Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2002 Dec 1;30(23):5168–5174.

Hybridization of 2′-O-methyl and 2′-deoxy molecular beacons to RNA and DNA targets

Andrew Tsourkas, Mark A Behlke 1, Gang Bao a
PMCID: PMC137950  PMID: 12466541

Abstract

Molecular beacons are stem–loop hairpin oligonucleotide probes labeled with a fluorescent dye at one end and a fluorescence quencher at the other end; they can differentiate between bound and unbound probes in homogeneous hybridization assays with a high signal-to-background ratio and enhanced specificity compared with linear oligonucleotide probes. However, in performing cellular imaging and quantification of gene expression, degradation of unmodified molecular beacons by endogenous nucleases can significantly limit the detection sensitivity, and results in fluorescence signals unrelated to probe/target hybridization. To substantially reduce nuclease degradation of molecular beacons, it is possible to protect the probe by substituting 2′-O-methyl RNA for DNA. Here we report the analysis of the thermodynamic and kinetic properties of 2′-O-methyl and 2′-deoxy molecular beacons in the presence of RNA and DNA targets. We found that in terms of molecular beacon/target duplex stability, 2′-O-methyl/RNA > 2′-deoxy/RNA > 2′-deoxy/DNA > 2′-O-methyl/DNA. The improved stability of the 2′-O-methyl/RNA duplex was accompanied by a slightly reduced specificity compared with the duplex of 2′-deoxy molecular beacons and RNA targets. However, the 2′-O-methyl molecular beacons hybridized to RNA more quickly than 2′-deoxy molecular beacons. For the pairs tested, the 2′-deoxy-beacon/DNA-target duplex showed the fastest hybridization kinetics. These findings have significant implications for the design and application of molecular beacons.

INTRODUCTION

Molecular beacons are dual-labeled oligonucleotide probes that are capable of forming a stem–loop structure in the absence of target (1). Specifically, a target-binding domain is flanked by two complementary stem sequences that are usually (but not necessarily) unrelated to the target sequence. One end of the oligonucleotide is labeled with a fluorescent reporter dye and the other end is labeled with a fluorescence quencher. When a molecular beacon is in its stem–loop conformation the reporter fluorophore is effectively quenched. Upon hybridization with target, the stem–loop hairpin structure of a molecular beacon opens, which separates the reporter dye and the quencher and results in an increase in fluorescence intensity of up to 200-fold. The stem–loop structure of a molecular beacon serves not only to bring the two end-labels into proximity in the absence of target but also to improve the specificity of target discrimination compared with linear probes (2). The competing reaction between hairpin formation and target hybridization increases the sensitivity of detecting a single-base mismatch between probe and target sequences and thus enables molecular beacons to differentiate between wild-type and mutant targets better than linear probes (2).

The high signal-to-background ratio and superior specificity of molecular beacons has led to their use in numerous in vitro hybridization assays as well as in the real-time detection and visualization of RNA expression in living cells (3–6). However, the sensitivity of cellular imaging and quantification of gene expression using molecular beacons can be severely limited by the degradation of oligonucleotide backbone by nucleases (5–7). It has been reported that unmodified phosphodiester oligonucleotides may possess a half-life as short as 15–20 min in living cells (8–10). To overcome this difficulty, molecular beacons have been synthesized with nuclease-resistant backbone chemistries, such as phosphorothioate, peptide nucleic acid (11) and 2′-O-methyl modifications (6). False-positive signals, i.e. fluorescence signals induced by the opening of molecular beacons due to nucleases and hairpin-binding proteins may be reduced further by using two molecular beacons that bind to adjacent regions on a target molecule and generate positive signals via fluorescence resonance energy transfer (12). For studies involving mRNA transport and localization in living cells, it is also desirable to modify the backbone to eliminate RNA degradation by RNase H that would otherwise occur upon hybridization of a DNA probe with an RNA target in vivo (13).

