T., Zhou Z., Wang D., Ultrasound-activated piezo-hot carriers trigger tandem catalysis coordinating cuproptosis-like bacterial death against implant infections. Nat. Commun. 15, 1643 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xiong Z., Lin B., Huang C., Duan A., Zhang C., Qiang G., Liu W., Zhao R., Deng X., Wang D., Ge Z., Wang G., Hu X., Lin W., Biocompatible and stretchable chitosan piezoelectric gel with antibacterial capability and motion monitoring function for Achilles tendon rupture treatment. Carbohydr. Polym. 352, 123149 (2025). [DOI] [PubMed] [Google Scholar]
  • 33.Zheng Y., Wang S., Jin W., Li Z., Yang G., Li X., Li N., Wang Y., Sheng F., Song Z., An ultrasound-driven PLGA/Zn-KNN hybrid piezoelectric scaffold with direct and immunoregulatory antibacterial activity for bone infection. Bioact. Mater. 47, 295–312 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lemos J. A., Palmer S. R., Zeng L., Wen Z. T., Kajfasz J. K., Freires I. A., Abranches J., Brady L. J., The Biology of Streptococcus mutans. Microbiol. Spectr. 7, 10 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sculley D. V., Langley-Evans S. C., Salivary antioxidants and periodontal disease status. Proc. Nutr. Soc. 61, 137–143 (2002). [DOI] [PubMed] [Google Scholar]
  • 36.Liu X., Liang Y., Li Z., Xie C., Zhang Y., Wang W., Ge S., Li J., Nano-toothbrush for noninvasive control of periodontitis. J. Dent. Res. 104, 1333–1342 (2025). [DOI] [PubMed] [Google Scholar]
  • 37.McCracken G. I., Heasman L., Stacey F., Steen N., DeJager M., Heasman P. A., A clinical comparison of an oscillating/rotating powered toothbrush and a manual toothbrush in patients with chronic periodontitis. J. Clin. Periodontol. 31, 805–812 (2004). [DOI] [PubMed] [Google Scholar]
  • 38.Schenkein H. A., Papapanou P. N., Genco R., Sanz M., Mechanisms underlying the association between periodontitis and atherosclerotic disease. Periodontol. 2000 83, 90–106 (2020). [DOI] [PubMed] [Google Scholar]
  • 39.Chaves E. S., Jeffcoat M. K., Ryerson C. C., Snyder B., Persistent bacterial colonization of Porphyromonas gingivalis, Prevotella intermedia, and Actinobacillus actinomycetemcomitans in periodontitis and its association with alveolar bone loss after 6 months of therapy. J. Clin. Periodontol. 27, 897–903 (2000). [DOI] [PubMed] [Google Scholar]
  • 40.Xu F., Hu J., Li Y., Cheng C., Au R., Tong Y., Wu Y., Cui Y., Fang Y., Chen H., Zhu L., Shen H., Qin-Yu-Qing-Chang decoction reshapes colonic metabolism by activating PPAR-γ signaling to inhibit facultative anaerobes against DSS-induced colitis. Chin. Med. 19, 130 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Shen Y., Gao S., Fan Q., Zuo J., Wang Y., Yi L., Wang Y., New antibacterial targets: Regulation of quorum sensing and secretory systems in zoonotic bacteria. Microbiol. Res. 274, 127436 (2023). [DOI] [PubMed] [Google Scholar]
  • 42.Zeng Y., Charkowski A. O., The role of ATP-binding cassette transporters in bacterial phytopathogenesis. Phytopathology 111, 600–610 (2021). [DOI] [PubMed] [Google Scholar]
  • 43.Locher K. P., Mechanistic diversity in ATP-binding cassette (ABC) transporters. Nat. Struct. Mol. Biol. 23, 487–493 (2016). [DOI] [PubMed] [Google Scholar]
  • 44.Yu S., Ma Q., Li Y., Zou J., Molecular and regulatory mechanisms of oxidative stress adaptation in Streptococcus mutans. Mol. Oral Microbiol. 38, 1–8 (2023). [DOI] [PubMed] [Google Scholar]
  • 45.Cheng X., Xu X., Zhou X., Ning J., Oxidative stress response: A critical factor affecting the ecological competitiveness of Streptococcus mutans. J. Oral Microbiol. 16, 2292539 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Fretes A., Lara B., Appella M. N. D., López C., Pérez Leirós C., Tribelli P. M., Hauk V., Oxidative stress reshapes Porphyromonas gingivalis outer membrane vesicles and impairs OMV-mediated invasion and persistence in trophoblast cells. Antibiotics 15, 152 (2026). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Song J., Lu Y., Pan T., Wang J., Liu Z., Xu L., Zhang S., Li L., Bai Y., Heng B., Zheng X., Wu H., Han X., Guo Y., Cui Q., Deng X., Zhang X., Manipulation of surface electrical charge on nanocomposite membranes confers wide spectrum bactericidal effects and promotes tissue regeneration. Adv. Funct. Mater. 34, 2314024 (2024). [Google Scholar]
  • 48.Huang W., Wilks A., Extracellular heme uptake and the challenge of bacterial cell membranes. Annu. Rev. Biochem. 86, 799–823 (2017). [DOI] [PubMed] [Google Scholar]
  • 49.Fu H., Wu L., Cheng J., Hu L., Wang W., Lu Y., Zhang X., Liu Y., Deng X., Piezoelectric nanofibers synchronize mitochondrial dynamics and immune responses for regeneration of infected wounds. ACS Nano 20, 2366–2386 (2026). [DOI] [PubMed] [Google Scholar]
  • 50.Wang Z., Qu W., Qin Y., Piezoelectric hydrogel-mediated ROS/CO promotes infectious chronic wound healing. Matter 8, 102361 (2025). [Google Scholar]
  • 51.Ge M., Zhu W., Mei J., Hu T., Yang C., Lin H., Shi J., Piezoelectric-enhanced nanocatalysts trigger neutrophil N1 polarization against bacterial biofilm by disrupting redox homeostasis. Adv. Mater. 37, e2409633 (2025). [DOI] [PubMed] [Google Scholar]
  • 52.Wu M., Zhang Z., Liu Z., Zhang J., Li L., Piezoelectric nanocomposites for sonodynamic bacterial elimination and wound healing. Nano Today 37, 101104 (2021). [Google Scholar]
  • 53.Li X., Li Q., He A., Dang M., Zhang Y., Wang M., Sun Q., Dai Z., Ding M., Zheng J., Mou Y., Xiu W., Dong H., Disrupting biofilm tolerance by ionic microbubble-mediated copper ion surge for infection clearance. ACS Nano 19, 28624–28643 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figs. S1 to S10

sciadv.aeg5744_sm.pdf (23.3MB, pdf)

Data Availability Statement

This study did not generate new materials. The 16S rRNA gene sequencing data that supported the findings in this study has been deposited in the SRA database with the accession code PRJNA1478187 (www.ncbi.nlm.nih.gov/sra/PRJNA1478187), and the Metagenome sequencing data that supported the findings in this study have been deposited in the Genome Sequence Archive (GSA) with the accession code CRA045170 (https://ngdc.cncb.ac.cn/gsa/browse/CRA045170). All data and code needed to evaluate and reproduce the results in the paper are present in the paper and/or the Supplementary Materials.

Articles from Science Advances are provided here courtesy of American Association for the Advancement of Science

RESOURCES