A Scan of Chromosome 10 Identifies a Novel Locus Showing Strong Association with Late-Onset Alzheimer Disease

Abstract

Strong evidence of linkage to late-onset Alzheimer disease (LOAD) has been observed on chromosome 10, which implicates a wide region and at least one disease-susceptibility locus. Although significant associations with several biological candidate genes on chromosome 10 have been reported, these findings have not been consistently replicated, and they remain controversial. We performed a chromosome 10–specific association study with 1,412 gene-based single-nucleotide polymorphisms (SNPs), to identify susceptibility genes for developing LOAD. The scan included SNPs in 677 of 1,270 known or predicted genes; each gene contained one or more markers, about half (48%) of which represented putative functional mutations. In general, the initial testing was performed in a white case-control sample from the St. Louis area, with 419 LOAD cases and 377 age-matched controls. Markers that showed significant association in the exploratory analysis were followed up in several other white case-control sample sets to confirm the initial association. Of the 1,397 markers tested in the exploratory sample, 69 reached significance (P<.05). Five of these markers replicated at P<.05 in the validation sample sets. One marker, rs498055, located in a gene homologous to RPS3A (LOC439999), was significantly associated with Alzheimer disease in four of six case-control series, with an allelic P value of .0001 for a meta-analysis of all six samples. One of the case-control samples with significant association to rs498055 was derived from the linkage sample (P=.0165). These results indicate that variants in the RPS3A homologue are associated with LOAD and implicate this gene, adjacent genes, or other functional variants (e.g., noncoding RNAs) in the pathogenesis of this disorder.

Alzheimer disease (AD [MIM 104300]) is the most significant cause of dementia in developed countries and is clinically characterized by memory loss of subtle onset followed by a slowly progressive dementia that has a course of several years. The risk of AD has a genetic component, as evidenced by an increased risk of AD among first-degree relatives of affected individuals. So far, three genes have been identified that lead to the rare autosomal dominant early-onset form of AD. Mutations in the three genes—β-amyloid precursor protein (APP [MIM 104760]) (Goate et al. 1991), presenilin 1 (PSEN1 [MIM 104311]) (Sherrington et al. 1995), and presenilin 2 (PSEN2 [MIM 600759]) (Levy-Lahad et al. 1995)—lead to an increase in the production of long amyloid β peptide (Aβ42), the main component in amyloid plaques. The great majority of AD cases are of late onset (age at onset >65 years) and show complex, non-Mendelian patterns of inheritance. Late-onset AD (LOAD [MIM 606626]) probably results from the combined effects of variation in a number of genes as well as from environmental factors. Early genetic studies of LOAD demonstrated that the ɛ4 variant of APOE (MIM 107741) is associated with increased risk of LOAD and with lower age at disease onset in a dose-dependent manner (Corder et al. 1993).

Genomewide linkage screens in patients with LOAD have identified several other chromosomal regions (reviewed by Pastor and Goate [2004]), implying that genetic risk factors other than APOE must exist. Putative LOAD-susceptibility loci on chromosomes 9, 10, and 12 have been reported in two or more sample sets by different groups (Pericak-Vance et al. 1997, 2000; Rogaeva et al. 1998; Kehoe et al. 1999; Myers et al. 2000, 2002; Blacker et al. 2003). Perhaps the most prominent among them is the linkage to chromosome 10, observed in a number of nonoverlapping samples from studies employing distinct approaches, including linkage analysis based on a genomewide screen, a candidate gene–based limited genome screen, and a genome screen that used plasma Aβ levels as a quantitative phenotype (Kehoe et al. 1999; Bertram et al. 2000; Ertekin-Taner et al. 2000; Myers et al. 2000; Blacker et al. 2003; Farrer et al. 2003). Several candidate genes that are under or near the chromosome 10 linkage peaks have been tested for association with LOAD, but none has been consistently replicated (Alzheimer Disease Forum).

To identify the genes and mutations for LOAD, we undertook a screen of putative functional SNPs in 677 genes under the linkage peak, using a powerful set of unrelated cases and controls. A similar approach was used to identify the glyceraldehyde-3-phosphate dehydrogenase gene (GAPD [MIM 138400]), located on the short arm of chromosome 12, as a putative LOAD risk gene (Li et al. 2004). Here, we report the findings from this scan of 1,412 SNPs on chromosome 10.

Material and Methods

Sample-Set Characteristics

Three white clinical case-control series were used in this study: (1) the WU series (422 cases; 382 controls), collected through the Washington University Alzheimer’s Disease Research Center (ADRC) patient registry; (2) the UK series (368 cases; 404 controls), collected as part of the Medical Research Council (MRC) Late-Onset AD Genetic Resource, including those from the Cardiff University Wales School of Medicine and from King’s College London; and (3) the UCSD series (217 cases; 409 controls), collected through the ADRC of the University of California–San Diego. In total, 1,007 AD cases and 1,195 controls were analyzed. Cases in these series had received a clinical diagnosis of dementia of the Alzheimer type (DAT), with use of criteria equivalent to NINCDS-ADRDA (National Institute of Neurological and Communicative Diseases and Stroke/Alzheimer's Disease and Related Disorders Association) (McKhann et al. 1984) but modified slightly to include AD as a diagnosis for individuals aged >90 years (Berg et al. 1998). The minimum age at onset of DAT was 60 years. Controls were nondemented individuals aged >60 years at assessment who were screened for dementia through use of neuropsychological tests and clinical interviews. Controls were matched with cases for age and sex. These samples all show an expected age and APOE ɛ4–genotype distribution and do not appear to have evidence of population stratification (Li et al. 2004). More-detailed information about these samples can be found elsewhere (Li et al. 2005).

A fourth case-control series was generated by selecting one case per family from our genetic linkage sample (Myers et al. 2002) and matching each of them to an equal number of white, nondemented controls collected in St. Louis (these controls are independent of the controls used in the exploratory sample above). There were 429 cases and 321 controls in this series (mean age at onset for the case series is 73.6 years; mean age at assessment for controls is 75.0 years). The linkage pedigrees from the National Institute of Mental Health (NIMH) series and the NIA series (292 pedigrees; 624 affected individuals) (Myers et al. 2002) were also genotyped for the single SNP significant in all case-control series.

Two small series that consisted of neuropathologically confirmed white cases and controls were derived from the U.S. ADRCs (contributing centers are listed in the Acknowledgments) and from Newcastle upon Tyne, United Kingdom. Of the samples in the U.S. series, 40% were assessed as being at either Braak and Braak stage 5 or 6 (cases) or Braak stage 2 or less (controls). The remaining samples (cases) met neuropathological criteria for AD. Both the controls and cases were selected to be largely free of such complicating pathologies as Lewy bodies and vascular events. The combined series included 360 cases (age range 65–97 years; 220 women) and 252 controls (age range 65–100 years; 123 women).

SNP Selection and Genotyping

Genotyping of all samples was performed with written informed consent/assent from the participating individuals and their caregivers and approval from the participating institutions. Polymorphisms used for genotyping were identified from either the Celera human genome database that includes publicly available SNP data or the Applera Genome Sequencing Initiative database. For this study, we chose gene-based SNPs, with a preference for putative functional mutations, as predicted in the Celera or public SNP databases, with the aim to screen as many predicted genes with at least one variant as possible (table A1 and fig. A1 [online only]). Thus, these SNPs consist of 367 missense/nonsense mutations, 1 donor splice-site variant, 172 putative transcription factor binding site mutations, 9 exon-skipping site variants, 109 variants in the UTR, and 739 variants of other types (intronic, silent, and unknown types [SNPs of unknown and silent types were annotated as functional variants in previous genome assemblies]). They cover a total of 677 of 1,270 annotated genes on chromosome 10. All genomic positions for all SNPs and genes are from the Celera Genome Assembly R27. All SNPs had a minor-allele frequency (MAF) of >2% in either cases or controls. The MAF was 2%–5% for 80 exploratory markers and 5%–10% for 165 markers. The remaining markers had MAFs of 10%–50%, with approximately equal numbers of SNPs in each 10% interval.

Genotyping of SNPs was undertaken by allele-specific real-time PCR for individual samples, by use of primers designed and validated in-house (Germer et al. 2000). Cases and controls were always run on the same plate in a blind fashion. Assay quality was scored by an individual who had no access to the sample phenotypes, before the genotyping results were subjected to statistical analysis. Overall, the accuracy of our genotyping was >99%, as determined by internal comparisons of differentially designed assays for the same marker and by comparisons of the same marker across different groups.

Genotyping was performed in stages—markers were first genotyped in one sample set, the exploratory set. Generally, the WU sample set was used as the exploratory sample set. However, when markers were tested for replication in another sample set, we also genotyped that sample set with novel assays that had passed our assay-validation step. Overall, we used the UK sample (105 assays) and the UCSD sample (1 assay) as exploratory sets for <8% of all tested assays. Significant exploratory markers (P<.05) were then genotyped in two additional clinical case-control series. After replication in at least one of these other sample sets, additional fine-mapping markers were genotyped near the replicated SNPs. When additional assays for markers near significant exploratory markers were immediately available, they were genotyped in the exploratory sample in parallel with attempting to replicate in the validation samples. Significant markers were followed up as described above. Five SNPs that showed some level of replication in one or both of the additional case-control series were genotyped in a case-control series derived from the families originally used for our genomewide linkage scan. One of these SNPs (rs498055) was also genotyped in the case-control series that was composed of neuropathologically confirmed AD cases and controls.

Statistical Analysis

To help exclude assays with possible genotyping errors from the analysis, Hardy-Weinberg equilibrium tests were first performed in both the case and the control samples. Assays with significant deviation from Hardy-Weinberg equilibrium in controls were then examined for genotyping quality (P<.05; 63 markers in the exploratory stage). As a result, two assays were dropped from our analysis. One remaining assay with an MAF <10% was significant in the exploratory set but did not validate in the other sample sets and was in Hardy-Weinberg equilibrium.

Pearson’s χ² test was used to calculate P values for the association of an allele with disease status within a single study. This test of association was performed on the basis of the frequency counts of a 2×2 contingency table of allele and disease status. Two-sided P values are presented for the exploratory study. In the validation stage, one-sided P values were calculated if the odds ratios (ORs) were in the direction observed in the exploratory stage. P values were not adjusted for multiple comparisons unless otherwise stated. ORs and the 95% CIs for an allelic effect were also estimated. ORs and P values for meta-analyses that combine results of multiple sample sets were calculated using the Cochran-Mantel-Haenszel test, and were controlled for the sample set (Agresti 1990). Evidence of replication, rather than multiple testing corrections, was used to evaluate the significance of associated SNPs.

Linkage Analysis

To determine whether rs498055 contributed to our linkage signal on chromosome 10, we stratified families on the basis of the presence or absence of the risk allele of rs498055 in the proband of each family. The families used in this analysis were the NIMH and the National Cell Repository for Alzheimer's Disease families from our linkage screen (Myers et al. 2002). The analysis was performed in Mapmaker/SIBS (“All pairs, UNWEIGHTED”). For the “proband” analysis, the (numerically) first individual with the SNP genotype was identified as the proband.

Haplotype Analysis

Several studies have shown that placing individual SNPs into the context of a haplotype increases biological information (Balciuniene et al. 2002; Knoblauch et al. 2002; Van Eerdewegh et al. 2002). Similarly, placing haplotypes into their evolutionary context also increases biological information (Templeton et al. 2005). For the haplotype analysis, we used SNPs that were typed in all three series and were located within ∼40 kb of rs498055. These criteria resulted in a data set of 11 SNPs in 1,159 controls and 974 cases from the WU, UK, and UCSD case-control samples.

Haplotypes were estimated using the software PHASE (Stephens et al. 2001; Stephens and Donnelly 2003). A set of 95%-plausible haplotype trees was estimated using statistical parsimony in the program TCS (Clement et al. 2000; Templeton et al. 2000).

Association with LOAD was tested by tree scanning (Templeton et al. 2005), which was modified to manage case-control data (Nowotny et al. 2005). A tree scan uses the haplotype network to define tests that are based on each branch of the tree. Each branch represents an a priori defined pooling of haplotypes: haplotypes on one side of the branch are pooled together and define an allele, whereas the haplotypes on the other side are pooled to define a separate allele. This results in a biallelic locus that can be tested for association with the phenotype. A permutation-based analog of the sequential Bonferroni (Westfall and Young 1993) was used to obtain nominal and multiple-test–corrected significance values with the parametric P value used as the test statistic. This permutation method takes into account the correlation structure between tests while correcting for multiple tests.