2′-O-methyl oligoribonucleotides have been found to exhibit higher affinities for RNA, faster hybridization kinetics (14), better nuclease resistance (15) and the ability to avoid degradation of target RNA by RNase H upon hybridization (16). Compared with unmodified oligodeoxyribonucleotides, 2′-O-methyl oligoribonucleotides have a methoxy group at the 2′ position of the sugar moiety instead of a hydrogen atom. This allows the 2′-O-methyl oligoribonucleotides to confer an RNA-like 3′-endo conformation upon hybridization with RNA or DNA due to the Gauche effect between O4′ and O2′ (17,18). One possible drawback of using 2′-O-methyl oligoribonucleotides for in vivo hybridization studies is that such probes tend to localize in the nucleus and therefore become less available for hybridization to cytoplasmic RNAs (5,6). However, it may be possible to prevent 2′-O-methyl oligonucleotide probes from localizing in the cell nucleus by attaching a macromolecule, such as streptavidin, to one end of the molecular beacon or by using a larger quencher molecule (19).

Since the thermodynamics of both hairpin formation and probe/target hybridization are different for molecular beacons made of 2′-O-methyl RNA, design parameters different from those for conventional DNA molecular beacons must be used. To determine the effect of the 2′-O-methyl sugar substitution on the behavior of molecular beacons, a thermodynamic and kinetic study was performed to contrast the properties of 2′-O-methyl and 2′-deoxy molecular beacons. We found that the 2′-O-methyl molecular beacons hybridize to RNA more quickly and with higher affinity than 2′-deoxy molecular beacons even though they exhibit a much more stable stem–loop structure. However, the enhanced affinity between 2′-O-methyl molecular beacons and RNA is accompanied by a slightly reduced ability to discriminate between wild-type and mutant targets.

MATERIALS AND METHODS

Oligonucleotide synthesis

Oligonucleotide (ODN) probes and targets were synthesized using standard phosphoramidite chemistry on an Applied Biosystems model 394 automated DNA synthesizer (Foster City, CA). Molecular beacons were purified using dual reverse phase (RP) plus ion-exchange (IE) high performance liquid chromatography (HPLC) on a Waters Model 600E HPLC system (Millipore Corp., Milford, MA). For RP-HPLC purification, oligonucleotides were loaded on a Hamilton PRP-1 column and eluted with a linear 5–50% acetonitrile gradient in 0.1 M triethyl-ammonium acetate pH 7.2 over 40 min. The oligonucleotides were additionally purified by IE-HPLC using a Source™ column (Amersham Pharmacia Biotech, Piscataway, NJ) and eluted with a linear 0–50% 1 M LiCl gradient in 0.1 M Tris pH 8.0 over 40 min. Unmodified (target) oligonucleotides were purified using PAGE. The purity of the oligonucleotide probes was functionally assessed by measuring the signal-to-noise ratios of quenched (hairpin) and dequenched (open and hybridized to target) molecular beacons. All nucleic acid targets were purified using PAGE, which resulted in an estimated purity of >95%. However, the actual purity of ODN probes and nucleic acid targets was not directly measured. The concentration of oligonucleotides was determined by measuring the optical absorbance, OD260, and the mass yield was calculated from the measured optical absorbance using nearest-neighbor extinction coefficients, while the concentration of 2′-O-methyl RNAs was calculated using RNA nearest-neighbor extinction coefficients. The description of the method and the exact values of the extinction coefficients used can be found at http://www.idtdna.com/program/techbulletins/Calculating_Molar_Extinction_ Coefficient.asp). All oligonucleotides were synthesized at Integrated DNA Technologies, Inc. (Coralville, IA).

Molecular beacons having the same base sequences were made using oligodeoxyribonucleotides (DNA) and 2′-O-methyl oligoribonucleotides (RNA). Probes were labeled on the 5′-end with a Cy3 fluorophore and at the 3′-end with a dabcyl quencher. As shown in Table 1, both types of molecular beacon have an antisense probe sequence complementary to exon 6 of the human GAPDH gene. In contrast to conventional molecular beacons, where the stem sequences are self-complementary but unrelated to the target sequence, in this study probes were designed such that one arm of the stem participates in both hairpin formation and target hybridization (‘shared-stem’ molecular beacons). Molecular beacons were synthesized with a probe length of 18 bases and a stem length of five bases. Further, two RNA targets were synthesized, one is a perfect complement (wild-type) and the other is mutant with a single base change (point mutation) near the center of the probe hybridization domain (Table 1). Similar DNA targets were also synthesized.