Results

To identify genetic variation associated with LOAD on chromosome 10, we performed a SNP-based association study with three well-characterized LOAD case-control series. Our strategy was to test markers in one sample set (exploratory sample) and to follow up significant markers in the two remaining sample sets (validation samples). Using this paradigm, we first scanned a relatively large number of gene-based putative functional SNPs across chromosome 10, with the highest SNP density in regions directly under the linkage peak reported above. Significant markers were then genotyped in the other two sample sets to attempt replication of the initial association. Regions with markers showing strong association with the exploratory sample and replication in at least one other sample set were then tested with additional markers. Specifically, we genotyped a total of 1,397 SNPs by allele-specific PCR in the exploratory stage (fig. 1), targeting 674 genes. From these, we genotyped 408 genes with 1 marker, 141 with 2 markers, 57 with 3 markers, 47 with 4–7 markers, and the remainder with ⩾8 markers. The majority of exploratory markers (1,291) were tested in the WU sample set. In the UK sample set, 105 markers were genotyped, and 1 marker was genotyped in the UCSD sample set. Of the 1,397 tested SNPs, 69 were significantly associated with LOAD in the exploratory sample (P<.05). These markers were scattered across the chromosome, as would be expected because of the high probability of false-positive associations due to the large number of SNPs analyzed (fig. 1). We subsequently genotyped the 69 markers in the two validation sample sets and found 5 that replicated in a meta-analysis combining the two validation sample sets (one-sided P<.05) (table 1). One marker, rs498055, located in LOC439999, a gene with high homology to RPS3A (MIM 180478), was significant (P<.05) in each of the three sample sets and was the most significant (P=.00004) marker in the three-sample meta-analysis (table 1). One other marker, rs4417206, located in a neighboring gene ALDH18A1 (or PYCS [MIM 138250]), was also significant in the combined validation study (P=.013). Markers rs4417206 in ALDH18A1 and rs498055 in LOC439999 are ∼41 kb apart and are in strong linkage disequilibrium (LD) with one another (D^′=0.98; r²=0.43).

Figure 1.

Allelic P values of 1,397 exploratory markers from the exploratory sample (middle), with a bar graph showing the distribution of annotated genes across chromosome 10 (bottom). Marker rs498055 is noted with an arrow, and a P value of .05 is marked with a line. The previously identified linkage peak regions are noted with solid lines and references (top). Studies with multipoint LOD scores >2 in white samples were included. Results of single-marker studies were not included.

Table 1.

Allelic Tests of Replicated Markers and LOAD

	Cases					Controls
	No. with Genotype					No. with Genotype
Marker, Gene, Position (bp) and Sample	11	12	22	Total	MAF(%)	11	12	22	Total	MAF(%)	P	OR (CIa)	Power to Replicate
rs1057971, PCGF5, 86733401:
WUb	2	54	363	419	6.9	0	33	344	377	4.4	.029	1.62 (1.05–.52)	…
UCSDc	2	33	213	248	7.5	2	37	360	399	5.1	.044	1.49 (1.01–.19)	.61
UKc	1	39	307	347	5.9	3	32	345	380	5.0	.22	1.19 (.82–.75)	.66
UCSD and UKc	3	72	520	595	6.6	5	69	705	779	5.1	.042	1.33 (1.01–.74)	.88
All	5	126	883	1,014	6.7	5	102	1,049	1,156	4.8	.0068	1.43 (1.10–.85)	…
rs498055, LOC439999, 91096111:
UKb	80	175	92	347	48.3	67	194	124	385	42.6	.029	1.26 (1.02–.55)	…
UCSDc	64	107	48	219	53.7	85	156	102	343	47.5	.022	1.28 (1.04–.56)	.59
WUc	125	175	89	389	54.6	65	200	86	351	47.0	.0017	1.36 (1.14–.61)	.71
UCSD and WUc	189	282	137	608	54.3	150	356	188	694	47.3	.00021	1.32 (1.16–.51)	.89
All	269	457	229	955	52.1	217	550	312	1,079	45.6	.00004	1.3 (1.15–.47)	…
rs4417206, ALDH18A1, 91137678:
UKb	36	153	158	347	32.4	61	169	154	384	37.9	.029	.79 (.63–.98)	…
UCSDc	17	102	101	220	30.9	50	157	142	349	36.8	.021	.77 (.62–.95)	.59
WUc	45	155	190	390	31.4	38	165	148	351	34.3	.12	.88 (.73–.05)	.71
UCSD and WUc	62	257	291	610	31.2	88	322	290	700	35.6	.013	.83 (.72–.95)	.90
All	98	410	449	957	31.7	149	491	444	1,084	36.4	.0019	.81 (.71–.93)	…
rs600879, SORCS1, 102662200:
WUb	6	87	325	418	11.8	4	54	319	377	8.2	.017	1.5 (1.07–.09)	…
UCSDc	3	42	196	241	10.0	6	53	335	394	8.2	.15	1.23 (.89–.71)	.67
UKc	6	66	277	349	11.2	3	63	319	385	9.0	.079	1.28 (.96–.70)	.74
UCSD and UKc	9	108	473	590	10.7	9	116	654	779	8.6	.040	1.26 (1.01–.56)	.92
All	15	195	798	1,008	11.2	13	170	973	1,156	8.5	.0043	1.34 (1.10–.65)	…
rs1903908, hCG2039140, 102940843:
WUb	14	97	308	419	14.9	5	77	294	376	11.6	.050	1.34 (1.00–.80)	…
UCSDc	6	54	188	248	13.3	2	81	314	397	10.7	.079	1.28 (.96–.71)	.53
UKc	11	78	247	336	14.9	10	76	296	382	12.6	.10	1.22 (.94–.57)	.57
UCSD and UKc	17	132	435	584	14.2	12	157	610	779	11.6	.029	1.24 (1.03–.50)	.80
All	31	229	743	1,003	14.5	17	234	904	1,155	11.6	.0070	1.28 (1.07–.53)	…

^a95% CI for exploratory and total samples; 90% CI for validation samples.

^bExploratory sample set.

^cValidation sample set: one-sided P value.

To determine whether any of the five SNPs that replicated in the meta-analysis (rs1057971, rs498055, rs4417206, rs600879, and rs1903908) were also associated with risk for LOAD in our original linkage study sample (Myers et al. 2002), we genotyped the entire series and performed two analyses. First, we used a case-control approach by selecting one case (proband) per family, and we matched each of them to an equal number of unrelated controls. We chose to use a case-control analysis rather than a discordant–sib-pair analysis because of the greater power in the case-control design and because discordant siblings were available for only a proportion of the cases. A one-sided χ² test demonstrated significant evidence of association in the case-control sample with the same allele as in the other case-control series for rs498055 (P=.0165); all other SNPs failed to show any evidence of association (table 2). The ORs observed in the linkage series for rs498055 were similar to those observed in the other case-control series (OR=1.26; 95% CI 1.02–1.54).

Table 2.

Allelic Association in Linkage Case-Control Series^[Note]

		No. of Cases with Genotype			No. ofControlswith Genotype
Marker	Location(Mb)	11	12	22	11	12	22	Pa	OR (95% CI)
rs1057971	86.7	1	35	304	0	41	302	.73	.91 (.57–1.43)
rs498055	91.09	110	207	112	58	162	96	.017	1.26 (1.02–1.54)
rs4417206	91.13	45	163	145	59	139	131	.24	.87 (.70–1.09)
rs600879	102.66	285	62	6	275	56	8	1	1.01 (.72–1.43)
rs1903908	102.94	13	87	265	6	84	252	.45	1.12 (.84–1.51)

Note.— For cases, one affected sibling was genotyped from each family in the linkage sample (Myers et al. 2002) and was compared with a set of independent controls.

^aAllelic tests are two sided except for rs498055.

Marker rs498055 was also examined in two small series (183 cases/127 controls; 160 cases/106 controls) of neuropathologically confirmed cases and controls. The SNP was not associated with AD risk in these samples (P=.63 and P=.21, respectively). However, power to replicate our finding in these samples was low (40% and 36%, respectively; 60% power in the combined sample sets).

To further estimate the effect of rs498055 in the linkage sample, we performed a stratified linkage analysis of the stage II linkage data, on the basis of the genotype of the proband of each pedigree. We performed stratified linkage analyses using the pedigrees in which the proband had a copy of allele A and pedigrees in which the proband had a copy of allele G (table 3). We also considered pedigrees in which the proband was a homozygote for the A allele and in which the proband was a homozygote for the G allele. The results did not show an increase in LOD score in probands with the risk allele. In fact, although the first two groups were roughly the same size, the LOD score was substantially smaller in pedigrees in which the proband had a copy of the risk allele. This suggests that the rs498055 polymorphism (at 91.1 Mb) may have little direct effect on the linkage findings, which have their peak near D10S1211 (at 59.9 Mb), and that other loci contributing to disease have yet to be found in this region.

Table 3.

Linkage Analysis of Pedigrees Stratified by rs498055

Sample	No. of Pedigrees	No. Affected	Peak LOD	Location(cM)
All	343	733	3.84	68
Pedigrees with SNPs	292	624	3.18	68
Probands with A	228	488	3.37	68
Probands with G	221	471	2.38	50
Probands without A	64	136	.73	90
Probands without G	71	153	1.18	67

These findings prompted us to focus further follow-up on the region flanking these two genes. A total of 53 markers, covering a 1.49-Mb region, were typed in the exploratory sample, and association of these SNPs was examined. Ten of the markers resulted in a P value <.1 in the exploratory sample, and five were significant at P<.05 (fig. 2). After genotyping these markers in the validation samples, rs498055 remained the only marker that was significantly associated with LOAD in each of the three sample sets.

Figure 2.

Allelic P values of markers around the RPS3A homologue region (LOC43999) in both exploratory and validation samples, along with a gene map of the region and Celera assembly coordinates (in Mbp). Blue diamonds indicate two-sided explatory sample P values; the other symbols indicate one-sided replication sample P values for WU (red squares), UCSD (gray triangles), and UK (green circle).

We examined LD structure in this region, using genotypes from the UK and the WU sample sets. We observed a block of high LD extending from rs500470 to rs1418709, covering at least 190 kb of the genomic region that includes the most-significant markers, rs498055 and rs4417206. Although the D′ values among neighboring SNPs were high, the r² values were generally low (table 4). The LD structure was comparable between cases and controls. The five significant markers with a P value <.05 (rs500470, rs533343, rs495998, rs498055, and rs4417206) were all located within this block and exhibited higher r² values with rs498055 than with other neighboring SNPs. (All had r²>0.43 with rs498055.) Comparison of these results with data in the HapMap project indicates that the block containing rs498055 extends 419 kb and contains seven genes, LOC439999, ALDH18A1 (MIM 138250), C10orf61, ENTPD1 (MIM 601752), hCG2023951, hCG1781136, and C10orf130.

Table 4.

Measures of Pairwise D′ and r² in UK Controls^[Note]

Marker	Distance	rs500470	rs533383	rs533343	rs11594687	rs7895441	rs495998	rs17110999	rs7906450	rs498055	rs2296690	rs1804934	rs749049	hDV68531050	rs2986401	rs2275272	rs4417206	rs11188410	rs10882645	hDV68531048	rs11553577	hCV25943811	rs1418709
rs500470	.00		1.00	1.00	1.00	1.00	.89	1.00	1.00	.88	.95	1.00	.12	.92	.20	1.00	.98	1.00	.18	.92	.96	.92	.02
rs533383	5.78	.99		.99	1.00	1.00	.89	1.00	1.00	.88	.95	1.00	.11	.92	.20	1.00	.98	.96	.19	.92	.93	.92	.03
rs533343	.01	.74	.73		1.00	.66	.99	1.00	.92	.98	1.00	1.00	.04	1.00	.19	1.00	.98	1.00	.16	1.00	.97	1.00	.20
rs11594687	4.03	.07	.07	.05		1.00	1.00	1.00	1.00	1.00	1.00	.68	1.00	.05	1.00	1.00	1.00	1.00	1.00	.05	1.00	.05	1.00
rs7895441	1.40	.37	.37	.22	.03		1.00	1.00	.94	.98	1.00	.76	.50	.95	.63	1.00	1.00	.62	.60	.95	.25	.95	.88
rs495998	5.76	.54	.54	.48	.11	.25		1.00	1.00	.99	.77	1.00	.37	.91	.09	.76	.99	1.00	.09	.91	.94	.91	.23
rs17110999	2.17	.26	.27	.36	.02	.72	.18		1.00	1.00	1.00	.16	1.00	1.00	.96	1.00	1.00	.26	.94	1.00	.04	1.00	.86
rs7906450	5.57	.28	.28	.32	.02	.68	.19	.94		1.00	.85	.27	1.00	1.00	.90	1.00	1.00	.39	.95	1.00	.17	1.00	.87
rs498055	1.49	.52	.51	.47	.11	.24	.98	.18	.19		.78	1.00	.37	.91	.08	.77	.98	.94	.08	.91	.89	.91	.23
rs2296690	16.03	.09	.09	.07	.69	.04	.10	.03	.02	.10		1.00	.87	.44	1.00	1.00	1.00	1.00	.86	.44	1.00	.44	1.00
rs1804934	.20	.04	.04	.05	.00	.00	.02	.00	.00	.02	.00		1.00	1.00	1.00	.99	.98	1.00	1.00	1.00	1.00	1.00	1.00
rs749049	4.96	.01	.01	.00	.10	.06	.11	.19	.20	.11	.11	.02		1.00	.04	1.00	1.00	1.00	.02	1.00	.83	1.00	.41
hDV68531050	.02	.06	.06	.02	.00	.18	.04	.01	.01	.04	.00	.00	.04		1.00	.32	1.00	.93	1.00	1.00	.63	1.00	1.00
rs2986401	6.55	.03	.03	.04	.05	.19	.00	.33	.30	.00	.07	.01	.00	.02		1.00	1.00	1.00	.99	1.00	1.00	1.00	.94
rs2275272	5.51	.09	.09	.07	.74	.03	.09	.02	.03	.09	.94	.00	.13	.00	.07		1.00	1.00	1.00	.32	1.00	.32	1.00
rs4417206	8.31	.30	.29	.21	.05	.11	.44	.08	.09	.43	.07	.01	.54	.02	.23	.07		1.00	1.00	1.00	.86	1.00	.91
rs11188410	.09	.14	.13	.19	.01	.01	.10	.00	.00	.09	.01	.00	.08	.00	.04	.01	.04		1.00	.93	1.00	.93	1.00
rs10882645	7.81	.03	.03	.03	.05	.17	.00	.31	.33	.00	.06	.01	.00	.02	.95	.07	.23	.04		1.00	1.00	1.00	.94
hDV68531048	12.0	.06	.06	.02	.00	.18	.04	.01	.01	.04	.00	.00	.04	1.00	.02	.00	.02	.00	.02		.63	1.00	1.00
rs11553577	37.1	.14	.13	.19	.01	.00	.09	.00	.00	.08	.02	.00	.06	.00	.05	.01	.03	.95	.05	.00		.63	.94
hCV25943811	.24	.06	.06	.02	.00	.18	.04	.01	.01	.04	.00	.00	.04	1.00	.02	.00	.02	.00	.02	1.00	.00		1.00
rs1418709	65.0	.00	.00	.02	.11	.18	.05	.12	.13	.05	.15	.02	.16	.05	.42	.14	.41	.09	.42	.05	0	.05

Note.— Measures of pairwise D′ are shown above the diagonal; r² values are shown below the diagonal.

The tree-scan analysis of 11 SNPs in the region surrounding rs498055 identified significant results across many branches of the haplotype network. However, the results of the conditional tests suggest that the association observed at these branches is due to their location in the network relative to a single branch. This branch was significant in both the original (P=.0008) and the conditional (P=.03) analyses (fig. 3). It is marked by mutations creating the SNPs rs498055 and rs495998.

Figure 3.

Haplotype networks. Each oval contains the haplotype identification number, the state at each locus, and the number of times it was inferred to occur in this sample set. To simplify the presentation of the network, haplotypes that appear only once in the sample are not shown, and selected haplotypes have been collapsed. The branch that was significant in the tree scan is denoted by the dashed line. P values for the original and conditional analyses are also provided. Mutations at rs498055 are indicated by “T⟷C”; the mutation at rs495998 is indicated by “A⟷C.”

Discussion

Genetic variants in several biological candidate genes under or near the chromosome 10 linkage peaks—including mutations in CTNNA3 (MIM 607667), PLAU (MIM 191840), IDE (MIM 146680), and others—have been reported to be associated with LOAD. However, none of the associations in these candidate genes has been consistently replicated (Alzheimer Disease Forum). Indeed, our own studies in the case-control series used in the present study showed no evidence of association with any of these genes (Myers et al. 2004; Nowotny et al. 2005). These findings suggest that the reported association may be false, although it remains possible that the lack of consistent replication may be due to type 1 error, genetic heterogeneity, population stratification, and/or a small genetic effect confounded by sample sizes insufficient to replicate the initial reports. With the technology that was available to us, we performed a broadly scaled and nonbiased genotyping program. This approach would inevitably be burdened by a requirement of multiple-testing corrections to assess potential associations. To mitigate this, we designed a two-step process in which we genotyped ∼1,400 SNPs in the exploratory sample set but only 69 markers in the subsequent validation sample sets. This strategy led us to identify five SNPs, located in five genes on chromosome 10, that are associated with LOAD. Although our genotyping scan covers the entire chromosome 10, these significant SNPs are located relatively close to linkage peaks identified in other studies (Bertram et al. 2000). Our analysis included 12 SNPs in IDE, 2 SNPs in PLAU, and 32 SNPs in CTNNA3, but none was significantly associated with LOAD (Busby et al. 2004; Nowotny et al. 2005).

The most consistently associated marker among the five significant SNPs is rs498055, which is significant in each of the three initially tested clinical case-control series employed here, with an allelic P value of .00004 in the meta-analysis of the three sample sets. The replication P value of .00021 is significant even after Bonferroni correction for 69 markers (P=.014), and the meta-analysis of these three case-control series used in the screening paradigm is marginally significant even after adjustment for 1,397 SNPs (P=.051). The linkage sample–derived case-control series replicates these results, whereas the smaller combined neuropathologically confirmed case-control sample set is not significant. The meta-analysis of all six sample sets maintains that rs498055 is significantly associated with AD risk (P=.0001).

The tree-scan analysis identified a single branch in the network that is significantly associated with LOAD. This branch is marked by mutations at rs498055 and rs495998. Marker rs498055 is the most significant SNP in the single-marker association tests (see table 1), and rs495998 is in high LD with rs498055 (r²=0.98) (table 4). This suggests that the observed effect is a mutation on the background shared and defined by these SNPs. It is also interesting to note that rs498055 is homoplasious, with mutations inferred on four different haplotypic backgrounds (one major and three minor haplotypes). In some cases, the haplotype structure of a population allows for tests to be conducted at each branch that is marked by a particular SNP, which provides some evidence as to the “causal” nature of the polymorphism. Although no association was detected at the other transitions marked by rs498055 (a result that suggests that the SNP is not causal), the sample sizes for these tests are too small to provide strong evidence regarding the causality of this SNP. Inclusion of all the associated SNPs in this region in a logistic regression analysis by use of sequential regression (type 1) indicates that the significance derives only from LD with rs498055; that is, no other significant association is observed after first including the effect of rs498055.

Marker rs498055 is located in a gene annotated as an RPS3A homologue in the Entrez Gene database. Although the function of the RPS3A homologue is unknown, it appears that RPS3A itself is a strong biological candidate gene for AD. It has been reported that RPS3A mediates the interaction between BCL2 (encoded by BCL2 [MIM 151430]) and PARP—poly(ADP-ribose) polymerase—(PARP1 [MIM 173870]) and that BCL2 and RPS3A together prevent apoptosis by inhibiting PARP activity (Hu et al. 2000; Song et al. 2002). Thus, RPS3A is an important player in the early phase of apoptosis, a feature observed in AD-affected brains. However, we have been unable to detect transcripts of the RPS3A gene by RT-PCR in RNA from multiple tissues, including brain (data not shown). This may be due to constraints in transcript-specific primer design if a gene has multiple paralogues, as is the case with RPS3A. Alternatively, the annotated gene may not be expressed, and this SNP or variants that are in LD are located in a noncoding expressed sequence, such as a microRNA. It is also possible that this SNP, or variants that are in LD, modulate the transcription of neighboring genes. The SORBS1 (MIM 605264) coding sequence is located 33.7 kb downstream from this SNP and can be considered a strong biological candidate gene. It is involved in insulin signaling and was recently reported to be up-regulated in the hippocampus of AD-affected brains compared with controls (Blalock et al. 2004). ALDH18A1 (at 91.1 Mb and in tight LD with SNPs in RPS3A) encodes a member of the aldehyde dehydrogenase family, which is involved in proline biosynthesis via catalyzing the conversion of l-glutamate to l-glutamate 5-phosphate.

On the basis of the results in the combined validation sample sets, three other markers of interest were also identified, but they are not significant in all three individual samples. The power to replicate the original observation in the exploratory sample for these markers is relatively low in each of the validation samples (table 1). These markers are located in four different genes. PCGF5 (at 86.7 Mb) encodes polycomb group (PcG) ring finger 5, a component of a multimeric, chromatin-associated PcG protein complex, which is involved in stable repression of gene activity. SORCS1 (MIM 606283) (at 102.7 Mb) encodes a type 1 receptor containing a Vps10p-domain and a leucine-rich domain that is involved in endocytosis and intracellular sorting. It is most abundantly expressed in the brain (Hermey et al. 1999), and its expression can be differentially affected by neuronal activity (Hermey et al. 2004). hCG2039140 (at 102.9 Mb) is a predicted gene in the Celera Genome Assembly, encoding a 41-aa polypeptide with no apparent homology to any other known proteins. The potential relevance of these genes with LOAD remains to be examined. Moreover, it is possible that neighboring genes might have a role in AD, since the significant SNPs we identified or variants that are in LD may affect their function.

Although the association with rs498055 was replicated in the case-control series from the linkage sample, the pedigree analyses suggest that this association did not significantly contribute to the original linkage signal on chromosome 10. Although the power of this analysis is low, it suggests that there may be more than one AD susceptibility gene on chromosome 10.

In our screen, we did not attempt to systematically genotype chromosome 10; rather, we used an opportunistic approach to identify functionally relevant gene-based variants that show significant association with AD in at least two independently collected case-control sample sets. Therefore, we cannot exclude the majority of nonsignificant chromosome 10 genes from those that might contribute to the genetic risk of AD. This would require high-density SNP genotyping incorporating an LD-based approach to SNP selection in the case of the common disease–common variant hypothesis and, ultimately, deep resequencing of all genes, to exclude rare pathogenic variants. However, the results outlined above highlight five SNPs—particularly rs498055, which was replicated in four independent case-control series—and corresponding genes as likely AD risk factors on chromosome 10. These findings require functional experiments to validate potential links of the genes and genetic variation to pathways related to disease mechanisms for AD.

Appendix A

Figure A1.

Count of markers used in the exploratory samples by SNP types. Note that the categorization of the unknown (intergenic) and silent mutation SNPs is based on the most current genome assembly (Celera Genome Assembly R27). In previous genome assemblies, these SNPs belonged to functional categories as well.

Table A1.