Table 1. The design of molecular beacons and target oligonucleotides.

Name Sequence (5′–3′) Note
2′-deoxy-MBa Cy3-GAGTCCTTCCACGATACCgactc-Dabcyl Probe 18 / stem 5
2′-O-methyl-MB Cy3-GAGUCCUUCCACGAUACCgacuc-Dabcyl Probe 18 / stem 5
DNA WT targetb ACTTTGGTATCGTGGAAGGACTCATGA Perfect match
DNA target B ACTTTGGTATCGTaGAAGGACTCATGA Single base mismatch
RNA WT target ACUUUGGUAUCGUGGAAGGACUCAUGA Perfect match
RNA target B ACUUUGGUAUCGUaGAAGGACUCAUGA Single base mismatch

aMB, molecular beacons. Lower case, residues added to create stem domains. Upper case, probe target hybridizing domains. Upper case bold, residues participating in both stem hairpin and target binding.

bWT, wild-type. Underscore, 18 base sequence complementary to MB. Lower case bold, mismatch bases in targets.

Equilibrium analysis

Molecular beacons in the presence of target were assumed to exist mainly in three phases: (i) bound to target, (ii) stem–loop hairpin and (iii) a random-coil conformation (2). Dissociation constants describing the transition between these phases were determined by analyzing the thermal denaturation profile of molecular beacons in the presence and absence of target. Denaturation profiles were obtained by recording the fluorescence intensity of a 50 µl solution containing 200 nM of molecular beacon in the presence of 0–20 µM of target at temperatures ranging from 5 to 95°C. Specifically, the temperature of hybridization solution was brought to 95°C and reduced at 1°C increments to 5°C. The temperature was then raised at 1°C increments back to 95°C to ensure that the solution reached equilibrium and no hysteresis had occurred. The temperature was held at each increment for 10 min and fluorescence was measured for the final 30 s. The fluorescence intensity of each test solution was adjusted to correct for the intrinsic variation of dye molecular fluorescence with temperature. Each thermal denaturation assay was performed in a modified STE buffer containing 10 mM Tris and 50 mM KCl, but without MgCl2 to avoid RNA degradation.

The fluorescence intensity as a function of temperature describing the thermal denaturation profile of each molecular beacon and molecular beacon–target duplex was employed to determine the respective dissociation constant as described in Bonnet et al. (2). Dissociation constants K12 and K23, corresponding to the transition from phase 1 to phase 2, and from phase 2 to phase 3, respectively, were obtained for beacon–target pairs and for molecular beacons in the absence of target. Further, for each beacon–target duplex, the dissociation constant K12 was used to determine the changes in enthalpy (ΔH12) and entropy (ΔS12) associated with the transition from phase 1 to phase 2, as described below. The errors calculated for the thermodynamic parameters signify a 95% confidence interval.

Molecular beacon specificity

The fraction of molecular beacons bound to target, α, was calculated for each beacon–target pair as a function of temperature. All calculations utilized the enthalpy change ΔH12 and entropy change ΔS12, obtained from the thermal denaturation profiles for each beacon–target duplex.

graphic file with name gkf635equ1.jpg

where η = T0/B0, B̂0= B0/c0, T0 and B0 are, respectively, the initial concentration of target and beacons and c0 is the unit concentration 1 M (20,21). The value of α was calculated for samples containing B0 = 200 nM of molecular beacon and T0 = 400 nM of target. The melting temperature θm is defined as the temperature at which half of the molecular beacons are bound to target, α = 0.5.