Markers Genotyped as Part of the LOAD Screen of Chromosome 10^[Note]

	Gene			Sample
Marker	1	2	3	WU	UCSC	UK	SNP Sequence
hCV1007164	hCG1811021			X			TGTGTGTACGGGTGTGGTTGTGAAAGAGARAAGGAAGTCATTTTGTAGAGCTGTTTATTT
hCV11194331	IDE			X			CCCGGCTCAAGCAATCCTCCCGCCTCAGCMTCTGGAATAGTTGAGATTACTGGCACGTGC
hCV11196784	LOC119587			X			GGGCAACCTGGAAAGGACAATGCTTGTTAWAAACAACGACAGATGCTGAAAGGGATGAGT
hCV11205455	MAT1A			X			AAGTTGCTGCTTCTGCTCCAGGAAGCCCASATAGGACTGGACTGGACTTAGACCACTTAC
hCV11208397	DMBT1			X			AAGGATTCTTGTGTTCCCCTGTAGGATCTRAATCCAGTTTGGCCCTGAGGCTGGTGAATG
hCV11276238	PTPRE			X			TACCAGTTCATAATACCCATTTGTTGATGWCCTCAGGGGCTGACGGTGGCCGTTATGGTT
hCV11304669	SAMD8			X			GAGGGTGGGAGGATCATTTCAAAAATATGWGATGTATGGTCCCTGTCCTCAGGAATATTA
hCV11374977	NA			X			CTTATTAGGTCTTCCACGATAACTATTTTRTTGCCTCATACACCACCTCTTTATCCTGTT
hCV11476780	VCL			X			TACTGTGGGCTATCAGGCTGCCTATATTTRGTGGGTGCCTTCATTTCTTTGGGTAGGCTC
hCV11568071	MRC1			X			TACGCTACTAGGCAATGCCAATGGAGCAAYCTGTGCATTCCCGTTCAAGTTTGAAAACAA
hCV11568148	hCG1660695			X			TGGGACCCCAGGAGCCCTCCTGTGACTCCRGAATCCTGAGAATGATGTCCCGGCGAGATG
hCV11596131	JMJD1C					X	GGGAATTATAAACTGTTTTTTCTGTGCTGKTTTTTTTTTTTTTTTCTGAGACACAGTCTC
hCV11640694	RSU1					X	GCAACCAAAAGGGAAACGCGGGTTCCCCCYGTCAGGCAGAAAACTTCCCAGACAGACTAC
hCV11640699	CUBN					X	TTAGAAAGGGTAGCAGCAAGACCTACCACSAAGTAATCCCCCTGGTTGCAAGAAGAATCT
hCV11647845	CALML3			X			CCTCCACGGCATGGCATCAGCTACTCTGAYTCAGTTCACCCACGGCAGTGAGTGTGTCCT
hCV11652239	KIN			X			CATACATACTATCTGTCCTAGTAAGAAAAYAGATCAACGCTGAGTAGAAACTATGGATGA
hCV11756797	HTR7					X	AATGGGAAGTTGGACACACTTCCTGATACYCCCACCTTCAGGGGAGCCATCAGGCTTTCC
hCV11779483	ASAH2			X			ATATAAACCCCAAACCCCCAGCTCCACAARCAGACAAGGAGATGAACAGAAAAGCAGAAT
hCV11877867	NCOA4			X			TTGAGCCAAGGAGTTTAACACCAGCCTGGSCAACATACAGAGACCCTGTCTGTACAAAAA
hCV11880347	GALNAC4S-6ST			X			TTTTGTTTTCTCCTTTGCACGTGGGGCACRCCTGGTGACCGTGATGGGGGCCCCCTTGGC
hCV12014288	NA			X			ACCCACTGACACCGGTGATAGGGGCCTCTYTTCCACTGGACTGACAGCTACAAGGATGTA
hCV1213173	hCG1781406	TACC2		X			ACAAAGTGAGCATGGGGTGTAACATGTCCRTTTGCTTACTATGCATGCACGCCCCTCTTC
hCV1229739	ADAMTS14					X	CTAGTGAGGTGTTTTGTATTCATAAACAARGTTATTTAAAACAAAAAAGCTGGAGTATCC
hCV1251183	hCG1820432			X			GAGCAAGAATGTGATGCTTTAGAAGAAAGRAATGAATGAAAGGCCAGGCTGGTTAAGCTG
hCV1345812	PKD2L1			X	X	X	GGGAAGCCATCAGCTCCTGTTCTATCACCYACTCTACTGGGATCTCAGGACCAAGGCTCA
hCV1407029	hCG2041916			X			CAGAACACAAATTATTATTATGATTCCTAWTATGAGCAATAGCTTCTGCCACCAAGTTCC
hCV1531925	SUPV3L1			X			GCCAGCGGAGACTCCTTTTAGGATTCTTTRTCATTGAGGAGGCGCCGACTCATACCACGC
hCV1548908	hCG1643384			X			TGAAGATGCTTCAGATTCAATCCGAGAAAKGTATCACTGCAGAGTTTATAGAAAATGAAG
hCV15792242	C10orf30			X			GTTCGCTGGGAGCATATAAGGGAAATTGGRGGTTGTTGTCTGTTTTGAGTTCCAACTGCG
hCV15825497	NA			X			CTGGTTAATCGCAGGAGGCACTTTCAGCCMCTTATAGAGGATGGCTCTCTGCCGCTGCAA
hCV15834772	MKI67			X			GGTCTCCCCTGACGTCCGTGTGAACTTGCYGACTGCTAGGAGCTCTTCTTTCACACCTAC
hCV16167035	hCG1655317			X			TGATCTCATCCATCTTACTAAAGTTTGTGSAGTCTTGATCATTCCCCATTCCCCCAACAT
hCV16192725	C10orf35			X			ACAGGTAGGTACTCATTTCCTGTGGAGTGRGACAGATGGCCTCCTGTGTACTGGCTACTC
hCV16264597	NA			X			CTCAGACTCCAGTTATGGCTCAACCCAAARAAGATGAAGAGGAAGATGATGATGTAGTGG
hCV1709930	LHPP			X			GACTTGGCCCAGGGCAGCCTCATAAAGCARTTCCCACCCAGGACCGCCCCGATCGATCGG
hCV1720473	C10orf7			X			GCAGGTACAACATTTTTAAGACAGATACARTGTAAACCTTTCCAGTCTACTGACTGACTG
hCV1893544	JMJD1C			X			CATCCTACAAGATGTGGTAAATTTGAAAAKAATAACCCTGATCTTTACTTAAAGGAGTTG
hCV1912681	hCG39169			X			CAGCGTCTGGTACAGCCACCTGTTCTTCCRGTACAGATGGAAGTGGAATTGACTATCTGT
hCV1974596	LOXL4			X			TGGGCTTGAGCCGCACCTCCTCCAGCCGCYGGCCCTGCGGGGTGCACAGTCACCTGTGGG
hCV2008818	SORBS1			X			ACAGCAGCTGAGGCACAGGCATTGAAAACRAATTTTGCCTACCTGTAAAGACTCTAGACT
hCV2009356	hCG2041919			X			TTTTGTAGAAAGTATTTGAGGTGACGCTCWCAATTCAAGGAGATATCTCAGGGTGTAAGA
hCV2041328	hCG2041421			X			TTTCAACTGAGAGGATAACAAAGAACATGRTAGGAGTTGGACTACATAAAAGTTAGTTTC
hCV204710	hCG23640			X			TCTTTGACAAGTTTGAGTGTTGCTGGAACRGTTCGGATAGGTAAGGCCTGCGTGGAGATG
hCV21898	RPP30					X	GAAGTTTGAATTTGTCTGTCAAGCCTGTAYACACTAGCATTGTCAGTAAGCTTTGTTTTT
hCV2376176	hCG1811015			X			GATTCCTAGAGGGAACCTCCCTCCCCCCCWCAAGGGTGACACGCATGCTCGTGGGGTGAT
hCV2432147	TXNL2			X			AGCGACATGCATCTAGTGGCTCCTTCCTAYCCAGCGCTAATGAACATCTTAAAGAAGATC
hCV247567	LOC220929			X			ACACATGCATGTTTTCACTGAGAGCTGTAYTTGAAGAACAGCCTATATTCTGCTAAATTT
hCV25592823	CWF19L1			X			CATAGGGCTCAAAGTCTTTCCGGAAGCGGYGAGCCAGGGTCTCCTCGTCTTCCTTGCTGA
hCV25595249	SYNPO2L			X			CCTGCTTGGGTGTTGCCCGAGGCCCCTGGKATTGGGCCTTAGGGAGAGTTCGGGCCGCCT
hCV25595681	NA			X			AACCAGAACAATGTCTTTTGACTTGCAGARATCCAGCAGTTTGCTCTGGTTGAGGTAAGG
hCV25596066	RGR			X			TCTATACGCAGTCATCGCAGACGTGACTTYCATCTCCCCCAAACTGCAGATGGTACAGAT
hCV25599810	MMRN2			X			ACCCTTCTGCAGCTCAGCCATGGCAAAGASCGTTGCTGTGCTTCCACTCCCCTGCCCAGT
hCV25600248	ADAMTS14			X			CGGGCCCCAACCCTGGCCCAGACCCTGGCYCAACCTCACTGCCCCCCTTCTCCACTCCTG
hCV25602992	DNTT			X			GTTTCAGAACTCTGAGTAAAGTAAGGTCGSACAAAAGCCTGAAATTTACACGAATGCAGA
hCV25603384	INA			X			CCAATCCAAGTTACCTGCTCCCACCTAGAMTCCTCAGTGCTACAACCTCCAAAGTCTCAT
hCV25603850	hCG23635			X			GTCTTAGGTTTTAGTCTCTATGGAAAGCAYTGTGAAGTTAAAGTGCTTAATATTCACATA
hCV25603990	hCG23635			X			GAGGTATTTTCTTAACAGGCACTGTGGGCRGCAATCTGTCAACAGAGAAAATAAAACTAT
hCV25604328	PPRC1			X			AAACACCCCTTGAGATTTGCCTTGTGCCTRTAGGTCCCAGCCCTGCTTCTCCTAGTCCTG
hCV25604457	ITIH2			X			GGACTATGATTTTTTGAAGAGACTGTCCARTGAAAACCATGGAATTGCACAAAGGATTTA
hCV25604675	ARHGAP19			X			CAGCTCTCTCAGTGCCTCTTCCGTATGGTRCTGGGTCTCCTCCTGGTGAGGGCAGGAATC
hCV25605409	C10orf28			X			CGAAGAGTTCAAAACAGAAGAGCAAGATGMCTCAGGGAGTATAGAATTTGGTGTATCTTT
hCV25606322	C10orf64			X			CCTGGAGAGAGGGAAGTGAAGATTGAAGASGTCACACCGCTCTGGGAGGAGACGATGCTC
hCV25614719	OGDHL			X			GAGCTGGCCACACTGCCGATGTGGGTGAGSATGTCCTCAGGGATCCCCGTGGCTGGGCAT
hCV25624518	PNLIPRP2			X			CTGTAAAATTACTTCCCTGGTCCCCCGAGSACATTGACACCCGCTTTCTTCTGTACACAA
hCV25624843	MCM10			X			GAACCAAGAGGGTGGCTCGAACACCAAAGSCTTCACCTCCAGGTGTAGTACTTGCGGTCT
hCV25625205	JMJD1C					X	TATACCTTTTGAAGAAATTCCCTTATCTTSTCAACATCTTTCCCAGCATAAATATGCCAC
hCV25626240	FER1L3			X			TTTCCCTGCATAAGGGTCACAGCGAAAGCRGTCCAGGCGCTCGATGGTGCACTGGCCGAC
hCV25626404	C10orf3			X			AGAAATGTTACAACGATCTCTTGGCAAGTSCAAAAAAAGATCTTGAGGTTGAACGACAAA
hCV25638641	hCG1641533			X			TACTGTTCGGTTCTGGTTCTACATGATTGWTCCCAGGAGTATGGGAATATTAAAGGTACA
hCV25639102	hCG1643351			X			TATCAAAAGTATGCACGTATTTTATGTATRAGGTTCGCTACCCTAACAGCTCCACCGAGG
hCV25644235	hCG1655308			X			TTTGACATTGATAGACTAGGAGAGGAAATYATCTCCAGGAAAAATGCCATGCATGACCAG
hCV25650689	MGC16186			X			GAAGGAGGCCTTGAAGCAGGAATTCCTGCSAGGTACTTCCAGTCTGATTCCAGGAATGCC
hCV25651247	AMSH-LP			X			TGCGAAGTCAGCAAACCTCAGGGCTGTCARAGCAGATTGATGGGAGCGCTTTGTCCTGCT
hCV25651790	THNSL1			X			GCCTGAAGACTGTGAACAGAAGGTTTCAGMAAAATTCTTTAGTGAAGCTGTAATTGAGGG
hCV25651880	NEBL			X			TGACCTTCCTTTAATCTCCTTCTCAAAATSCTCTTTGTAAACTTTCTGTTAAATAAGACC
hCV25652036	hCG1792626			X			GCCTGACGTTCGTTCATCAGCTCCTGGTAMTCACGCCGCTGCCGCGCCATGTCCTGCTTG
hCV25652141	TCF7L2			X			GTTAAAGAACATTAAATAAATTATATAAGKATGCCTACCTGTAACACTTTTATAAGGCAA
hCV25652286	SORCS3			X			AGCAGAGGCCGTAAAAAAAAGTTTAAAGCRTGAAGCGAAATTCCACACCCATCCAGCGCT
hCV25767316	HECTD2			X			AATTACTATTTACAAGATCTATAAACTTCRGAAGCAAAAATATCTTGCCTTGGCAGGAAA
hCV25921991	hCG2018011			X			CTTACTGGGAAGGTTACGTTATGTAATATXTGCCAGCCATTTTTGCAAAGTGCTGTATAC
hCV25923481	hCG2023484			X			ATTGAAAGCCATGGGAGAGGCTAAAGGAASAAGAGCCTCCAGATAACTTTCCTGAAAACA
hCV25930703	hCG1648656	hCG2042804		X			TCCTTCTGACACTGGGTCCCTGTCACTTCYGAGGGAACAGGACCGTAGGATGATGTTTCC
hCV25931135	hCG1803570			X			AAGCTGTGGAGAGCCACGAAGGTGGCAGGRGGCATTAGAGGGGCTGTAAAGGGACCGATG
hCV25932561	MGC32871			X			ATTCAAATTAGTTTATCATTTACCTGCAAWCTTTTTCTTTGGTTCTGCAAGTCCGTGACT
hCV25933604	KNDC1			X			TGACCCAGCCTCCTCGGCCGTGCTGACGAYGAGAATGCAGGTCAGTCCCCACCTCCGCCC
hCV25936294	NA			X			CGCGCCGGCACGAGGGTGTTTTCGACGTTRGCTGTGGGGAAACAGCAAGCGGCGTGGACG
hCV25943811	C10orf61			X		X	CGGGTCCGACGTAGGCCTCCGCGGTCTCCMATCGCATTGCCAGAGCGTGGGTGGGAGGAG
hCV25953510	hCG2024410			X			CTTTGGTCACCCTGTGGTAGAAAGCCTTCRAAAGCAGCTAGGCCAGGACCCTTTCTTTGA
hCV25953694	hCG2017698			X			GTGTCAGCCTGGACAACATAGCAAGACTCYATCTCTGAAAAAAAAACAACAACAAACTTT
hCV25966142	GPR123			X			GGCGGGGTCACTTCGGTACCCCCAGTGACYTCATGTGGCAGATGGGCCCCCCACTCTGCT
hCV25971922	NUDT13			X			CTGTTTCTTAGAGTTGGAAAGGCTCCTGGRTAAATTTGGACAGGATGCACAAAGAATAGA
hCV25990430	NA			X			TTCTCCTCTTGTAGCACCCAGTGACTGTGSGGGCCACTACACAGATGAATATGGCAGGAT
hCV29522	RPP30					X	TTAAGCACAGATCTTAATTTTGTCACGATKTGGGCCCTTTTCTTTGGTTGTGGTGAAAAG
hCV3010735	hCG1993574			X			GGGGAAAATGTCTGGGAAGAAGCTTTTCGKGACCAATGGTGAGCGGATGCCTTTCTCCAA
hCV3033543	NA			X			GCCTGAAGGGGAAAGCCACCTCGGAGGACMCCCTCAATCTAAGGTAATGGCGGGTAGCCA
hCV3061051	NA			X			GCTGGCAAGGCTGCGGAGAAAAGGGAATGYTTACACACTGTTGGTGGGAATGTAAATTTG
hCV3261312	KIAA1754			X			CCCCCTCTGTCGGCAGCCATCTCCGACACRGCTCCTCCGAGCTCGCGCTCTCCATCGCGC
hCV382705	BTRC			X			CCAGGCCTCAGCTGGTAGTGTAGTTATTTMAAATAATATTTAATACAATAAATTCTATGG
hCV385555	hCG1657676			X			CCCGAACAGAGGTAGATACCATGTGTAGAKAGAAACAGGCAGAGAAATAGGAGAGTTGAA
hCV7432608	KCNMA1			X			CTTACCACGACCCAAAGAGCCTCACAGAAYAGATTTCGGAAAGTACGTGTGCGTGTGTGT
hCV7534313	hCG2041498			X			TTGGTACAGGTAAGACCATCAGAGTGATTRCTGACATCTGGAATGTTGTTGTTCTTTTCA
hCV7548937	hCG25651			X			ACAGTACATAAGAGAACACACAGAGGGGAKAAATCTTATTACTGTAATAAATGTGGGAAA
hCV8040921	CTNNA3			X			CTATTGCATGATTGCTCGTACACATGTCTMTTCCTGGGTAATGAGCTCCATTATAGGAGG
hCV8171810	ABLIM1			X			AATATCCTTGGGATTTAGCTCCGTAGCTAYACTTATGTTACATTCTCCATCTCTCCCACC
hCV9580408	CACNB2			X			TTTATTTTTTCCCAGAGATGTTTTTATCTRTCTTTTGTGCCTTGTGACTTTGATAAGGTT
hDV60100216	NA					X	CTTGTCACAGCCGACAGGCTGAGGCCAGAKGTGAGGTCAGTGGGAGGAGGCTCCCCTGCC
hDV60100219	NA			X			TAACTGAAACCACAGAACTTGTATATCCTYAGGATTGAGTTGATGAAGGTCATAAAAGGT
hDV68531048	NA					X	CGCCCCCTGGCACTACCGCGGGTCCGCACYCCACGCCGGGCTGATTCCGGCGCTCGCTCA
hDV68531050	PYCS					X	CCTAAAGTCTGAAGGCTCACAGGCCTGCTSGAGTGTCAAGTCTGCTTGTAGTAGTGTCTT
rs1004256	CBARA1			X
rs10082391	MKI67			X
rs10082466	MBL2			X
rs1017822	ATRNL1	hCG2042431		X
rs1021362	SORCS3			X
rs10242	RPP38			X
rs1027190	SORCS3			X
rs1029074	LIPA			X
rs1029077	ARHGAP12			X
rs10409	HNRPF			X
rs1042454	RGR			X
rs1043009	hCG2041852			X
rs1043098	EIF4EBP2			X
rs1044258	C10orf76			X
rs1044261	IDI2			X
rs1044563	PPP1R3C			X
rs1044612	CAMK2G			X
rs1044795	ARHGAP12			X
rs10450321	hCG2017076	hCG25653		X
rs1045170	WDR11			X
rs1046399	LDB1			X
rs1046528	hCG1640346			X
rs10466026	CDH23			X
rs10466280	SEC61A2			X
rs1047100	FGFR2			X
rs1047991	PAPD1			X
rs1048828	NA			X
rs1049125	PNLIPRP1			X
rs1049455	NOLC1			X
rs1049632	RSU1			X
rs1050767	MKI67			X	X	X
rs10508773	EPC1			X
rs10509343	CBARA1			X
rs10509571	IFIT4	LIPA		X	X	X
rs10509612	RPP30					X
rs10509613	RPP30					X
rs1051338	LIPA			X
rs1051509	ARHGAP22			X
rs1051723	TLX1					X
rs1052289	SEC23IP			X
rs1052420	hCG24072			X
rs1052895	hCG1781727			X
rs1053266	CCDC6			X
rs1053905	PYCS			X
rs1054053	hCG1993574			X
rs1057108	CREM			X
rs1057234	hCG1803442			X
rs1057910	CYP2C9			X	X	X
rs1057971	RNF159			X	X	X
rs1061135	HPS1			X
rs1061159	hCG1781474			X
rs1062465	MPHOSPH1			X
rs1063535	MKI67			X
rs10727	PANK1			X
rs10736069	KIF11			X
rs10736889	LOC399818			X
rs10740118	JMJD1C					X
rs10745302	GPR123			X
rs10751331	hCG2006747	ZNF32		X
rs10751904	hCG2039878	hCG2041856		X
rs10752157	hCG2041860			X	X	X
rs10761471	ANK3			X
rs10761733	JMJD1C					X
rs10761739	JMJD1C			X	X	X
rs10762179	NA			X
rs10762231	CXXC6			X
rs10762360	LRRC20			X
rs10762430	hCG1818231	UNC5B		X
rs10762732	hCG1793822			X
rs10762760	KCNMA1			X
rs10764048	C10orf9			X
rs10764734	PTPRE			X
rs10764882	hCG1796762			X
rs10764899	MGMT			X
rs10764921	hCG41189			X
rs10765037	TCERG1L			X
rs10776682	hCG1803640			X
rs10786050	KIF11			X
rs10786122	C10orf4			X
rs10786211	SORBS1					X
rs10786740	hCG2040253			X
rs10786775	OBFC1			X
rs10786783	C10orf78			X
rs10787227	SMNDC1			X
rs10787428	GPAM			X
rs10787728	hCG1792255			X
rs10787879	hCG39777			X
rs10795417	RSU1					X
rs10795446	CUBN			X
rs1079610	OPN4			X
rs10821668	ANK3			X
rs10821675	ANK3			X
rs10821937	hCG41574			X
rs10822156	JMJD1C					X
rs10822160	JMJD1C					X
rs10822988	CTNNA3			X
rs10823333	HK1			X
rs10823345	HK1			X
rs10823365	TACR2			X
rs10823435	COL13A1			X
rs10823935	CBARA1			X
rs10824119	ADK			X
rs10826793	hCG1789973			X
rs10827628	hCG1641533			X
rs10828317	PIP5K2A			X
rs10828395	ARMC3			X
rs10828833	GPR158			X
rs10829163	hCG25239			X	X	X
rs10829529	hCG1654004			X
rs10829970	TCERG1L			X
rs10857625	C10orf64			X
rs10882617	SORBS1					X
rs10882645	PYCS					X
rs10882993	ZFYVE27			X
rs10883100	HPSE2			X
rs10883565	C10orf6			X
rs10883841	NT5C2			X
rs10883974	C10orf79	hCG23142		X
rs10883979	C10orf79	hCG23143		X
rs10885330	hCG1811160			X
rs10885789	ATRNL1			X
rs10887621	KIAA0261			X
rs10887666	BMPR1A			X
rs10901542	hCG1793036			X
rs10901614	hCG1660574			X
rs10903752	ZMYND11			X
rs10906818	THEDC1			X
rs10994860	ACF			X
rs10997762	CTNNA3			X	X	X
rs10997795	hCG1786927			X
rs10997818	DNAJC12			X
rs10997823	DNAJC12			X
rs10998112	RUFY2			X
rs10998268	hCG1787108			X
rs10999147	TYSND1			X
rs10999212	GPR147			X
rs10999426	PRF1					X
rs10999511	MYST4					X
rs11000566	TTC18			X
rs11000911	ADK			X
rs11001296	SAMD8			X
rs11001359	hCG1643166			X
rs11001456	NA			X	X	X
rs11002528	hCG2041497			X
rs11006122	UBE2D1			X
rs11006128	TFAM			X
rs11007349	hCG1820823			X
rs11008020	hCG1643739			X
rs11008032	hCG1643738			X
rs11009218	NA			X
rs11010082	CUL2	hCG2040100		X
rs11011216	hCG1817887	hCG1817888		X
rs11011224	hCG25652			X
rs11013233	ARMC3			X
rs11015624	hCG1648219			X
rs11015640	ARMC4			X	X	X
rs11016076	MKI67			X
rs11016944	hCG1796998			X
rs11068	NET-7			X
rs1108616	RAI17			X
rs11101202	CHAT			X
rs11106	MKI67			X
rs1111350	TLX1			X
rs1113394	NRAP			X	X	X
rs11146301	NA			X
rs11186275	hCG1787893			X
rs11186361	NA					X
rs11186426	hCG1641715			X
rs11187265	CYP26C1			X
rs11187825	PLCE1			X
rs11187952	hCG1811021			X
rs11188410	ALDH18A1					X
rs11189211	KIAA0690			X
rs11189705	HPSE2			X
rs11190190	SLC25A28			X
rs11190780	SEMA4G			X
rs11190812	KAZALD1					X
rs11191283	PSD			X
rs11191865	OBFC1			X
rs11193438	hCG2039140			X
rs11196200	hCG1776259	TCF7L2		X
rs11196400	NRAP			X
rs11196686	NA			X
rs11199005	RGS10			X
rs11199755	hCG2040383			X
rs11200999	KIAA1128			X
rs11204210	ZNF488			X
rs11239851	hCG2040417			X
rs1124013	hCG1641930			X
rs11245007	hCG2023484			X	X	X
rs11245366	LOC399818			X
rs11248366	ACADSB			X
rs11253042	AKR1C4			X
rs11253185	NET1			X
rs11254232	CUBN					X
rs11254238	CUBN					X
rs11256802	RBM17			X
rs11257462	UPF2			X
rs1125798	hCG1781035			X
rs1129614	GDI2			X	X	X
rs1132816	PIP5K2A			X
rs1139943	DNMBP			X
rs1148274	hCG25654			X
rs1148275	hCG25654			X
rs11509438	GSTO1			X
rs1152659	CTBP2			X
rs11541237	NA			X
rs11542131	PEO1					X
rs11553577	C10orf61					X
rs11572080	CYP2C8			X
rs11591349	SEMA4G			X
rs11592052	CCDC7	hCG2017386		X
rs11592502	hCG1781166			X
rs11592567	hCG2040099	hCG2040100		X
rs11592612	ACADSB			X
rs11593766	CASP7			X
rs11594687	NA					X
rs11594962	C10orf79			X
rs11595081	hCG1818441			X
rs11595114	SORBS1					X
rs11595603	LRRC20			X
rs11595684	ZNF248			X
rs11596193	HK1			X
rs11596235	SUFU			X
rs11596518	HTR7					X
rs11597349	PRKG1			X
rs11597471	HTR7					X
rs11597812	hCG2041859			X
rs11597888	hCG2041374			X
rs11598232	ADK			X
rs11598673	hCG24137			X
rs11599164	ANK3			X
rs11599210	ADAMTS14					X
rs11599234	PTPLA			X
rs11600	hCG1643971			X
rs11601	CSTF2T			X
rs1162759	HNRPH3			X
rs1171614	SLC16A9			X
rs11812465	hCG2040270			X
rs11812708	HTR7					X
rs11816811	COL13A1			X
rs11816967	C10orf59			X
rs11872	PDLIM1			X
rs1200814	ANKRD30A	hCG1789874		X
rs1208606	ZNF25			X
rs1211373	hCG1745367			X
rs12217414	C10orf68			X
rs12221	STAM			X
rs12221039	hCG32858			X
rs12240276	AKR1CL2			X
rs12241995	NRAP			X
rs12243497	ANXA7			X
rs12244832	C10orf68			X