Kinetic analysis

A SPEX fluorolog-2 spectrofluorometer with an SFA-20 rapid kinetics stopped-flow accessory and a temperature/trigger module (SFA-12) was used to measure molecular beacon– target binding kinetics. Specifically, the fluorescence intensity emitted from a rapidly mixed solution containing 250 nM molecular beacon and 2.5 µM target was recorded over time for each molecular beacon–target pair. The probe/target hybridization was assumed to obey second order reaction kinetics

graphic file with name gkf635equ2.jpg

where [B], [T] and [D] are the concentrations of unbound molecular beacon, unbound target, and beacon–target duplex, respectively, k1 is the on-rate and k2 the off-rate of molecular beacon–target hybridization. The exact solution of equation 2 gives

graphic file with name gkf635equ3.jpg

where graphic file with name gkf635equ3a.jpg, [Deq] = (B0 + T0 + K12 – Δ)/2, λ = [Deq]2/ B0T0, and K12 = k2/k1 is the dissociation constant discussed above. Since the concentration of molecular beacon–target duplex is unknown at any given time, it was assumed that F(t) – Fo / (Feq – Fo) = [D(t)/[Deq] where F(t) is the fluorescence intensity at time t, Fo is the initial fluorescence intensity and Feq is the fluorescence intensity as t → ∞. In order to obtain the on-rate k1 based on the fluorescence measurement, two different curve-fitting schemes were used. The first utilized a least-square method by fitting a straight line to a logarithmic form of equation 3

graphic file with name gkf635equ4.jpg

with a slope equal to k1. Alternatively, a non-linear least-square method was used to determine the value of k1 from equation 3 directly. The results obtained using these two approaches were compared.

RESULTS

Thermal analysis

Thermal denaturation profiles describing the behavior of molecular beacons in the absence of target were generated for analogous 2′-O-methyl and 2′-deoxy molecular beacons with a stem length of five bases and a probe length of 18 bases. As shown in Figure 1, at low temperatures, both types of molecular beacon were effectively quenched, showing low background fluorescence. Since the DNA stems were less stable than the 2′-O-methyl RNA stems, the DNA beacon was completely melted around 60°C with a melting temperature θm of 43°C, while the 2′-O-methyl RNA beacon did not fully melt until around 80°C with a θm of 65°C. Consequently, the increased stability of 2′-O-methyl hairpins implies that this class of molecular beacon should be made with a shorter stem than DNA beacons to maintain similar hybridization characteristics.

Figure 1.

Figure 1

Thermal denaturation profiles of 2′-O-methyl and 2′-deoxy molecular beacons with a stem length of five bases and a probe length of 18 bases in the absence of target.

The thermodynamic parameters describing the dissociation of the molecular beacon–target duplex also appear to depend on the specific type of duplex formed. As revealed by van’t Hoff plots shown in Figure 2, the affinity of 2′-O-methyl molecular beacons for RNA targets is higher than that of 2′-deoxy molecular beacons for RNA targets, which is in turn higher than the affinity of 2′-deoxy molecular beacons with DNA targets. Of the four possible combinations, the 2′-O-methyl molecular beacons/DNA target duplex is the least stable. Since at the melting temperature θ = θm of the molecular beacon/target duplex,

Figure 2.

Figure 2

Reciprocal of melting temperature as a function of R·ln(T0 – 0.5B0) indicating the changes in enthalpy (slope of the fitted line) and entropy (y-intercept) describing the transition between bound to RNA or DNA targets and free in the stem–loop conformation for 2′-O-methyl and 2′-deoxy molecular beacons (MB) with stem length of five bases and probe length of 18 bases.

graphic file with name gkf635equ5.jpg

the slope of the fitted straight line of each curve in Figure 2 represents the change in enthalpy –ΔH12 and the y-intercept represents the change in entropy ΔS12. To obtain more accurate values of ΔS12, θmRln(T0 – 0.5B0) versus θm curves were generated and fitted by straight lines. According to equation 5,

θmR ln(T0 – 0.5B0) = –ΔH12 + ΔS12 · θm,6

thus, the slope of each fitted straight line gave the corresponding value of ΔS12.