rs12247541	RSU1			X	X	X
rs12248786	BMPR1A	hCG1994049		X
rs12251014	ADAM12			X
rs12253226	hCG1643166			X
rs12253240	CTNNA3			X
rs12254856	AMSH-LP			X
rs12255505	USP54			X
rs12256352	HTR7					X
rs12256617	hCG1787893					X
rs12256853	VPS26			X
rs12261515	hCG32744			X
rs12262099	LRRC21			X	X	X
rs12263503	hCG1649846			X
rs12263945	hCG2040383			X	X	X
rs12266925	CCDC7			X
rs12268745	CUL2	hCG2040100		X
rs12268910	ADD3			X
rs1227049	CDH23			X
rs1227065	CDH23			X
rs1227236	hCG1640361			X
rs1228187	LIPF			X
rs1229406	LIPF			X
rs12354886	ZNF485			X
rs12356978	C10orf92			X
rs12357316	VCL			X
rs12359728	hCG2040358			X
rs12359843	KAZALD1					X
rs12359948	hCG25653			X
rs1240373	hCG1994053			X
rs12412095	hCG1642404			X
rs12412249	IDE			X
rs12413153	NA			X
rs12414281	HERC4			X
rs12414693	SORBS1					X
rs12415681	SORBS1					X
rs12415976	SARA1			X
rs12416239	hCG40968			X
rs1244229	hCG1774090			X	X	X
rs1244422	ATP5C1			X
rs1244471	hCG2017949			X
rs1245560	SPOCK2			X
rs1247441	SVIL			X
rs1247755	KCNMA1			X
rs1247766	KCNMA1			X
rs1248623	DLG5			X
rs1248634	DLG5			X
rs1248636	DLG5			X
rs1248638	DLG5			X
rs1248653	DLG5			X
rs1248674	DLG5			X
rs1248678	DLG5			X
rs1248688	DLG5			X
rs1248689	DLG5			X
rs1248690	DLG5			X	X	X
rs1248696	DLG5			X
rs1250533	RAI17			X
rs1250541	RAI17			X
rs1250556	RAI17			X
rs1250565	RAI17			X
rs1250580	RAI17			X
rs1250600	RAI17			X
rs1251363	KIF5B			X
rs12570211	hCG24887			X
rs12570967	PP			X
rs12570974	P4HA1			X
rs12572012	MPHOSPH1			X
rs12572520	C10orf70			X
rs12573590	ADK			X
rs12573841	hCG2024499			X
rs1258184	OGDHL			X
rs1264781	ATRNL1			X
rs1268514	DLG5			X
rs1268956	DLG5			X
rs1270911	DLG5			X
rs12761105	HTR7					X
rs12761705	hCG24649			X
rs12765373	C10orf107			X
rs12765826	hCG1744837			X
rs12766523	RPP30			X	X	X
rs12766938	hCG1643166			X
rs12767046	ARL8			X
rs12767142	ANXA11			X
rs12769629	hCG2036818			X
rs12769766	PCBD			X
rs12770335	SGPL1			X
rs12770830	hCG25567	HSPA14		X
rs12771333	hCG1646071			X
rs12771404	hCG1648653	hCG41189		X
rs12772251	DOCK1			X
rs12772980	hCG2041102					X
rs12773574	SORBS1					X
rs12773592	hCG1646071			X
rs12774010	C10orf64	hCG1642860		X	X	X
rs12774061	CTNNA3			X
rs12774070	ADAMTS14			X
rs12776792	NA					X
rs12779919	ABI1			X
rs12780826	NA			X
rs12781453	hCG2040330			X
rs12782946	hCG1781474			X
rs12782963	PKD2L1			X
rs12784524	hCG40467			X
rs12784975	PIK3AP1			X
rs12915	hCG2040497			X
rs12917	MGMT			X
rs13088	C10orf72			X	X	X
rs13134	ALOX5			X
rs1316312	PPIF			X
rs1316313	PPIF			X
rs1317894	C10orf64			X
rs1320496	LIPA			X
rs1321934	PAPSS2			X
rs1322319	ZNF248			X
rs1324693	NA			X
rs1326331	SEC15L1			X
rs1328323	SVIL			X
rs1331326	NRP1			X
rs1334891	FRAT1			X
rs1336459	C10orf130			X
rs1338565	ZNF239			X
rs1338864	NA					X
rs1339746	hCG1644292			X
rs1339907	hCG2038611			X
rs1340380	LOC143241	MGC16186		X
rs1341667	NA			X
rs1341676	NA			X
rs1342273	MXI1			X	X	X
rs1344089	CTNNA3			X
rs1344967	NA			X
rs13500	LIPA			X
rs1356090	KCNMA1			X
rs1359281	PARD3			X
rs1359511	RAI17			X
rs1359849	SHOC2			X
rs1360456	NRP1			X
rs1367024	NA			X
rs1370562	hCG1781753			X
rs1374471	C10orf76			X
rs1380555	FAM13C1			X
rs1397617	EIF3S10			X
rs1403629	VCL			X
rs1407696	PDCD4			X
rs1409313	CUEDC2	PSD		X
rs1409322	PRPF18			X
rs1409354	PANK1			X
rs1410304	ATRNL1			X
rs1413772	ARMC4			X
rs1413835	FAM13C1			X
rs1417000	hCG25163			X
rs14177	LZTS2			X
rs1418362	MXI1			X
rs1418709	ENTPD1					X
rs1436186	PIK3AP1			X
rs1436214	hCG1745369			X
rs1439031	hCG1815393			X
rs1441735	ACTA2	AMSH-LP		X
rs1443502	MRC1			X
rs1457523	KCNMA1			X
rs1459990	FAM13C1			X
rs1459996	FAM13C1			X
rs1468063	TNFRSF6			X	X	X
rs1471384	CTNNA3			X
rs1474	hCG1655317			X
rs1475435	EPC1			X
rs1477069	ADAMTS14			X	X	X
rs1477070	ADAMTS14					X
rs1477071	ADAMTS14			X
rs1477536	hCG1644026			X
rs1484247	SORCS3			X
rs1516510	KCNMA1			X
rs1536444	SORBS1					X
rs1538204	CNNM2			X
rs1538311	ADK	hCG1644605		X
rs1538599	LGI1			X
rs1539163	DDX21			X
rs1541009	FRMD4			X
rs1541046	GBF1	PITX3		X
rs1544210	NA			X
rs1551067	MYST4			X
rs1551687	hCG1773755			X
rs1555319	NRP1			X
rs1556612	hCG23658					X
rs1556641	ARMC4			X
rs1556864	hCG1647210			X
rs1561087	KCNMA1			X
rs1563824	FAM13C1			X
rs156697	GSTO2			X
rs157076	GSTO2			X
rs1571013	TNFRSF6			X
rs1571781	NRP1			X
rs1572798	ADAMTS14			X
rs1572934	TNKS2			X
rs15772	RPP38			X
rs1609746	hCG2042429			X
rs161229	TCF8			X
rs161254	TCF8			X
rs161255	TCF8			X
rs1638421	hCG2023700			X
rs1639134	KIF5B			X
rs1650146	hCG2040947			X
rs1668154	ASCC1			X
rs166924	FAM13C1			X
rs1671308	RSU1					X
rs16924989	HERC4			X
rs16925584	CXXC6			X
rs17010003	hCG32744			X
rs17091403	hCG1781474	hCG2040349		X
rs17091424	TDRD1			X
rs17098707	GRK5			X
rs17101193	hCG1641930			X
rs17108179	hCG2040337			X
rs17108991	RBP4			X	X	X
rs17109671	PLCE1			X
rs17110999	NA			X	X	X
rs17113613	PEO1			X
rs17116350	COL17A1			X	X	X
rs17133693	AKR1CL2			X
rs17152897	MCM10			X
rs17173698	PAPSS2			X
rs1720293	hCG1815358			X
rs1721804	FER1L3			X
rs17229970	hCG1802476			X
rs1735641	hCG25651			X
rs17366712	hCG1774090			X
rs1739	HPS1			X
rs17391197	SMBP			X
rs17445028	IDE			X
rs17445328	IDE			X
rs17468739	IFIT2			X
rs17473271	PRG1			X
rs1749849	RAI17			X
rs1749851	RAI17			X
rs17506606	hCG2042945			X
rs17508082	PLCE1			X
rs17511	CTNNA3			X
rs1751658	hCG23635			X
rs17516758	PLCE1			X
rs17517578	C10orf117			X
rs17526356	SIRT1			X
rs1753586	PARD3			X
rs1761987	hCG2041939			X
rs1767174	SGPL1			X
rs17673844	hCG1811160			X
rs1769692	LIPF			X
rs17730369	CWF19L1			X	X	X
rs17731	COPEB			X
rs1775230	APBB1IP			X
rs17756919	SVIL			X
rs1775715	KIF5B			X
rs17768650	ANUBL1			X
rs1777329	SVIL			X
rs1781935	hCG20065			X
rs1782644	RAI17			X
rs1782645	RAI17			X
rs178598	TCF8			X
rs1786909	CTNNA3			X
rs17879914	CYP2C19	hCG2044079		X
rs17881479	SFTPA1	SFTPA2		X
rs17883804	CHUK			X
rs17884026	CHUK			X
rs17885900	SFTPD			X
rs1797077	RSU1					X
rs1799939	RET			X
rs1800373	SNCG			X
rs1800451	MBL2			X
rs1800898	PAX2			X
rs1801222	CUBN			X
rs1801230	CUBN			X
rs1803997	MXI1			X
rs1804689	HPS1			X
rs1804934	PYCS					X
rs180643	NA			X
rs1830951	NA			X
rs1832196	IDE			X
rs1833477	NA			X
rs1837949	hCG1788856			X
rs1837950	hCG1788856			X
rs1856564	IMPK			X
rs1856591	hCG37897			X
rs1856679	DKFZP566K0524			X
rs1858610	PLCE1			X
rs1864590	NET-7			X
rs1865638	hCG2040457	hCG2042457		X
rs1866435	DLG5			X
rs1867998	CDH23			X
rs1868627	MYST4			X
rs1868751	FAM13C1			X
rs1871063	KCNMA1			X
rs1871065	KCNMA1			X
rs1871084	ADK			X
rs1871446	CDC2			X
rs1874147	AP3M1			X
rs1874150	VCL			X
rs1874151	VCL			X
rs1874664	ATE1			X
rs1877993	KCNMA1			X
rs1880055	C10orf27					X
rs1880057	SGPL1			X
rs1880389	hCG1818441			X
rs1880676	CHAT			X
rs1885434	NRAP			X
rs1885517	NA			X
rs188571	LIPF			X
rs1886996	MPHOSPH1			X
rs1886997	MPHOSPH1			X
rs1887027	hCG1642404			X	X	X
rs1887922	IDE			X
rs1888685	NRP1			X
rs1888686	NRP1			X
rs1889568	DUSP5			X
rs1890739	hCG1647787			X
rs1891110	FAM24B			X
rs1891269	hCG1641716			X
rs1891386	hCG1818441			X
rs1891565	FER1L3			X
rs1892110	hCG1787893					X
rs1897367	RHOBTB1			X
rs1897516	hCG1658018			X
rs1898082	C10orf11			X
rs1900005	hCG1817383			X
rs1903870	CTNNA3			X
rs1903894	hCG2040450	KCNMA1		X
rs1903908	hCG2039140			X	X	X
rs1904416	CDC2			X
rs1904589	NODAL			X
rs1904634	CTNNA3			X
rs1905542	KIAA1598			X
rs1907724	KCNMA1			X
rs1907732	KCNMA1			X
rs1907733	KCNMA1			X
rs1907737	KCNMA1			X
rs1907740	KCNMA1			X
rs1912277	hCG1818441			X
rs1914345	BTAF1			X
rs1915440	TMEM26			X
rs1916389	CTNNA3	hCG2038400	LRRTM3	X
rs1917138	NA			X
rs1917155	hCG1818441			X
rs1923260	ATAD1			X
rs1923694	TLL2			X
rs1923696	TLL2			X
rs1923934	GLUD1			X
rs1924504	hCG23635			X
rs1925576	CTNNA3	hCG2038400	LRRTM3	X
rs1925591	CTNNA3	hCG1810898	LRRTM3	X
rs1925604	CTNNA3	hCG1810898		X
rs1925607	CTNNA3	hCG2038400	LRRTM3	X