We found that the difference in ΔH12 and ΔS12 between the 2′-O-methyl/RNA duplex and the 2′-O-methyl/DNA duplex was substantial. For example, the 2′-O-methyl/RNA duplex exhibited a ΔH12 = 679 kJ/mol and a ΔS12 = 1798 J/mol·K whereas the 2′-O-methyl/DNA hybrid had a ΔH12 = 379 kJ/mol and a ΔS12 = 1041 J/mol·K. For a sample containing 200 nM of molecular beacons and 400 nM of target, this corresponds to a change of melting temperature from 80.0 to 51.9°C. The difference in the thermodynamic behavior of 2′-deoxy beacon/RNA target duplex and 2′-deoxy beacon/DNA target duplex was much smaller. Specifically, the 2′-deoxy beacon/RNA target duplex had a ΔH12 = 750 kJ/mol and a ΔS12 = 2078 J/mol·K and the 2′-deoxy beacon/DNA target duplex exhibited a ΔH12 = 691 kJ/mol and a ΔS12 = 1938 J/mol·K. For a sample containing 200 nM of molecular beacon and 400 nM of target, this corresponds to a change of melting temperature from 64.7 to 61.5°C.

Molecular beacon specificity

Melting curves, displaying the fraction of molecular beacon bound to target α as a function of temperature, were created for each beacon/target duplex to determine the ability of molecular beacons with different backbone chemistries to discriminate between wild-type and mutant targets. As demonstrated in Figure 3A, 2′-O-methyl molecular beacons formed much more stable duplexes with both the wild-type and mutant RNA targets than 2′-deoxy molecular beacons. However, the difference in melting temperature between molecular beacon/wild-type RNA duplexes and molecular beacon/mutant RNA duplexes is larger for the 2′-deoxy molecular beacons. The ability of 2′-O-methyl and 2′-deoxy molecular beacons to discriminate between wild-type and mutant RNA targets was further evaluated by calculating the difference between the fraction of molecular beacon bound to wild-type and mutant targets, αWT – αTarget B, for temperatures ranging from 0 to 100°C, shown in Figure 3B. It was found that the 2′-deoxy molecular beacons can discriminate between wild-type and mutant RNA targets over a wider range of temperatures and can obtain a slightly larger maximal difference in the fraction of beacon/wild-type target and beacon/mutant target duplexes. Therefore, the improved affinity of 2′-O-methyl molecular beacons for RNA targets is accompanied by reduced specificity.

Figure 3.

Figure 3

Figure 3

Melting behavior of 2′-O-methyl and 2′-deoxy molecular beacons with a stem length of five bases and a probe length of 18 bases in the presence of RNA targets. (A) Melting curves of 2′-O-methyl and 2′-deoxy beacons in the presence of wild-type and mutant RNA target. (B) The difference in the fraction of 2′-O-methyl and 2′-deoxy molecular beacons bound to wild-type and mutant RNA targets as a function of temperature.

In Figure 4A, the fraction α of 2′-O-methyl and 2′-deoxy molecular beacons bound to DNA targets as a function of temperature is displayed. The curves in Figure 4A revealed that the difference in melting behavior of 2′-O-methyl molecular beacons bound to wild-type and mutant targets is slightly larger than that of 2′-deoxy molecular beacons. This is accompanied by a slightly broader temperature range over which the molecular beacons can discriminate between wild-type and mutant DNA targets, as illustrated by Figure 4B where αWT – αTarget B is plotted as a function of temperature. However, the 2′-deoxy molecular beacons attained a slightly larger maximal difference in the fraction of beacon/wild-type target and beacon/mutant target duplexes, i.e. a larger peak value of αWT – αTarget B, as shown in Figure 4B.

Figure 4.

Figure 4

Figure 4

Melting behavior of 2′-O-methyl and 2′-deoxy molecular beacons with a stem length of five bases and a probe length of 18 bases in the presence of DNA targets. (A) Melting curves of 2′-O-methyl and 2′-deoxy beacons in the presence of wild-type and mutant DNA target. (B) The difference in the fraction of 2′-O-methyl and 2′-deoxy molecular beacons bound to wild-type and mutant DNA targets as a function of temperature.

Kinetic analysis

Previous studies have demonstrated that a linear 2′-O-methyl RNA probe hybridizes to a single-stranded RNA target more than twice as quickly than a DNA probe (14). However, for molecular beacons with a stem–loop hairpin structure, the rate of probe–target hybridization depends not only on the interaction between the probe and target but also on the stability of the hairpin structure. The rate limiting step of beacon/target hybridization is the energy barrier of stem opening. Specifically, with a longer and more stable stem, the hybridization on-rate is usually lower. As shown in Figure 5, the 2′-O-methyl molecular beacon was found to bind to single-stranded RNA targets 1.3 times more quickly than the 2′-deoxy molecular beacon. We also found that the 2′-O-methyl molecular beacon binds to an RNA target more than 4.5 times more quickly than it binds to a DNA target. The results shown in Figure 5 indicate that, among four different combinations, binding between 2′-deoxy molecular beacons and the complementary DNA target had the fastest rate of hybridization. The kinetic rate constants observed in this study were significantly lower than those reported for hybridization between linear oligonucleotides. This is most likely due to the energy barrier that must be overcome to open the stem–loop structure. Further, low salt concentrations were used in all of the thermodynamic and kinetic assays. In particular, MgCl2 was not added to the samples since, at the high temperatures used to generate the thermal denaturation profiles of molecular beacons, these cations result in degradation of the RNA targets.

Figure 5.

Figure 5

The hybridization on-rate for 2′-O-methyl and 2′-deoxy molecular beacons in the presence of wild-type RNA and DNA targets. Error bars represent the range of on-rate values calculated from five experiments.

DISCUSSION

Molecular beacons fluoresce upon binding to complementary nucleic acid targets, thus becoming a powerful tool in a variety of in vitro sequence detection and quantification assays. However, when performing real-time visualization of gene expression in living cells, significant false-positive signals and increased background fluorescence is generated by nuclease degradation, hairpin binding proteins and other events that disrupt the stem–loop structure. To overcome these difficulties, one can chemically modify the oligonucleotide backbone to reduce probe degradation significantly. False-positive signals can also be reduced through the use of a two-probe fluorescence resonance energy transfer (FRET) reporter system (12). Specifically, two molecular beacons, one with a donor dye and another with an acceptor dye, can be designed to hybridize to adjacent regions on the same target, resulting in FRET between the donor and acceptor. The detection of a FRET reporter signal enables discrimination between fluorescence due to probe/target hybridization and that of false-positive events. In this study we focused on the comparison between unmodified (2′-deoxy) and 2′-O-methyl modified molecular beacons, since 2′-O-methyl oligoribonucleotides bind RNA with higher affinity and faster kinetic hybridization rates, resist nuclease degradation and do not form a substrate for RNase H. The goal was to optimize the design of 2′-O-methyl molecular beacons so that they can survive the intracellular environment for a few hours, form stable duplexes with the target mRNA, and not interfere with the normal functions of the living cells under observation. These objectives require an understanding of the structure– function relationships of molecular beacons.

Considering the free energy differences for unbound molecular beacons and beacon–target duplexes provides insight into the structure–function relationships of molecular beacons. The formation of the stem–loop structure due to self-complementary arm sequences at the ends of a molecular beacon is driven by a favorable free energy difference, ΔGs. Likewise, binding between the probe and its complementary target is driven by a free energy difference, ΔGp. Both ΔGs and ΔGp values depend on the ionic strength of the buffer, temperature and the stem and probe length and sequence. Moreover, ΔGs and ΔGp values will depend on the type of hybrid formed. For example, 2′-O-methyl molecular beacons form a more stable stem–loop structure because of the 2′-O-methyl/2′-O-methyl interaction. Specifically, the formation of the stem of a 2′-O-methyl molecular beacon results in an RNA like C3′-endo conformation, with a larger free energy change ΔGs than that of the 2′-deoxy molecular beacon. Therefore, in the absence of target, the 2′-O-methyl molecular beacons exhibited a higher melting temperature and a lower level of background fluorescence over a large range of temperatures compared with the 2′-deoxy molecular beacon. The 2′-O-methyl modification of the molecular beacon backbone also resulted in a higher affinity for target mRNA in accordance with a higher ΔGp. The melting temperature of the 2′-O-methyl/RNA hybrid was found to be significantly higher than that of the 2′-deoxy/RNA hybrid.