rs1925621	CTNNA3	hCG2038400	LRRTM3	X
rs1925627	CTNNA3	hCG1810898	LRRTM3	X
rs1926564	ACSL5			X
rs1926736	MRC1			X
rs1928494	hCG2040451			X
rs1931757	hCG1811021			X
rs1932574	C10orf57			X
rs1934952	CYP2C8			X
rs1934963	CYP2C9			X
rs1935	JMJD1C			X
rs1935347	HTR7					X
rs1935349	HTR7			X	X	X
rs1935350	HTR7					X
rs1935351	HTR7					X
rs1937348	STAM			X
rs1953758	ATRNL1			X
rs1962336	hCG1653562			X
rs1969724	C10orf6			X
rs1969815	hCG2038406	HELLS		X
rs1970473	hCG2040007			X	X	X
rs1973972	XPNPEP1			X	X	X
rs1977584	hCG2006597					X
rs1979363	CTNNA3			X
rs1979487	hCG2040312			X
rs1983864	LOXL4			X
rs1983894	C10orf45			X
rs1986558	hCG1818441			X
rs1991808	KCNMA1			X
rs1993986	C10orf64			X
rs1998709	PLCE1			X
rs1998756	HPSE2			X
rs1998864	DOCK1			X
rs1999240	MYO3A			X
rs1999764	IDE			X
rs2001245	MYST4			X
rs2001740	hCG1980421			X
rs2001813	NA			X
rs2002773	PARD3			X
rs2004558	FER1L3			X
rs200910	hCG25654			X
rs2018728	hCG2036689			X	X	X
rs2020172	hCG20065			X
rs2024179	ATRNL1			X
rs2025453	TLL2			X
rs2025459	PARD3			X
rs2026015	ACBD5			X
rs2027108	NA					X
rs2030057	CXXC6			X
rs2031612	TNFRSF6			X
rs2040009	ITGB1			X
rs2043618	ASAH2			X
rs2057227	hCG1815019			X
rs2062258	PPIF			X
rs2062988	DHTKD1			X
rs2065364	NRP1			X
rs2066271	DNAJC1			X
rs2066323	NT5C2			X
rs2070845	IFIT2			X
rs2071496	MKI67			X
rs2095890	hCG2023943			X
rs2096181	FER1L3			X
rs211070	hCG1643662			X
rs211291	KIF5B			X
rs211299	KIF5B			X
rs211424	hCG1807268			X
rs2120902	hCG32855			X
rs2126750	CTNNA3			X
rs2133696	CTNNA3			X
rs2147289	hCG23635			X
rs2148493	hCG1811160			X
rs2152143	MKI67			X
rs2153779	HTR7					X
rs2162540	FGFR2			X
rs2163188	C10orf74			X
rs2170132	C10orf64			X
rs2172659	LOC220929			X
rs2182162	CTNNA3	hCG1810898	LRRTM3	X
rs220049	TCF8			X
rs220059	TCF8				X
rs2210497	hCG2036689					X
rs2227310	CASP7			X
rs2227564	PLAU			X
rs2228059	IL15RA			X
rs2228149	IL2RA			X
rs2228527	PGBD3			X
rs2228529	PGBD3			X
rs2228638	NRP1			X
rs2230660	ZNF239			X
rs2230661	ZNF239			X
rs2232659	FAM26B			X
rs2234962	BAG3			X
rs2234965	ANXA7			X
rs2236319	SIRT1			X
rs2236379	PRKCQ			X
rs2240	MKI67			X
rs2240711	hCG2023700			X
rs2241666	hCG2024246	ZWINT		X
rs2243897	hCG1652542			X
rs2244380	OPTN			X
rs2244647	SFXN2			X
rs2250266	NA			X
rs2251101	IDE			X
rs2253545	KCNMA1			X
rs2254067	hCG2042943			X
rs2254174	C10orf27			X
rs2254266	CAMK2G			X
rs2254419	C10orf92			X
rs2255607	KIAA1279			X
rs2262274	C10orf35			X
rs2270962	CWF19L1			X	X	X
rs2271362	PRDX3			X	X	X
rs2271690	hCG2041592	SARA1		X
rs2271904	HSGT1			X
rs2271908	MRPS16			X
rs2273697	ABCC2			X
rs2273740	XPNPEP1			X
rs2273747	C10orf119	INPP5F		X
rs2273749	INPP5F			X
rs2274109	MCM10			X
rs2274223	PLCE1			X	X	X
rs2274224	PLCE1			X	X	X
rs2274741	hCG25239					X
rs2275047	AVPI1			X
rs2275060	hCG23658			X
rs2275069	ITIH5			X
rs2275111	SFXN4			X
rs2275272	PYCS			X
rs2275382	BA108L7.2			X
rs2275383	BA108L7.2					X
rs2275580	KIAA0690			X
rs2275586	MMS19L			X
rs2275716	SLC25A16			X
rs2275720	ADAM8			X
rs2275799	NRAP			X
rs2277212	CUGBP2			X
rs2277257	SLC29A3			X
rs2281699	hCG32858			X
rs2281797	C10orf49			X
rs2281854	hCG1817644			X
rs2281878	C10orf95			X
rs2281891	CYP2C18			X
rs2284665	PRSS11			X
rs2286735	NRAP			X
rs2286748	TRIM8			X
rs2290167	hCG1655308			X
rs2292307	KIAA0913			X
rs2292584	C10orf64			X
rs2292948	hCG2024499			X
rs2293277	C10orf3			X
rs2295715	hCG2041216					X
rs2295716	SEMA4G					X
rs2295772	SEC31L2			X
rs2295774	SEC31L2			X
rs2295778	HIF1AN			X
rs2295874	TACC2			X
rs2295876	TACC2			X
rs2295879	TACC2			X
rs2296136	hCG24072			X
rs2296436	HPS1			X
rs2296441	C10orf33			X
rs2296467	MSRB			X
rs2296545	C10orf59			X
rs2296690	PYCS					X
rs2297145	hCG25239			X	X	X
rs2297151	YME1L1			X	X	X
rs2297452	ZMYND17			X
rs2297492	C10orf25					X
rs2297882	C10orf97			X
rs2297991	GPAM	hCG2041212		X
rs2298075	SEC31L2			X
rs2298122	DRD1IP			X
rs2304804	ANKRD22			X
rs2305204	PNLIPRP1			X
rs2305386	PKD2L1			X
rs2306264	JMJD1C			X
rs2308327	MGMT			X
rs2339402	TMEM23			X
rs2339507	TMEM23			X
rs236212	NA			X
rs2368184	ABI1			X
rs2370771	hCG2041958			X
rs237596	NA			X
rs2388486	GATA3	hCG2041865		X
rs2393989	C10orf74			X
rs2394341	CTNNA3	hCG1810898		X
rs2394522	VPS26			X
rs2394641	hCG2041592			X
rs2394800	CDH23			X
rs2394848	CHST3			X
rs2395335	C10orf11	hCG2040332		X
rs2395373	C10orf11			X	X	X
rs2395576	C10orf56			X
rs2420367	HTR7					X
rs2421013	C10orf87			X
rs2421131	hCG2040007			X
rs2422324	PDE6C			X
rs2429485	hCG1642042					X
rs2435381	GALNACT-2			X
rs2437257	MRC1			X
rs2441743	CTNNA3			X
rs2452505	PHYHIPL			X
rs2456664	CTNNA3			X
rs2456751	CTNNA3			X
rs2462712	hCG23635			X
rs2474329	hCG1729712			X
rs2474519	C10orf9			X
rs2474571	hCG25655			X
rs2475298	SEC23IP			X
rs2478568	SLC39A12			X
rs2478577	MRC1			X
rs2484180	hCG1642042			X
rs2487068	SLC29A3			X
rs2487999	OBFC1			X
rs2488142	NA			X
rs2492651	NA			X
rs2501578	ADD3			X
rs2503084	hCG1730556	PBEF1		X
rs2505323	hCG1642042			X	X	X
rs2505327	hCG1642042			X
rs2515641	CYP2E1			X
rs2531670	NA			X
rs2531685	hCG2036773	KIAA1598		X
rs2616652	hCG2040450			X
rs2620918	CTNNA3			X
rs2645227	hCG2041853			X
rs266089	CXCL12			X
rs2663056	NA			X
rs2675694	LDB3	OPN4		X
rs2675705	hCG1643076			X
rs2694791	GFRA1			X
rs2704482	COL13A1			X
rs2719995	KCNMA1			X
rs2735343	PTEN			X
rs2738222	hCG25651			X
rs2758988	C10orf11			X
rs2761286	FER1L3			X
rs276222	KIAA1754			X
rs276229	KIAA1754			X
rs2764343	PLCE1			X
rs2764345	PLCE1			X
rs2766628	hCG2040450			X
rs2778979	PLXDC2			X
rs2787140	hCG1659888			X
rs2794981	PFKFB3			X
rs2797567	hCG39531			X
rs2798000	PLCE1			X
rs2804535	VDAC2			X
rs2805910	PRG1			X
rs2805915	PRG1			X
rs2808096	ARHGAP12			X
rs2812968	hCG1729643			X
rs2817698	SLIT1			X
rs2839668	GAD2	MYO3A		X
rs284596	FAM13C1			X
rs284624	FAM13C1			X
rs284856	C10orf26			X
rs2855025	PRG1			X
rs2862507	hCG1642531			X
rs2894016	CTNNA3			X
rs2894087	NET-7			X
rs2894103	hCG1796715			X
rs2894280	COL13A1			X
rs2894347	NA			X
rs2901127	HTR7					X
rs290481	TCF7L2			X
rs2915772	PNLIP			X
rs2927501	ADAM12			X
rs2946994	CTBP2			X
rs2950354	hCG41428			X
rs2986401	PYCS					X
rs2996224	Rab11-FIP2			X	X	X
rs2997211	MPP7			X
rs2999278	ZNF239			X
rs3006365	hCG2044073			X
rs3006739	C10orf68			X
rs3007	GDF10			X
rs3010503	PNLIP			X
rs3013236	DMBT1			X
rs3014185	FAM26A			X
rs3026782	RET			X
rs303169	LOC387700			X
rs303218	IFIT1			X
rs303426	MAP3K8			X
rs303438	MAP3K8			X
rs303450	MAP3K8			X
rs303465	LIPF			X
rs303523	hCG1640331			X
rs303533	NA			X
rs303537	NA			X
rs305375	hCG1805714			X
rs3071	SCD			X
rs3088142	DUSP13			X
rs3101793	hCG1785360			X	X	X
rs3189030	NRAP			X
rs35773	KCNMA1			X
rs35791	KCNMA1			X
rs363282	TRIK			X
rs363294	PDZK8			X
rs366107	LIPF			X
rs369421	GATA3	hCG2041865		X
rs371210	NA			X
rs3730463	POLL			X
rs373304	FAM13C1			X
rs3737015	PDLIM1			X
rs3737294	CSPG6			X
rs3739989	TMEM23			X
rs3739998	hCG1643737			X
rs3740015	DHTKD1			X
rs3740094	C10orf10			X
rs3740097	RASSF4					X
rs3740199	ADAM12			X
rs3740211	SEPHS1			X
rs3740215	hCG2041844			X
rs3740329	ZNF11B			X
rs3740423	MKI67			X
rs3740462	UNC5B			X
rs3740469	SLK			X	X	X
rs3750718	CPN1			X
rs3750805	hCG1776259	TCF7L2		X
rs3750898	DCLRE1A			X
rs3758402	RASSF4			X
rs3758490	ZNF365			X
rs3763695	SEC31L2			X
rs3763735	TYSND1			X
rs3763747	SLC16A9			X
rs3763792	CNNM1			X
rs3764990	MIR			X
rs3765101	PITRM1			X
rs3765595	RSU1					X
rs3780971	RSU1					X
rs378308	LIPF			X
rs3793663	hCG1789661	USP54		X
rs3793706	SEC31L2			X
rs3793771	WNT8B			X
rs3802557	hCG1817623			X	X	X
rs3802656	LIPA			X
rs3808909	ARMC4			X
rs3812619	HSGT1			X
rs3814165	hCG24161			X
rs3814568	RASSF4			X
rs3814596	PITRM1			X
rs3816	HPS6			X
rs3816699	PFKP			X
rs3818672	hCG2042945			X
rs3818909	ZDHHC16			X
rs3824700	MYO3A			X
rs3824754	CYT19			X
rs3829142	hCG2041141			X
rs3829909	hCG1776259			X
rs3850680	SORCS1			X
rs3852407	PLEKHK1			X
rs3858340	BAG3			X
rs3862018	HABP2			X	X	X
rs3862030	SUFU			X
rs3862501	KCNMA1			X
rs3862511	RAI17			X
rs388972	FAM13C1			X
rs3900887	TFAM			X
rs390414	LIPF			X
rs391260	LIPF			X
rs391683	LIPF			X
rs3939	ANKRD1			X
rs3952313	SPAG6			X
rs4025981	NEBL			X
rs402781	LIPF			X
rs405635	LIPF			X
rs4065	PLAU			X
rs4078488	CH25H			X
rs4096395	COL13A1			X
rs412927	LIPF			X
rs4144422	RPP30					X
rs4147179	ARHGAP21			X
rs415996	LIPF			X
rs416957	LIPF			X
rs418276	LIPF			X
rs4237438	FRMD4			X
rs4242746	PITRM1			X
rs4323796	ADAMTS14			X
rs436207	FAM13C1			X
rs4400684	JMJD1C					X
rs4412676	ADAM12	hCG1644692		X
rs4417206	PYCS			X	X	X
rs444386	LIPF			X
rs4485000	CACNB2			X
rs4548513	CTNNA3			X
rs4581397	hCG1791394			X
rs4595427	JMJD1C					X
rs4630205	IFIT4	LIPA		X	X	X
rs4646953	NA			X
rs4646957	IDE			X
rs4646958	IDE			X
rs4691	NDST2			X
rs4745805	hCG2041396			X
rs4746015	COL13A1			X
rs4746332	C10orf11			X
rs4746821	SUPV3L1			X
rs4746946	H2AFY2			X
rs4747194	CDH23			X
rs4747647	hCG1774090			X
rs4747796	hCG1792626			X
rs4750568	hCG2039913	hCG2041288		X
rs4751651	C10orf84			X
rs4751995	PNLIPRP2			X
rs4751996	PNLIPRP2			X
rs4838592	ARHGAP22			X
rs4880241	C10orf39			X
rs4880801	ADARB2			X
rs4917723	BLNK			X
rs4917766	NA			X
rs4919058	MLR2			X
rs492943	XPNPEP1			X
rs4933617	RPP30					X
rs4933620	RPP30			X	X	X
rs493392	PARD3			X
rs4935502	PCDH15			X
rs4948550	BICC1			X
rs4948970	hCG17919			X
rs495998	NA			X	X	X
rs498055	hCG1641328			X	X	X
rs500470	NA			X	X	X
rs5030920	TACR2			X
rs5030949	HK1			X
rs523611	KCNMA1			X
rs526219	PIK3AP1			X
rs527458	KCNMA1			X
rs530872	MRC1			X	X	X
rs532678	PTEN			X
rs533343	NA			X	X	X
rs533383	NA			X	X	X
rs533480	SORBS1			X	X	X
rs542007	KCNMA1			X	X	X
rs554765	SORBS1					X
rs558764	hCG1796761			X
rs559198	IFIT5			X
rs566484	PIK3AP1			X
rs569511	PKD2L1			X
rs577537	CRTAC1			X	X	X
rs5870	ACTR1A			X
rs590142	hCG1648219			X
rs591157	C10orf129			X
rs595652	CX40.1			X
rs597371	AMACO			X
rs600879	SORCS1			X	X	X
rs607437	SORCS1			X
rs6163	CYP17A1			X
rs618687	hCG1640833			X
rs621375	KIAA1914			X
rs622491	hCG1640638			X
rs623980	XPNPEP1					X
rs625039	hCG1781727	LBX1		X
rs625859	PIK3AP1			X
rs626394	PARD3			X
rs626859	PARD3			X
rs636555	C10orf79	hCG23142		X
rs646668	KIAA1914			X
rs646767	PKD2L1			X
rs647758	PARD3			X	X	X
rs6480404	HK1			X
rs6481530	NA			X
rs649785	AMACO			X
rs650212	PARD3			X
rs6537579	NA			X
rs657477	PARD3			X	X	X
rs6580	FAM26B			X	X	X
rs6585312	TRUB1			X
rs6597731	ADAM12			X
rs6602141	RSU1			X
rs6602160	RSU1			X	X	X
rs6646	ABLIM1			X
rs6686	SEC61A2			X
rs67179	hCG1783557			X
rs673009	PARD3			X
rs678188	PARD3			X
rs6816	OGDHL			X
rs682304	PIK3AP1			X
rs684395	hCG2042948			X
rs687528	PIK3AP1			X
rs6896	ANXA7			X
rs6901	PITRM1			X
rs690763	MRC1			X
rs691196	MRC1			X
rs691773	MRC1			X
rs691863	MRC1			X
rs692126	MRC1			X	X	X
rs693986	ATRNL1			X
rs7006	DPCD			X
rs7013	C10orf10					X
rs701834	LZTS2					X
rs701836	LZTS2					X
rs701846	CPEB3			X
rs701865	PDE6C			X
rs702366	ALOX5			X
rs703258	VCL			X
rs703460	SORCS3			X
rs703461	SORCS3			X
rs703973	RAI17			X
rs703981	RAI17			X
rs703982	RAI17			X
rs703990	RAI17			X
rs704010	RAI17			X
rs7070570	CTNN3			X
rs7072367	CWF19L1			X	X	X
rs7072645	ADAMTS14					X
rs7073610	CWF19L1			X
rs7074064	BMPR1A			X
rs7074242	hCG1641715			X
rs7075141	IDI1			X
rs7075260	hCG1817623			X
rs7075831	BLNK			X
rs7075888	hCG40944			X
rs7075964	hCG2023790	XPNPEP1				X
rs7076888	SORBS1					X
rs7077596	hCG2036689					X
rs7079901	RSU1			X
rs7080160	hCG1646572			X
rs7080643	hCG23635			X
rs7081273	ADAMTS14					X
rs7081275	JMJD1C					X
rs7081960	CCAR1			X
rs7082044	hCG25652			X
rs7082342	hCG1800341			X
rs7082434	FBXO18			X
rs7082558	HTR7					X
rs7084090	IDE			X
rs7084874	CDH23	hCG1745900		X
rs7085991	NA			X
rs7086446	hCG2040215			X
rs7089142	PCDH21			X
rs7089312	FLJ22761	hCG2038551		X
rs7089349	hCG39169			X
rs7091896	SIRT1			X
rs7092539	JMJD1C					X
rs7093729	RSU1					X
rs7094973	ANKRD2			X	X	X
rs7097295	hCG20065			X
rs7099478	GRK5			X
rs7099565	TRUB1			X
rs7099777	NA			X
rs7100129	NA					X
rs7100340	NA			X
rs7100382	hCG2042429			X
rs7100623	IDE			X
rs7184	MRPL43			X
rs7199	hCG23640			X
rs719909	PANK1			X
rs725529	hCG41574			X
rs726817	C10orf4			X
rs727427	PANK1			X
rs727532	ABLIM1			X
rs728289	PSAP			X
rs7304	COMTD1	VDAC2		X
rs731947	hCG2040574			X
rs732102	SORBS1					X
rs735104	NA			X
rs736189	ADAMTS14			X
rs736535	MAWBP			X
rs736597	VTI1A			X
rs7377	PRG1			X
rs740595	hCG2023700			X
rs746472	hCG1811015			X
rs748164	ADAMTS14					X
rs748165	ADAMTS14			X
rs748235	HK1			X
rs749049	PYCS			X
rs749304	SORCS3			X
rs749377	ARHGAP22			X
rs750431	ADAMTS14			X
rs751450	CHST3			X
rs752372	KCNMA1			X
rs752974	LZTS2			X
rs753270	RAI17			X
rs755381	KCNIP2			X
rs780157	RAI17			X
rs780631	RSU1					X
rs780668	SLC29A3			X
rs787037	APBB1IP			X
rs787041	APBB1IP			X
rs787634	FER1L3			X
rs788219	MASTL			X
rs788237	MASTL			X
rs7895441	NA					X
rs7896327	MINPP1			X
rs7897619	IFIT4	LIPA		X
rs7897947	NFKB2			X
rs7899065	SORBS1					X
rs7899853	RSU1					X
rs7900095	SORBS1			X
rs7900392	FER1L3			X
rs7900830	PHYH			X
rs7900859	hCG2006597	hCG2041102		X
rs7901045	PCDH15			X
rs7902355	DC-TM4F2			X	X	X
rs7903091	CBARA1			X
rs7903397	SVIL			X
rs7903964	CTNNA3			X
rs7905087	PI4KII			X
rs7905162	hCG41189			X
rs7905784	MCM10			X
rs7906450	NA			X	X	X
rs7906504	GHITM			X
rs7906894	hCG20066			X
rs7908112	RSU1					X
rs7908745	MIR			X
rs7909832	hCG23996	PTER		X
rs7910154	hCG1783494			X
rs7911748	RSU1			X
rs7912249	SORBS1					X
rs7913176	NHLRC2			X	X	X
rs7914287	CTNNA3			X
rs7915504	hCG2023773			X
rs7916571	hCG2040007			X	X	X
rs7916821	MYPN			X
rs7918084	hCG1641008			X
rs7918118	GTPBP4			X
rs7923749	NA			X
rs792718	NA					X
rs805657	SLK			X
rs805721	COL17A1			X
rs807023	hCG1647209			X
rs807037	KAZALD1			X
rs807038	KAZALD1					X
rs807042	NA					X
rs8139	NT5C2			X
rs814624	LIPF			X
rs814626	LIPF			X
rs814628	LIPF			X
rs816827	KCNMA1			X
rs8181357	FLJ44653			X
rs8187694	ABCC2			X
rs821942	SORCS1			X	X	X
rs827241	PCBD			X
rs829237	TMEM20			X
rs8354	ARL3			X
rs838759	hCG1652542			X
rs8473	MKI67			X
rs860989	KCNMA1			X
rs866255	HERC4			X
rs867407	NA			X
rs867629	NA			X
rs8677	ANK3			X
rs868750	CHAT			X
rs869156	RASSF4					X
rs869801	DOCK1			X
rs870957	RASSF4			X	X	X
rs874556	FLJ22761			X
rs874885	KCNIP2			X
rs877779	CREM			X
rs880348	hCG1788074			X
rs881343	NA			X
rs881406	RAI17			X
rs882052	DOCK1			X
rs882845	C10orf10	RASSF4		X
rs882872	hCG1818441			X
rs883604	MAPK8			X
rs884144	NKX2-3			X
rs885822	PRF1			X
rs892691	ALOX5			X
rs894375	CRTAC1			X
rs902991	NEURL			X
rs906217	SUPV3L1			X
rs906219	FLJ22761			X
rs912485	PIK3AP1			X
rs914325	CAMK1D			X
rs915230	hCG2042179			X
rs915432	CBARA1			X
rs921742	RSU1					X
rs922239	hCG2039963			X
rs923799	hCG1811015			X
rs927099	NRP1			X
rs932512	hCG1655317			X
rs9325593	SNCG			X
rs9333269	ITGA8			X
rs934187	ALOX5			X
rs9414761	hCG1820925	hCG41574		X
rs9416746	BICC1			X
rs9419048	C10orf125	Sprn		X
rs942077	hCG2036763			X
rs9420822	BTRC			X
rs9423590	hCG20066			X
rs942431	PARD3			X
rs942775	STAM			X	X	X
rs942789	RAI17			X
rs943265	TECTB			X
rs943542	SORBS1			X
rs945189	NA			X
rs947599	C10orf3			X
rs951308	MYST4			X
rs951647	LIPA			X
rs952919	GFRA1			X
rs954439	IFIT2	LIPA		X
rs955157	C10orf11	hCG2041509		X
rs959629	PAPD1			X
rs962524	MPHOSPH1			X
rs9664986	SVIL			X
rs9665610	NA			X
rs977096	C10orf35			X
rs980994	NA			X
rs985273	ABLIM1			X
rs994174	hCG1650570			X
rs994811	C10orf107			X
rs9971293	GDF2			X
rs998799	PAX2			X
rs999995	KCNMA1			X

Note.— The public gene name or hCG identifier for predicted genes from the Celera database indicates which sample sets were genotyped, and a 60-bp sequence is provided for SNPs without a public “rs” identifier. NA=not applicable.