Interestingly, although the stem–loop structure of the 2′-deoxy molecular beacons was less stable than that of 2′-O-methyl molecular beacons, they exhibited a slightly higher specificity and a slower rate of hybridization to target RNA. The specificity and kinetic rates of molecular beacons are determined by the competing reaction between the formation of a unimolecular hairpin structure and bimolecular beacon– target duplex, which are in turn dictated by the difference between ΔGs and ΔGp. Although for 2′-O-methyl molecular beacons both ΔGs and ΔGp are increased, it is likely that for 2′-deoxy molecular beacons the difference between ΔGs and ΔGp is smaller, resulting in improved specificity but reduced rates of hybridization.

In this study, molecular beacons were designed such that one arm of the stem participates in both hairpin formation and target hybridization (shared-stem molecular beacons). We have conducted a comparative study of the structure–function relationships of shared-stem and conventional molecular beacons and found out that shared-stem molecular beacons formed more stable duplexes with DNA target molecules than conventional molecular beacons; however, conventional molecular beacons may discriminate between wild-type and mutant targets with a higher specificity. The probe/target hybridization kinetics were found to be similar for both classes of molecular beacon (22). It is likely that the general trends revealed in this study concerning the thermodynamic and kinetic features of 2′-O-methyl and 2′-deoxy shared-stem molecular beacons apply to conventional molecular beacons as well.

Recently, evidence suggests that not all of the 2′-O-methyl molecular beacons retain a stem–loop structure in living cells, possibly due to nucleic acid binding proteins that disrupt the hairpin (5,6). Although denaturation of the stem–loop structure would eliminate the improved specificity of molecular beacons, dual-labeled linear probes still demonstrate an increase in fluorescence upon binding to target (23). The signal-to-background of the 2′-O-methyl molecular beacons may be further improved by using donor and acceptor beacons in a FRET-based detection assay. Other chemical modifications may be beneficial in this setting, such as phosphorothioate internucleoside linkages or a combination of phosphorothioate chemistry with 2′-O-methyl RNA.

Acknowledgments

ACKNOWLEDGEMENTS

We thank John M. Nickerson for his help in conducting the stopped-flow experiments, Andrei Laikhter, Scott Rose and Erin Edgar for assistance with oligonucleotide synthesis. This work was supported in part by NSF grant BSE-0222211, a seed grant from the Wallace H. Coulter Foundation and a Cutting Edge Research Award from Georgia Institute of Technology.

REFERENCES

  • 1.Tyagi S. and Kramer,F.R. (1996) Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol., 14, 303–308. [DOI] [PubMed] [Google Scholar]
  • 2.Bonnet G., Tyagi,S., Libchaber,A. and Kramer,F.R. (1999) Thermodynamic basis of the enhanced specificity of structured DNA probes. Proc. Natl Acad. Sci. USA, 96, 6171–6176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Matsuo T. (1998) In situ visualization of messenger RNA for basic fibroblast growth factor in living cells. Biochim. Biophys. Acta, 1379, 178–184. [DOI] [PubMed] [Google Scholar]
  • 4.Sokol D.L., Zhang,X., Lu,P. and Gewirtz,A.M. (1998) Real time detection of DNA.RNA hybridization in living cells. Proc. Natl Acad. Sci. USA, 95, 11538–11543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dirks R.W., Molenaar,C. and Tanke,H.J. (2001) Methods for visualizing RNA processing and transport pathways in living cells. Histochem. Cell Biol., 115, 3–11. [DOI] [PubMed] [Google Scholar]
  • 6.Molenaar C., Marras,S.A., Slats,J.C., Truffert,J.C., Lemaitre,M., Raap,A.K., Dirks,R.W. and Tanke,H.J. (2001) Linear 2′ O-methyl RNA probes for the visualization of RNA in living cells. Nucleic Acids Res., 29, e89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Li J.J., Geyer,R. and Tan,W. (2000) Using molecular beacons as a sensitive fluorescence assay for enzymatic cleavage of single-stranded DNA. Nucleic Acids Res., 28, e52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fisher T.L., Terhorst,T., Cao,X. and Wagner,R.W. (1993) Intracellular disposition and metabolism of fluorescently-labeled unmodified and modified oligonucleotides microinjected into mammalian cells. Nucleic Acids Res., 21, 3857–3865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Leonetti J.P., Mechti,N., Degols,G., Gagnor,C. and Lebleu,B. (1991) Intracellular distribution of microinjected antisense oligonucleotides. Proc. Natl Acad. Sci. USA, 88, 2702–2706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Uchiyama H., Hirano,K., Kashiwasake-Jibu,M. and Taira,K. (1996) Detection of undegraded oligonucleotides in vivo by fluorescence resonance energy transfer. Nuclease activities in living sea urchin eggs. J. Biol. Chem., 271, 380–384. [DOI] [PubMed] [Google Scholar]
  • 11.Kuhn H., Demidov,V.V., Coull,J.M., Fiandaca,M.J., Gildea,B.D. and Frank-Kamenetskii,M.D. (2002) Hybridization of DNA and PNA molecular beacons to single-stranded and double-stranded DNA targets. J. Am. Chem. Soc., 124, 1097–1103. [DOI] [PubMed] [Google Scholar]
  • 12.Tsourkas A. and Bao,G. (2001) Detecting mRNA transcripts using FRET-enhanced molecular beacons. In Proceedings of the 2001 Bioengineering Conference, ASME BED, Vol. 50, pp. 169–170.
  • 13.Mitchell P. (2001) Turning the spotlight on cellular imaging. Nat. Biotechnol., 19, 1013–1017. [DOI] [PubMed] [Google Scholar]
  • 14.Majlessi M., Nelson,N.C. and Becker,M.M. (1998) Advantages of 2′-O-methyl oligoribonucleotide probes for detecting RNA targets. Nucleic Acids Res., 26, 2224–2229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cummins L.L., Owens,S.R., Risen,L.M., Lesnik,E.A., Freier,S.M., McGee,D., Guinosso,C.J. and Cook,P.D. (1995) Characterization of fully 2′-modified oligoribonucleotide hetero- and homoduplex hybridization and nuclease sensitivity. Nucleic Acids Res., 23, 2019–2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zamaratski E., Pradeepkumar,P.I. and Chattopadhyaya,J. (2001) A critical survey of the structure–function of the antisense oligo/RNA heteroduplex as substrate for RNase H. J. Biochem. Biophys. Methods, 48, 189–208. [DOI] [PubMed] [Google Scholar]
  • 17.Teplova M., Minasov,G., Tereshko,V., Inamati,G.B., Cook,P.D., Manoharan,M. and Egli,M. (1999) Crystal structure and improved antisense properties of 2′-O-(2-methoxyethyl)-RNA. Nature Struct. Biol., 6, 535–539. [DOI] [PubMed] [Google Scholar]
  • 18.Manoharan M. (1999) 2′-carbohydrate modifications in antisense oligonucleotide therapy: importance of conformation, configuration and conjugation. Biochim. Biophys. Acta, 1489, 117–130. [DOI] [PubMed] [Google Scholar]
  • 19.Tsuji A., Koshimoto,H., Sato,Y., Hirano,M., Sei-Iida,Y., Kondo,S. and Ishibashi,K. (2000) Direct observation of specific messenger RNA in a single living cell under a fluorescence microscope. Biophys. J., 78, 3260–3274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ratilainen T., Holmen,A., Tuite,E., Haaima,G., Christensen,L., Nielsen,P.E. and Norden,B. (1998) Hybridization of peptide nucleic acid. Biochemistry, 37, 12331–12342. [DOI] [PubMed] [Google Scholar]
  • 21.Xia T., SantaLucia,J.,Jr, Burkard,M.E., Kierzek,R., Schroeder,S.J., Jiao,X., Cox,C. and Turner,D.H. (1998) Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson–Crick base pairs. Biochemistry, 37, 14719–14735. [DOI] [PubMed] [Google Scholar]
  • 22.Tsourkas A., Behlke,M.A. and Bao,G. (2002) Structure–function relationships of shared-stem and conventional molecular beacons. Nucleic Acids Res., 30, 4208–4215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Livak K.J., Flood,S.J., Marmaro,J., Giusti,W. and Deetz,K. (1995) Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl., 4, 357–362. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES