Skip to main content
PMC home page
American Journal of Human Genetics logoLink to American Journal of Human Genetics
. 2005 Dec 16;78(2):202–221. doi: 10.1086/499411

Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists

Sanghamitra Sengupta 1, Lev A Zhivotovsky 2, Roy King 3, S Q Mehdi 4, Christopher A Edmonds 3, Cheryl-Emiliane T Chow 3, Alice A Lin 3, Mitashree Mitra 5, Samir K Sil 6, A Ramesh 7, M V Usha Rani 8, Chitra M Thakur 9, L Luca Cavalli-Sforza 3, Partha P Majumder 1, Peter A Underhill 3
PMCID: PMC1380230  PMID: 16400607

Abstract

Although considerable cultural impact on social hierarchy and language in South Asia is attributable to the arrival of nomadic Central Asian pastoralists, genetic data (mitochondrial and Y chromosomal) have yielded dramatically conflicting inferences on the genetic origins of tribes and castes of South Asia. We sought to resolve this conflict, using high-resolution data on 69 informative Y-chromosome binary markers and 10 microsatellite markers from a large set of geographically, socially, and linguistically representative ethnic groups of South Asia. We found that the influence of Central Asia on the pre-existing gene pool was minor. The ages of accumulated microsatellite variation in the majority of Indian haplogroups exceed 10,000–15,000 years, which attests to the antiquity of regional differentiation. Therefore, our data do not support models that invoke a pronounced recent genetic input from Central Asia to explain the observed genetic variation in South Asia. R1a1 and R2 haplogroups indicate demographic complexity that is inconsistent with a recent single history. Associated microsatellite analyses of the high-frequency R1a1 haplogroup chromosomes indicate independent recent histories of the Indus Valley and the peninsular Indian region. Our data are also more consistent with a peninsular origin of Dravidian speakers than a source with proximity to the Indus and with significant genetic input resulting from demic diffusion associated with agriculture. Our results underscore the importance of marker ascertainment for distinguishing phylogenetic terminal branches from basal nodes when attributing ancestral composition and temporality to either indigenous or exogenous sources. Our reappraisal indicates that pre-Holocene and Holocene-era—not Indo-European—expansions have shaped the distinctive South Asian Y-chromosome landscape.

Two rival models based primarily on mtDNA and Y-chromosome data have been proposed to explain the genetic origins of tribes and castes in South Asia. One model suggests that the tribes and castes share considerable Pleistocene heritage, with limited recent gene flow between them (Kivisild et al. 2003a), whereas an exact opposite view concludes that caste and tribes have independent origins (Cordaux et al. 2004). Another analogous debate concerns the origins of the hypothetical proto–Elamo-Dravidian language, which is thought to be the precursor of Tamil. It has been proposed that the proto–Elamo-Dravidian language spread eastward from southwest Persia into South Asia with agriculture (McAlpin 1974, 1981), and the argument is bolstered by the existence of a solitary Dravidian-speaking group, the Brahui, in Pakistan (Renfrew 1996). The linguistic evidence, however, is compromised by uncertainty regarding whether word borrowing is responsible for the observed linguistic affinities (Blazek and Boisson 1992). A study of mtDNA-haplogroup frequencies in southwestern and central Asia reported that the Brahui gene pool was more similar to that of Indo-Iranian speakers from southwest Asia than to that of Dravidian populations of India (Quintana-Murci et al. 2004). The signature of low-frequency western Eurasian mtDNA lineages in India was interpreted (Kivisild et al. 1999) to support the hypothesis that Dravidian farmers arrived in India from the Middle East (Renfrew 1996). Since most Dravidians are clustered, like the Indo-Iranian speakers, within South Asian–derived mtDNA haplogroups (HGs) (Bamshad et al. 2001), this scenario would imply, in terms of maternal lineages, a farming-associated language shift in India. A competing alternative model based on both archaeobotanical material evidence and colloquial agricultural terms, however, more parsimoniously postulates that early Dravidian has a epipaleolithic preagricultural heritage with origins near a South Asian core region, suggesting possible independent centers of plant domestication within the Indian peninsula by indigenous peoples (Fuller 2003).

The usually strong correlation of haploid Y-chromosome diversity with geography makes it a particularly effective gauge of both range and population expansions (Hammer et al. 2001; Underhill et al. 2001b). As the global architecture of the Y-chromosome phylogeny has become well defined (Underhill et al. 2000) and refined (Jobling and Tyler-Smith 2003), the complex Y-chromosome binary HG diversity of southern Asia has begun to be described (Qamar et al. 2002; Basu et al. 2003; Kivisild et al. 2003a, 2003b; Cordaux et al. 2004), revealing an intricate composition and phylogeography concomitant with the initial and subsequent repeated colonization events of South Asia, generally consistent with that reported for mtDNA (Kivisild et al. 1999; Quintana-Murci et al. 2004). To a considerable extent, molecular studies of haploid mtDNA and Y-chromosome structure in southwestern Asians have been framed in the context of the contemporary social hierarchy and/or linguistic fabric of various groups (Bamshad et al. 1998, 2001; Ramana et al. 2001; Roychoudhury et al. 2001; Basu et al. 2003; Wooding et al. 2004). Although such studies have provided interesting insights into the genetic history of paternal lineages in India, there have been two main limitations arising from a combination of ethnically ill-defined populations, limited geographic sampling, inadequate molecular resolution, and inappropriate statistical methods. Another underappreciated factor in some studies is the innate complexity of caste origins, including the recognition that some castes have tribal origins (Majumder 2001). The present study addresses these deficiencies by using a large set of well-defined ethnic groups, wider geographic sampling, high molecular resolution to define HGs, comprehensive haplotyping with use of a large set of microsatellite markers, evaluation of phylogeographic patterns of HG frequencies, and haplotype diversification, as well as estimation of both HG-based expansion and population-divergence times. The major issues addressed include the origins of castes and tribes, the extent of the impact of recent Central Asian agriculturists on the South Asian gene pool, and the geographic source of Dravidian speakers. We attempt to assess both external and internal demic expansions via a detailed phylogeographic approach and microsatellite-based analyses using samples assessed at similar comprehensive levels of Y-chromosome genetic resolution, comprising groups from the Indian peninsula, the Indus Valley, and East Asia. Additional insights regarding the origins of HGs are revealed from an analysis of genetic variability among social categories and linguistic clusters of populations.

Material and Methods

Population Samples

The social structure of the Indian population is dominated by the Hindu caste system. Most contemporary Indian populations belong to the Hindu religious fold and are hierarchically arranged in four main caste clusters; that is, Brahmin (priestly class, upper), Kshatriya (warrior class, middle), Vysya (business class, middle), and Sudra (menial labor class, lower). There are many tribal groups that are predominantly ancestor worshippers and are believed to be autochthones of India. In addition, there are several religious communities that practice different religions; that is, Islam, Christianity, Sikhism, Judaism, etc.

High-resolution assessment of Y-chromosome binary-HG composition was conducted on 728 Indian samples representing 36 populations, including 17 tribal populations, from six geographic regions and different social and linguistic categories. They comprise (Austro-Asiatic) Ho, Lodha, Santal, (Tibeto-Burman) Chakma, Jamatia, Mog, Mizo, Tripuri, (Dravidian) Irula, Koya Dora, Kamar, Kota, Konda Reddy, Kurumba, Muria, Toda, and (Indo-European) Halba. The 18 castes include (Dravidian) Iyer, Iyengar, Ambalakarar, Vanniyar, Vellalar, Pallan and (Indo-European) Koknasth Brahmin, Uttar Pradhesh Brahmin, West Bengal Brahmin, Rajput, Agharia, Gaud, Mahishya, Maratha, Bagdi, Chamar, Nav Buddha, and Tanti. With the exception of the Koya Dora and Konda Reddy groups, these samples have been described elsewhere (Basu et al. 2003). The samples were collected after receipt of informed consent. In addition, 176 samples representing 8 Pakistani populations and 175 East Asian samples from 18 population groups were also studied. Those samples are from the Human Genome Diversity Cell Line Panel (Cann et al. 2002). A description of relevant population characteristics and sample sizes are given in table 1.

Table 1.

Geographic, Social, and Linguistic Description of Populations Studied

Country, Region, and Population (Code) Social Category Linguistic Category No. of Chromosomes
South Asia:
 India:
  North:
   Chamar (cha) Caste, low Indo-European 18
   Muslim (mus) Religious group Indo-European 19
   Rajput (raj) Caste, high Indo-European 29
   Uttar Pradesh Brahmin (ubr) Caste, high Indo-European 14
  Northeast:
   Chakma (chk) Tribe Tibeto-Burman 4
   Jamatia (jam) Tribe Tibeto-Burman 30
   Mog (mog) Tribe Tibeto-Burman 5
   Mizo (mzo) Tribe Tibeto-Burman 27
   Tripuri (tri) Tribe Tibeto-Burman 21
  East:
   Agharia (agh) Caste, middle Indo-European 10
   Bagdi (bag) Caste, low Indo-European 11
   Gaud (gau) Caste, middle Indo-European 5
   Ho (ho) Tribe Austro-Asiatic 30
   Lodha (lod) Tribe Austro-Asiatic 20
   Mahishya (mah) Caste, middle Indo-European 13
   Santal (san) Tribe Austro-Asiatic 14
   Tanti (tan) Caste, low Indo-European 7
   West Bengal Brahmin (wbr) Caste, high Indo-European 18
  South:
   Ambalakarar (amb) Caste, middle Dravidian 29
   Irula (ila) Tribe Dravidian 30
   Iyengar (iyn) Caste, high Dravidian 30
   Iyer (iyr) Caste, high Dravidian 29
   Koya Dora (kdr) Tribe Dravidian 27
   Kota (kot) Tribe Dravidian 16
   Konda Reddy (krd) Tribe Dravidian 30
   Kurumba (kur) Tribe Dravidian 19
   Pallan (pln) Caste, low Dravidian 29
   Toda (tod) Tribe Dravidian 8
   Vanniyar (van) Caste, middle Dravidian 25
   Vellalar (vlr) Caste, middle Dravidian 31
  Central:
   Halba (hal) Tribe Indo-European 21
   Kamar (kmr) Tribe Dravidian 30
   Muria (mur) Tribe Dravidian 20
  West:
   Koknasth Brahmin (kbr) Caste, high Indo-European 25
   Maratha (mrt) Caste, middle Indo-European 20
   Nav Buddha (nbh) Caste, low Indo-European  14
    Total (India) 728
 Pakistana:
  North:
   Burusho Burushaskia 20
   Hazara Indo-European 25
   Kalash Indo-European 20
   Pathan Indo-European 20
  South:
   Balochi Indo-European 25
   Brahui Akin to Dravidian 25
   Makrani Indo-European 20
   Sindhi Indo-European  21
    Total (Pakistan) 176
East Asia:
 Cambodia:
   Cambodian Austro-Asiatic 6
 China:
   Dai Sino-Tibetan 7
   Daur Altaic 7
   Han Sino-Tibetan 24
   Hezhen Altaic 6
   Lahu Sino-Tibetan 7
   Miaozu Sino-Tibetan 7
   Mongola Altaic 7
   Naxi Sino-Tibetan 8
   Oroqen Altaic 7
   She Sino-Tibetan 7
   Tu Altaic 7
   Tujia Sino-Tibetan 9
   Uygur Altaic 8
   Xibo Altaic 8
   Yizu Sino-Tibetan 9
 Japan:
   Japanese Altaic 23
 Siberia:
   Yakut Altaic  18
    Total (East Asia) 175
Open in a new tab
a

Isolated language; remains unclassified.

Polymorphisms and Haplotyping

Binary polymorphisms were genotyped using either denaturing high-performance liquid chromatography, RFLP, or direct sequencing, following the hierarchy of the Y-chromosome phylogeny. The majority of the binary markers have been described elsewhere (Underhill et al. 2001b; Cinnioğlu et al. 2004). Figure 1 shows the phylogenetic relationships and Y Chromosome Consortium (YCC) nomenclature assignments of informative binary markers. All 351 non-Indian and 724 of the 728 Indian samples were also genotyped at 10 Y-microsatellite loci described elsewhere (Cinnioğlu et al. 2004), to estimate haplotype variation within an HG defined by binary markers. In addition, the dinucleotide DYS413 microsatellite locus was analyzed in all J2-M172–related lineages (Malaspina et al. 1997).

Figure 1.

Figure 1

Open in a new tab

Phylogenetic relationships and nomenclature of Y-chromosome binary HGs observed in India, Pakistan, and East Asia. The 69 informative binary markers that were haplotyped are indicated in plain font. The markers in italics are shown to provide phylogenetic context. The following polymorphisms were typed but not observed in Indian populations: M8, M25, M38, M39, M56, M67, M70, M88, M97, M147, M170, M204, M210, M217, M282, M297, and M319.

We introduce eight new informative binary polymorphisms (M346, M356, M357, M377, M378, M379, M407, and M410), a deletion, and seven single-nucleotide substitutions, which are described in table 2. The M377, M378, and M379 markers occur within the same PCR-amplified fragment. The complete data set, with HG and repeat numbers at the 10 microsatellite loci for each individual, is provided in table 3.

Table 2.

Primers and Specifications of New Y-Chromosome Binary Markers

Primer(5′→3′)
Position(bp) Forward Reverse Size(bp) YCC HG
33 ccccgttttttcctctctgcc aatctgccttccaacaaacc 419 Q4
185 aactcttgataaaccgtgctg tccaatctcaattcatgcctc 215 C5
234 ccccgttttttcctctctgcc cacgtaacctgggatggtcata 458 L3
40 tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326 G5
114 tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326 Q1a
135–136 tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326 I1c2
149 gttataccctgctctaaagtgcttc gtagagatggggcttcaccgtgttac 418 C3a2
115 caatcattgaccttaagtctgagtccc actggatacctttctaggaagaattg 395 J2a
Open in a new tab

Table 3.

Complete Data Set of Y-Chromosomal HGs, Numbers of Repeats at 10 Microsatellite Loci, and Descriptions of Populations

No. of Repeats at Microsatellite Markers
Serial No. Sample ID Population Code Country Region Area Social Category Linguistic Category Terminal Marker YCC HG DYS19 DYS388 DYS389AB DYS389CD DYS390 DYS391 DYS392 DYS393 DYS439 DYSA7.2
1 cha-01 cha India North South Asia Caste-low Indo-European M052 H1 15 12 16 14 22 10 11 12 11 10
2 cha-02 cha India North South Asia Caste-low Indo-European M017 R1a1 16 12 17 13 24 11 11 13 10 9
3 cha-03 cha India North South Asia Caste-low Indo-European M017 R1a1 15 12 18 13 25 10 11 14 10 9
4 cha-06 cha India North South Asia Caste-low Indo-European M017 R1a1 16 12 17 13 24 10 11 14 10 9
5 cha-07 cha India North South Asia Caste-low Indo-European M017 R1a1 17 12 17 13 24 11 13 13 11 11
6 cha-08 cha India North South Asia Caste-low Indo-European M052 H1 15 12 16 14 23 10 11 12 11 10
7 cha-09 cha India North South Asia Caste-low Indo-European M052 H1 15 12 17 14 22 10 12 12 11 10
8 cha-12 cha India North South Asia Caste-low Indo-European M052 H1 16 12 16 14 22 10 11 12 11 10
9 cha-13 cha India North South Asia Caste-low Indo-European M356 C5 15 13 16 13 24 11 11 14 11 10
10 cha-14 cha India North South Asia Caste-low Indo-European M052 H1 15 12 16 14 22 10 11 12 11 9
11 cha-15 cha India North South Asia Caste-low Indo-European M052 H1 15 12 16 13 22 10 11 12 11 10
12 cha-17 cha India North South Asia Caste-low Indo-European M124 R2 14 12 15 13 23 10 10 14 12 10
13 cha-18 cha India North South Asia Caste-low Indo-European M052 H1 15 12 16 14 22 10 11 12 11 10
14 cha-20 cha India North South Asia Caste-low Indo-European M017 R1a1 15 12 18 13 25 11 11 13 10 9
15 cha-25 cha India North South Asia Caste-low Indo-European M052 H1 15 12 17 14 22 10 12 12 11 10
16 cha-26 cha India North South Asia Caste-low Indo-European M124 R2 15 13 17 14 23 10 12 14 10 10
17 cha-27 cha India North South Asia Caste-low Indo-European M017 R1a1 15 12 18 13 25 11 11 13 10 9
18 cha-28 cha India North South Asia Caste-low Indo-European M017 R1a1 15 12 18 13 25 11 13 10 9
19 mus-01 mus India North South Asia Religious group Indo-European M017 R1a1 15 12 18 13 24 11 11 13 10 9
20 mus-03 mus India North South Asia Religious group Indo-European M241 J2b2 15 15 17 14 22 10 11 12 12 7
21 mus-04 mus India North South Asia Religious group Indo-European M017 R1a1 15 12 16 14 26 10 11 13 10 9
22 mus-05 mus India North South Asia Religious group Indo-European M124 R2 14 12 16 13 23 10 10 15 11 11
23 mus-06 mus India North South Asia Religious group Indo-European M124 R2 14 12 16 13 23 10 10 15 11 11
24 mus-08 mus India North South Asia Religious group Indo-European M017 R1a1 15 13 18 14 25 10 11 13 10 9
25 mus-09 mus India North South Asia Religious group Indo-European M017 R1a1 15 13 18 14 25 10 11 13 10 9
26 mus-13 mus India North South Asia Religious group Indo-European M410 J2a 14 16 17 14 24 10 11 13 11 10
27 mus-15 mus India North South Asia Religious group Indo-European M017 R1a1 15 13 17 14 25 10 11 13 10 9
28 mus-16 mus India North South Asia Religious group Indo-European M124 R2 14 13 16 13 23 10 10 13 10 10
29 mus-17 mus India North South Asia Religious group Indo-European M017 R1a1 15 12 16 12 25 10 11 12 11 9
30 mus-18 mus India North South Asia Religious group Indo-European M017 R1a1 15 12 18 13 24 11 11 13 10 9
31 mus-19 mus India North South Asia Religious group Indo-European M124 R2 14 13 16 13 23 10 10 13 10 10
32 mus-20 mus India North South Asia Religious group Indo-European M124 R2 14 13 16 13 23 10 10 13 10 10
33 mus-21 mus India North South Asia Religious group Indo-European M017 R1a1 16 12 18 13 25 11 11 13 10 9
34 mus-22 mus India North South Asia Religious group Indo-European M124 R2 14 13 16 13 23 10 10 13 10 10
35 mus-26 mus India North South Asia Religious group Indo-European M017 R1a1 14 12 18 13 24 11 11 13 10 9
36 mus-27 mus India North South Asia Religious group Indo-European M017 R1a1 15 12 18 13 25 11 11 13 10 9
37 mus-28 mus India North South Asia Religious group Indo-European M017 R1a1 16 12 18 13 24 11 11 13 10 9
38 raj-02 raj India North South Asia Caste-high Indo-European M052 H1 15 12 17 14 22 10 11 12 11 10
39 raj-03 raj India North South Asia Caste-high Indo-European M017 R1a1 15 12 17 14 25 10 11 13 10 9
40 raj-04 raj India North South Asia Caste-high Indo-European M356 C5 15 13 17 13 25 10 11 13 11 11
41 raj-05 raj India North South Asia Caste-high Indo-European M017 R1a1 15 12 17 14 24 11 11 13 10 9
42 raj-06 raj India North South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 24 10 11 13 10 9
43 raj-09 raj India North South Asia Caste-high Indo-European M241 J2b2 16 15 17 12 25 10 11 12 12 7
44 raj-10 raj India North South Asia Caste-high Indo-European M017 R1a1 16 12 18 13 25 11 11 13 10 9
45 raj-11 raj India North South Asia Caste-high Indo-European M410 J2a 15 15 16 13 23 10 11 12 13 9
46 raj-12 raj India North South Asia Caste-high Indo-European M052 H1 15 12 17 14 21 11 11 12 11 11
47 raj-14 raj India North South Asia Caste-high Indo-European M357 L3 15 12 16 13 22 10 14 12 12 10
48 raj-17 raj India North South Asia Caste-high Indo-European M052 H1 16 12 15 13 22 10 11 12 11 10
49 raj-18 raj India North South Asia Caste-high Indo-European M357 L3 15 12 16 13 22 10 14 12 12 10
50 raj-19 raj India North South Asia Caste-high Indo-European M089/M213 F* 15 12 18 14 25 11 11 13 10 9
51 raj-20 raj India North South Asia Caste-high Indo-European M241 J2b2 16 15 16 12 24 10 11 12 12 7
52 raj-21 raj India North South Asia Caste-high Indo-European M052 H1 15 13 16 13 22 11 11 13 11 10
53 raj-23 raj India North South Asia Caste-high Indo-European M017 R1a1 15 12 17 13 25 11 11 13 10 9
54 raj-30 raj India North South Asia Caste-high Indo-European M017 R1a1 17 12 17 13 25 10 11 13 10 9
55 raj-34 raj India North South Asia Caste-high Indo-European M017 R1a1 15 12 17 13 25 11 11 13 10 9
56 raj-36 raj India North South Asia Caste-high Indo-European M267 J1 14 15 17 13 24 9 11 12 12 9
57 raj-37 raj India North South Asia Caste-high Indo-European M069 H 15 12 16 13 24 10 11 14 12 10
58 raj-39 raj India North South Asia Caste-high Indo-European M124 R2 15 12 15 13 23 10 10 14 12 10
59 raj-40 raj India North South Asia Caste-high Indo-European M134 O3e 13 10 16 12 24 10 14 12 12 10
60 raj-43 raj India North South Asia Caste-high Indo-European M124 R2 14 12 15 13 23 10 10 14 10 10
61 raj-46 raj India North South Asia Caste-high Indo-European M124 R2 14 12 15 13 23 10 10 14 10 10
62 raj-47 raj India North South Asia Caste-high Indo-European M124 R2 14 13 17 14 23 10 10 14 10 10
63 raj-50 raj India North South Asia Caste-high Indo-European M052 H1 15 12 16 14 22 10 11 12 11 10
64 raj-53 raj India North South Asia Caste-high Indo-European M241 J2b2 14 15 15 12 24 10 11 12 13 7
65 raj-54 raj India North South Asia Caste-high Indo-European M017 R1a1 16 12 18 14 25 12 11 13 10 9
66 raj-55 raj India North South Asia Caste-high Indo-European M017 R1a1 15 12 15 13 25 10 11 13 10 9
67 ubr-01 ubr India North South Asia Caste-high Indo-European M017 R1a1 16 13 19 13 24 11 11 13 10 9
68 ubr-02 ubr India North South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 25 11 11 13 10 9
69 ubr-03 ubr India North South Asia Caste-high Indo-European M410 J2a 14 14 17 13 23 11 11 12 11 11
70 ubr-04 ubr India North South Asia Caste-high Indo-European M017 R1a1 17 12 18 13 25 11 11 13 10 9
71 ubr-05 ubr India North South Asia Caste-high Indo-European M017 R1a1 17 13 18 13 26 11 11 13 10 9
72 ubr-07 ubr India North South Asia Caste-high Indo-European M346 Q4
73 ubr-09 ubr India North South Asia Caste-high Indo-European M052 H1 15 12 16 13 22 10 11 12 12 10
74 ubr-10 ubr India North South Asia Caste-high Indo-European M410 J2a 14 14 17 13 23 11 11 12 11 11
75 ubr-12 ubr India North South Asia Caste-high Indo-European M052 H1 15 12 16 13 22 10 11 12 12 10
76 ubr-18 ubr India North South Asia Caste-high Indo-European M124 R2 16 12 16 13 23 10 10 15 11 10
77 ubr-19 ubr India North South Asia Caste-high Indo-European M017 R1a1 16 12 18 13 24 10 12 13 10 9
78 ubr-22 ubr India North South Asia Caste-high Indo-European M241 J2b2 14 15 15 13 24 10 11 12 13 7
79 ubr-24 ubr India North South Asia Caste-high Indo-European M410 J2a 14 14 17 13 22 11 11 12 12 11
80 ubr-31 ubr India North South Asia Caste-high Indo-European M076 L1 14 12 16 12 22 11 14 11 13 10
81 chk-02 chk India Northeast South Asia Tribe Tibeto-Burman M356 C5 15 13 17 13 25 11 11 14 11 11
82 chk-05 chk India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
83 chk-07 chk India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
84 chk-10 chk India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 9 16 12 23 10 14 12 11 10
85 jam-09 jam India Northeast South Asia Tribe Tibeto-Burman M124 R2 14 13 16 13 23 10 10 15 10 10
86 jam-10 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 10 14 12 12 10
87 jam-11 jam India Northeast South Asia Tribe Tibeto-Burman M122 O3 17 12 15 12 24 10 13 12 13 9
88 jam-12 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 11 10
89 jam-13 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 11 14 12 12 10
90 jam-15 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 11 14 12 12 11
91 jam-16 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 13 9
92 jam-17 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 11 10
93 jam-18 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
94 jam-19 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 11 14 12 13 11
95 jam-20 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 11 10
96 jam-21 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 10 14 12 12 10
97 jam-22 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 11 14 12 13 11
98 jam-23 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 10 14 12 12 9
99 jam-24 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 11 10
100 jam-25 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 10 14 12 11 10
101 jam-31 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 10 14 12 12 10
102 jam-34 jam India Northeast South Asia Tribe Tibeto-Burman M124 R2 14 13 16 13 23 10 10 15 10 10
103 jam-39 jam India Northeast South Asia Tribe Tibeto-Burman M052 H1 15 13 17 14 22 10 11 12 12 10
104 jam-40 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 11 10
105 jam-41 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 10 14 12 11 10
106 jam-43 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 10 14 12 12 10
107 jam-44 jam India Northeast South Asia Tribe Tibeto-Burman M017 R1a1 15 12 18 13 25 10 11 13 10 9
108 jam-46 jam India Northeast South Asia Tribe Tibeto-Burman M095 O2a 15 12 16 13 24 10 13 15 11 9
109 jam-47 jam India Northeast South Asia Tribe Tibeto-Burman M095 O2a 17 12 15 12 24 10 13 12 13 9
110 jam-48 jam India Northeast South Asia Tribe Tibeto-Burman M017 R1a1 15 12 18 13 25 10 11 12 10 9
111 jam-49 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 11 14 12 12 11
112 jam-50 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 11 14 12 13 11
113 jam-51 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 25 10 14 12 11 10
114 jam-52 jam India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
115 mog-10 Mog India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 13 12 10
116 mog-17 Mog India Northeast South Asia Tribe Tibeto-Burman M124 R2 14 12 17 14 23 10 10 15 12 10
117 mog-18 Mog India Northeast South Asia Tribe Tibeto-Burman M124 R2 14 13 17 14 23 10 10 14 9 10
118 mog-20 Mog India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 13 12 10
119 Mog India Northeast South Asia Tribe Tibeto-Burman M017 R1a1 15 12 20 13 25 10 11 15 10 11
120 mzo-01 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 17 14 24 10 14 12 12 10
121 mzo-02 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 17 14 25 10 14 12 13 10
122 mzo-03 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 16 14 17 14 24 10 14 14 13 10
123 mzo-04 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 15 10 16 12 24 10 14 12 12 10
124 mzo-05 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 14 14 24 10 14 12 11 11
125 mzo-06 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 16 12 17 14 24 11 14 14 12 10
126 mzo-07 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 15 12 17 14 24 10 14 14 13 10
127 mzo-08 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 14 24 10 13 12 13 10
128 mzo-09 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 14 14 24 10 14 12 12 10
129 mzo-10 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 17 12 17 14 24 10 14 14 13 10
130 mzo-11 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 16 12 17 14 24 10 14 14 12 10
131 mzo-13 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 15 12 17 13 24 10 14 14 12 10
132 mzo-14 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 17 12 17 14 24 10 14 14 13 10
133 mzo-15 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 14 12 22 10 14 12 12 10
134 mzo-17 mzo India Northeast South Asia Tribe Tibeto-Burman M052 H1 16 12 16 14 22 10 11 12 12 10
135 mzo-18 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 17 12 16 13 24 10 14 14 13 10
136 mzo-19 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 16 12 16 14 24 10 14 14 13 10
137 mzo-20 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 14 14 24 10 14 12 12 10
138 mzo-21 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 17 14 24 10 14 12 12 10
139 mzo-22 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
140 mzo-23 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
141 mzo-24 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 15 12 16 14 24 10 14 14 12 10
142 mzo-25 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 17 12 16 13 24 10 14 14 13 10
143 mzo-26 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 14 24 10 14 12 12 10
144 mzo-27 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 16 12 16 13 24 10 14 14 13 10
145 mzo-28 mzo India Northeast South Asia Tribe Tibeto-Burman M095 O2a 16 12 16 14 24 10 14 14 12 10
146 mzo-29 mzo India Northeast South Asia Tribe Tibeto-Burman M134 O3e 15 10 16 12 23 10 13 12 12 10
147 tri-02 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 14 12 24 10 14 12 11 11
148 tri-04 tri India Northeast South Asia Tribe Tibeto-Burman M124 R2 14 12 17 13 23 10 10 14 11 10
149 tri-06 tri India Northeast South Asia Tribe Tibeto-Burman M122 O3 16 12 16 13 25 10 13 12 13 10
150 tri-07 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 9 16 12 23 10 14 12 11 10
151 tri-09 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 15 10 16 12 25 11 14 12 12 10
152 tri-11 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 10 14 12 12 10
153 tri-13 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
154 tri-15 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 14 12 24 10 14 12 11 11
155 tri-21 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 10 14 12 12 10
156 tri-22 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 11 10
157 tri-26 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 23 10 14 12 11 10
158 tri-27 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 11 13 12 11 10
159 tri-28 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 10 14 12 13 10
160 tri-29 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 25 10 14 12 12 10
161 tri-31 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 15 10 16 12 23 10 14 12 12 11
162 tri-38 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
163 tri-40 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 11
164 tri-42 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 16 12 24 10 14 12 12 10
165 tri-44 tri India Northeast South Asia Tribe Tibeto-Burman M095 O2a 15 12 16 13 24 10 13 14 11 9
166 tri-47 tri India Northeast South Asia Tribe Tibeto-Burman M017 R1a1
167 tri-53 tri India Northeast South Asia Tribe Tibeto-Burman M134 O3e 14 10 15 12 24 10 14 12 13 11
168 agh-03 agh India East South Asia Caste-middle Indo-European M410 J2a 14 14 16 13 23 10 11 12 12 11
169 agh-07 agh India East South Asia Caste-middle Indo-European M269 R1b3 14 13 16 13 24 11 13 12 12 9
170 agh-09 agh India East South Asia Caste-middle Indo-European M124 R2 13 13 16 13 23 10 10 14 10 10
171 agh-31 agh India East South Asia Caste-middle Indo-European M269 R1b3 14 13 16 13 24 11 13 12 12 9
172 agh-37 agh India East South Asia Caste-middle Indo-European M052 H1 15 12 16 13 22 11 11 12 12 11
173 agh-42 agh India East South Asia Caste-middle Indo-European M269 R1b3 14 13 16 13 24 11 13 12 12 9
174 agh-48 agh India East South Asia Caste-middle Indo-European M124 R2 13 13 16 13 23 10 10 14 10 10
175 agh-49 agh India East South Asia Caste-middle Indo-European M124 R2 13 13 16 13 23 10 10 14 10 10
176 agh-51 agh India East South Asia Caste-middle Indo-European M052 H1 15 12 16 13 22 11 11 12 12 10
177 agh-55 agh India East South Asia Caste-middle Indo-European M017 R1a1 16 12 17 14 25 10 11 14 10 9
178 bag-01 bag India East South Asia Caste-low Indo-European M069 H 16 9 15 12 23 10 11 13 12 9
179 bag-02 bag India East South Asia Caste-low Indo-European M069 H 16 9 15 12 23 10 11 13 12 9
180 bag-04 bag India East South Asia Caste-low Indo-European M069 H 16 9 15 12 23 10 11 13 12 9
181 bag-05 bag India East South Asia Caste-low Indo-European M069 H 16 9 15 12 23 10 11 13 12 9
182 bag-08 bag India East South Asia Caste-low Indo-European M069 H 16 9 15 12 23 10 11 13 12 9
183 bag-16 bag India East South Asia Caste-low Indo-European M410 J2a 14 15 16 13 24 10 11 13 11 10
184 bag-21 bag India East South Asia Caste-low Indo-European M122 O3 16 12 16 12 23 10 14 12 11 10
185 bag-23 bag India East South Asia Caste-low Indo-European M207 R* 15 12 17 13 24 10 11 13 10 9
186 bag-29 bag India East South Asia Caste-low Indo-European M069 H 16 9 15 12 23 10 11 13 12 9
187 bag-31 bag India East South Asia Caste-low Indo-European M069 H 14 13 17 14 25 10 11 13 11 11
188 bag-32 bag India East South Asia Caste-low Indo-European APT H2 15 12 15 14 21 11 11 14 11 10
189 gau-01 gau India East South Asia Caste-middle Indo-European M052 H1 16 12 16 13 22 10 10 12 10 10
190 gau-32 gau India East South Asia Caste-middle Indo-European M052 H1 15 12 16 13 22 10 11 12 12 11
191 gau-34 gau India East South Asia Caste-middle Indo-European M017 R1a1 16 12 18 13 24 10 11 13 10 9
192 gau-41 gau India East South Asia Caste-middle Indo-European M241 J2b2 14 16 15 12 24 10 11 12 7
193 gau-44 gau India East South Asia Caste-middle Indo-European M052 H1 15 12 16 13 22 10 11 12 10 10
194 ho-02 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
195 ho-03 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 15 13 25 10 13 15 12 10
196 ho-04 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 14 24 11 13 14 12 9
197 ho-05 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 24 10 13 14 11 9
198 ho-06 ho India East South Asia Tribe Austro-Asiatic M052 H1 14 12 14 15 22 10 11 12 12 10
199 ho-07 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 13 9
200 ho-17 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
201 ho-24 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 13 25 10 13 15 12 9
202 ho-27 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 13 25 11 13 14 12 9
203 ho-29 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
204 ho-30 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 13 25 11 13 14 12 9
205 ho-32 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 18 13 24 10 14 14 11 9
206 ho-34 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
207 ho-36 ho India East South Asia Tribe Austro-Asiatic M052 H1 14 12 14 15 22 10 11 12 11 10
208 ho-37 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 13 12 9
209 ho-38 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
210 ho-39 ho India East South Asia Tribe Austro-Asiatic M052 H1 15 12 15 14 22 11 11 12 11 10
211 ho-40 ho India East South Asia Tribe Austro-Asiatic M052 H1 15 12 15 14 22 11 11 12 11 10
212 ho-41 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 14 24 11 13 14 12 9
213 ho-42 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 10
214 ho-44 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
215 ho-45 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
216 ho-47 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
217 ho-48 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
218 ho-49 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 14 11 9
219 ho-50 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 13 10
220 ho-53 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
221 ho-55 ho India East South Asia Tribe Austro-Asiatic M052 H1 15 12 16 14 22 10 11 12 12 10
222 ho-56 ho India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 15 12 9
223 ho-57 ho India East South Asia Tribe Austro-Asiatic APT H2 14 12 17 14 21 11 11 13 11 11
224 lod-02 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 16 14 23 10 11 12 11 7
225 lod-03 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 17 14 24 10 11 12 12 7
226 lod-13 lod India East South Asia Tribe Austro-Asiatic M124 R2 15 12 16 14 23 10 10 13 10 9
227 lod-14 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 16 13 23 10 11 12 11 7
228 lod-15 lod India East South Asia Tribe Austro-Asiatic M124 R2 14 12 17 13 23 11 10 15 11 9
229 lod-16 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 16 13 22 10 11 12 11 7
230 lod-17 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 16 13 23 10 11 12 11 7
231 lod-18 lod India East South Asia Tribe Austro-Asiatic M124 R2 15 12 16 14 23 10 10 14 11 10
232 lod-19 lod India East South Asia Tribe Austro-Asiatic M124 R2 15 12 16 14 23 10 10 14 11 10
233 lod-20 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 16 13 22 10 11 12 11 7
234 lod-21 lod India East South Asia Tribe Austro-Asiatic M052 H1 15 12 16 13 22 10 11 12 11 10
235 lod-24 lod India East South Asia Tribe Austro-Asiatic M069 H 14 12 17 12 23 12 11 14 11 10
236 lod-25 lod India East South Asia Tribe Austro-Asiatic M356 C5 15 13 15 13 23 10 11 13 11 10
237 lod-26 lod India East South Asia Tribe Austro-Asiatic M124 R2 14 12 16 13 24 11 10 15 11 9
238 lod-27 lod India East South Asia Tribe Austro-Asiatic M052 H1 15 12 16 13 22 11 11 12 11 10
239 lod-28 lod India East South Asia Tribe Austro-Asiatic M052 H1 15 12 16 13 22 10 11 13 11 10
240 lod-29 lod India East South Asia Tribe Austro-Asiatic M241 J2b2 15 15 16 13 23 10 11 12 11 7
241 lod-30 lod India East South Asia Tribe Austro-Asiatic M124 R2 14 12 16 13 23 11 10 15 11 9
242 lod-31 lod India East South Asia Tribe Austro-Asiatic M069 H 14 12 17 14 23 11 11 14 13 10
243 lod-32 lod India East South Asia Tribe Austro-Asiatic M124 R2 15 12 16 14 23 10 10 14 11 10
244 mah-01 mah India East South Asia Caste-middle Indo-European M241 J2b2 15 15 16 12 25 10 11 12 13 7
245 mah-02 mah India East South Asia Caste-middle Indo-European M052 H1 15 12 17 13 22 10 11 12 10 11
246 mah-03 mah India East South Asia Caste-middle Indo-European M052 H1 15 12 16 14 21 10 11 12 11 10
247 mah-09 mah India East South Asia Caste-middle Indo-European M069 H 14 12 16 14 23 10 11 14 10 10
248 mah-13 mah India East South Asia Caste-middle Indo-European M052 H1 15 12 16 14 21 10 11 12 11 10
249 mah-20 mah India East South Asia Caste-middle Indo-European M095 O2a 15 12 15 14 25 10 13 14 12 9
250 mah-26 mah India East South Asia Caste-middle Indo-European M052 H1 15 12 17 13 22 10 11 12 10 11
251 mah-31 mah India East South Asia Caste-middle Indo-European M124 R2 14 13 17 14 23 10 10 14 11 10
252 mah-32 mah India East South Asia Caste-middle Indo-European M124 R2 15 12 16 14 23 8 10 14 11 10
253 mah-33 mah India East South Asia Caste-middle Indo-European M052 H1 15 12 17 13 21 10 11 12 11 10
254 mah-37 mah India East South Asia Caste-middle Indo-European M356 C5 13 13 16 14 25 10 11 13 12 10
255 mah-38 mah India East South Asia Caste-middle Indo-European M052 H1 15 12 16 14 21 10 11 12 11 10
256 mah-44 mah India East South Asia Caste-middle Indo-European M017 R1a1 15 12 18 13 24 11 11 13 10 9
257 san-06 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 15 13 24 10 13 15 12 10
258 san-07 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 13 25 10 13 14 13 10
259 san-08 san India East South Asia Tribe Austro-Asiatic M095 O2a 16 12 17 13 25 10 13 14 9
260 san-09 san India East South Asia Tribe Austro-Asiatic M095 O2a 16 12 17 13 25 12 14 14 13 9
261 san-10 san India East South Asia Tribe Austro-Asiatic M069 H 14 12 17 13 23 10 11 14 12 10
262 san-11 san India East South Asia Tribe Austro-Asiatic M069 H 14 12 17 12 23 10 11 14 12 10
263 san-12 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 14 12 10
264 san-13 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 17 13 25 10 13 14 12 9
265 san-14 san India East South Asia Tribe Austro-Asiatic M069 H 14 12 17 12 23 11 11 13 12 10
266 san-15 san India East South Asia Tribe Austro-Asiatic M095 O2a 17 12 17 13 25 10 13 15 13 9
267 san-16 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 14 13 11
268 san-17 san India East South Asia Tribe Austro-Asiatic M052 H1 15 12 17 14 22 10 11 12 11 10
269 san-18 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 16 13 24 10 13 15 11 8
270 san-20 san India East South Asia Tribe Austro-Asiatic M095 O2a 15 12 15 13 24 10 13 15 13 10
271 tan-01 tan India East South Asia Caste-low Indo-European M017 R1a1 16 12 18 13 25 10 11 13 10 9
272 tan-02 tan India East South Asia Caste-low Indo-European M124 R2 14 12 16 13 24 10 10 14 10 11
273 tan-03 tan India East South Asia Caste-low Indo-European M017 R1a1 16 13 17 13 24 11 11 13 10 9
274 tan-14 tan India East South Asia Caste-low Indo-European M124 R2 14 12 17 14 23 11 10 14 13 10
275 tan-16 tan India East South Asia Caste-low Indo-European M017 R1a1 17 12 17 13 23 11 11 13 10 10
276 tan-18 tan India East South Asia Caste-low Indo-European M124 R2 15 12 16 14 23 10 10 13 11 10
277 tan-22 tan India East South Asia Caste-low Indo-European M095 O2a 15 12 16 14 25 11 13 14 13 10
278 wbr-01 wbr India East South Asia Caste-high Indo-European M017 R1a1 15 12 17 14 25 10 11 13 11 9
279 wbr-02 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 25 12 11 13 10 9
280 wbr-03 wbr India East South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
281 wbr-04 wbr India East South Asia Caste-high Indo-European M124 R2 14 13 15 13 23 10 10 14 11 10
282 wbr-05 wbr India East South Asia Caste-high Indo-European M017 R1a1 15 12 22 10 10 13 10 11
283 wbr-06 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 24 11 11 13 10 9
284 wbr-07 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 25 12 11 13 10 9
285 wbr-08 wbr India East South Asia Caste-high Indo-European M017 R1a1 15 12 18 13 25 11 11 13 10 9
286 wbr-09 wbr India East South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
287 wbr-10 wbr India East South Asia Caste-high Indo-European M124 R2 13 13 17 14 23 10 11 13 11 9
288 wbr-13 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 25 11 11 13 11 9
289 wbr-14 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 25 11 11 13 10 9
290 wbr-15 wbr India East South Asia Caste-high Indo-European M124 R2 14 12 16 14 23 10 10 15 11 11
291 wbr-16 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 18 14 25 10 11 14 10 9
292 wbr-17 wbr India East South Asia Caste-high Indo-European M052 H1 15 12 16 14 22 10 11 12 12 10
293 wbr-18 wbr India East South Asia Caste-high Indo-European M017 R1a1 16 12 17 14 25 11 11 13 10 9
294 wbr-19 wbr India East South Asia Caste-high Indo-European M017 R1a1 15 12 18 13 25 11 11 13 10 9
295 wbr-20 wbr India East South Asia Caste-high Indo-European M124 R2 13 13 15 13 23 10 10 14 10 10
296 amb-01 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
297 amb-03 amb India South South Asia Caste-middle Dravidian M069 H 15 12 16 13 24 9 11 13 13 9
298 amb-04 amb India South South Asia Caste-middle Dravidian M076 L1 14 10 16 12 22 10 14 11 13 9
299 amb-05 amb India South South Asia Caste-middle Dravidian M052 H1 15 12 16 14 22 11 11 12 13 12
300 amb-07 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
301 amb-09 amb India South South Asia Caste-middle Dravidian M069 H 15 12 16 13 24 9 11 13 13 9
302 amb-13 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
303 amb-16 amb India South South Asia Caste-middle Dravidian M069 H 14 12 18 13 24 11 11 13 11 10
304 amb-17 amb India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 24 10 11 12 12 7
305 amb-18 amb India South South Asia Caste-middle Dravidian M076 L1 14 10 16 12 22 10 14 11 13 10
306 amb-21 amb India South South Asia Caste-middle Dravidian M052 H1 15 12 16 14 22 11 11 12 13 12
307 amb-22 amb India South South Asia Caste-middle Dravidian M052 H1 15 12 16 14 22 11 11 12 9 12
308 amb-25 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
309 amb-26 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
310 amb-27 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
311 amb-28 amb India South South Asia Caste-middle Dravidian M069 H 14 12 19 13 24 11 11 13 11 10
312 amb-29 amb India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
313 amb-33 amb India South South Asia Caste-middle Dravidian M017 R1a1 17 12 18 13 25 11 11 13 11 9
314 amb-34 amb India South South Asia Caste-middle Dravidian M076 L1 15 12 16 12 22 11 14 11 13 9
315 amb-35 amb India South South Asia Caste-middle Dravidian M017 R1a1 15 12 17 13 24 10 11 13 10 9
316 amb-36 amb India South South Asia Caste-middle Dravidian M076 L1 15 12 16 12 22 10 14 11 12 9
317 amb-37 amb India South South Asia Caste-middle Dravidian M089/M213 F* 15 13 16 14 21 11 12 13 12 10
318 amb-38 amb India South South Asia Caste-middle Dravidian P15 G2 17 12 18 12 22 10 11 14 11 9
319 amb-39 amb India South South Asia Caste-middle Dravidian M017 R1a1 15 12 17 13 24 10 11 13 10 9
320 amb-40 amb India South South Asia Caste-middle Dravidian M017 R1a1 15 12 17 14 24 10 12 13 10 9
321 amb-41 amb India South South Asia Caste-middle Dravidian M241 J2b2 15 15 15 12 24 10 11 12 13 7
322 amb-42 amb India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 13 9
323 amb-44 amb India South South Asia Caste-middle Dravidian M089/M213 F* 13 12 15 12 23 10 10 15 11 9
324 amb-45 amb India South South Asia Caste-middle Dravidian M052 H1 15 12 16 12 22 10 11 11 11 10
325 ila-04 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 23 11 12 13 11 10
326 ila-05 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 23 11 12 13 11 10
327 ila-15 ila India South South Asia Tribe Dravidian M089/M213 F* 15 13 17 14 22 11 11 13 11 12
328 ila-16 ila India South South Asia Tribe Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
329 ila-18 ila India South South Asia Tribe Dravidian M089/M213 F* 16 13 17 13 21 10 11 14 12 11
330 ila-19 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 24 10 11 13 11 10
331 ila-20 ila India South South Asia Tribe Dravidian M089/M213 F* 16 13 16 12 21 10 11 13 13 10
332 ila-21 ila India South South Asia Tribe Dravidian M089/M213 F* 16 14 17 13 21 10 11 14 12 11
333 ila-22 ila India South South Asia Tribe Dravidian M089/M213 F* 15 14 17 12 21 10 11 13 12 11
334 ila-23 ila India South South Asia Tribe Dravidian M089/M213 F* 15 14 17 12 21 10 11 13 12 11
335 ila-24 ila India South South Asia Tribe Dravidian M089/M213 F* 16 13 17 13 21 10 11 14 12 11
336 ila-28 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 24 10 12 13 11 10
337 ila-29 ila India South South Asia Tribe Dravidian APT H2 16 12 16 13 23 10 11 13 12 9
338 ila-30 ila India South South Asia Tribe Dravidian M089/M213 F* 15 14 18 13 22 9 11 15 11 10
339 ila-31 ila India South South Asia Tribe Dravidian M124 R2 15 12 16 14 21 10 10 14 11 9
340 ila-32 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 23 11 12 13 11 10
341 ila-33 ila India South South Asia Tribe Dravidian APT H2 16 12 17 13 23 10 11 13 12 9
342 ila-34 ila India South South Asia Tribe Dravidian APT H2 16 12 17 13 23 10 11 13 12 9
343 ila-35 ila India South South Asia Tribe Dravidian M356 C5 15 13 16 13 24 10 11 14 12 10
344 ila-36 ila India South South Asia Tribe Dravidian M124 R2 15 12 16 14 24 10 10 14 12 10
345 ila-37 ila India South South Asia Tribe Dravidian M089/M213 F* 16 13 17 13 21 10 11 14 12 11
346 ila-38 ila India South South Asia Tribe Dravidian APT H2 16 12 17 13 23 10 11 13 12 9
347 ila-39 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 24 10 12 13 11 10
348 ila-40 ila India South South Asia Tribe Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
349 ila-41 ila India South South Asia Tribe Dravidian APT H2 16 12 17 13 23 10 11 13 12 9
350 ila-42 ila India South South Asia Tribe Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
351 ila-43 ila India South South Asia Tribe Dravidian M267 J1 14 16 17 13 23 10 11 12 11 9
352 ila-44 ila India South South Asia Tribe Dravidian M052 H1 15 14 16 12 24 10 12 13 11 10
353 ila-49 ila India South South Asia Tribe Dravidian M124 R2 14 12 17 14 23 10 10 14 11 10
354 ila-50 ila India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 12 12 11 11
355 iyn-02 iyn India South South Asia Caste-high Dravidian M017 R1a1 15 12 18 14 24 10 11 13 10 9
356 iyn-05 iyn India South South Asia Caste-high Dravidian M017 R1a1 16 13 19 13 25 11 11 14 10 9
357 iyn-07 iyn India South South Asia Caste-high Dravidian M124 R2 15 12 16 13 23 10 10 13 11 9
358 iyn-08 iyn India South South Asia Caste-high Dravidian M017 R1a1 15 12 19 14 25 10 11 13 10 9
359 iyn-11 iyn India South South Asia Caste-high Dravidian M124 R2 14 12 16 13 23 10 10 15 11 10
360 iyn-12 iyn India South South Asia Caste-high Dravidian M017 R1a1 15 12 17 14 25 11 11 13 11 9
361 iyn-14 iyn India South South Asia Caste-high Dravidian M052 H1 15 17 14 21 11 11 12 11 10
362 iyn-15 iyn India South South Asia Caste-high Dravidian M158 J2a1e 15 15 16 13 23 10 11 13 13 11
363 iyn-16 iyn India South South Asia Caste-high Dravidian M052 H1 14 12 16 13 22 10 11 12 11 10
364 iyn-17 iyn India South South Asia Caste-high Dravidian M017 R1a1 16 12 17 13 25 10 11 13 10 9
365 iyn-18 iyn India South South Asia Caste-high Dravidian M124 R2 14 12 16 13 22 11 10 13 11 11
366 iyn-19 iyn India South South Asia Caste-high Dravidian M017 R1a1 15 12 17 14 25 10 11 13 10 9
367 iyn-21 iyn India South South Asia Caste-high Dravidian M017 R1a1 15 12 19 13 25 10 11 13 10 10
368 iyn-22 iyn India South South Asia Caste-high Dravidian M410 J2a 14 16 17 13 22 10 11 13 11 11
369 iyn-23 iyn India South South Asia Caste-high Dravidian P15 G2 16 12 16 12 22 10 11 15 12 9
370 iyn-24 iyn India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 13 13 9
371 iyn-25 iyn India South South Asia Caste-high Dravidian M017 R1a1 16 13 18 13 25 11 11 13 10 9
372 iyn-26 iyn India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
373 iyn-27 iyn India South South Asia Caste-high Dravidian M410 J2a 14 14 17 13 23 10 11 11 13 11
374 iyn-28 iyn India South South Asia Caste-high Dravidian M241 J2b2 15 15 17 12 24 12 11 12 12 7
375 iyn-29 iyn India South South Asia Caste-high Dravidian M076 L1 14 12 17 12 22 10 14 11 13 9
376 iyn-30 iyn India South South Asia Caste-high Dravidian M410 J2a 14 14 17 13 23 10 11 12 12 11
377 iyn-31 iyn India South South Asia Caste-high Dravidian M017 R1a1 16 12 17 13 25 10 11 13 10 9
378 iyn-33 iyn India South South Asia Caste-high Dravidian P15 G2 16 12 16 12 22 10 11 15 13 9
379 iyn-35 iyn India South South Asia Caste-high Dravidian M052 H1 15 12 18 14 22 10 11 12 12 10
380 iyn-36 iyn India South South Asia Caste-high Dravidian P15 G2 15 12 16 12 22 10 11 16 13 9
381 iyn-39 iyn India South South Asia Caste-high Dravidian M410 J2a 14 14 16 13 23 10 11 12 11 10
382 iyn-41 iyn India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 13 9
383 iyn-42 iyn India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
384 iyn-43 iyn India South South Asia Caste-high Dravidian P15 G2 15 12 16 12 22 10 11 15 13 9
385 iyr-01 iyr India South South Asia Caste-high Dravidian M410 J2a 14 14 17 13 23 10 11 12 10 9
386 iyr-02 iyr India South South Asia Caste-high Dravidian M017 R1a1 15 12 17 15 25 10 11 13 10 9
387 iyr-03 iyr India South South Asia Caste-high Dravidian M017 R1a1 15 12 18 14 24 10 11 13 10 9
388 iyr-06 iyr India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 13 9
389 iyr-08 iyr India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 11 9
390 iyr-09 iyr India South South Asia Caste-high Dravidian M124 R2 15 12 16 13 23 10 10 15 10 10
391 iyr-10 iyr India South South Asia Caste-high Dravidian M241 J2b2 14 14 17 13 23 10 11 12 10 9
392 iyr-11 iyr India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
393 iyr-12 iyr India South South Asia Caste-high Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
394 iyr-14 iyr India South South Asia Caste-high Dravidian M017 R1a1 16 12 17 13 24 11 11 13 10 10
395 iyr-15 iyr India South South Asia Caste-high Dravidian P15 G2 15 12 16 12 22 10 11 15 11 9
396 iyr-19 iyr India South South Asia Caste-high Dravidian M207 R* 14 12 16 14 24 10 12 12 11 10
397 iyr-20 iyr India South South Asia Caste-high Dravidian M076 L1 14 12 16 12 22 10 14 11 11 9
398 iyr-25 iyr India South South Asia Caste-high Dravidian M124 R2 14 12 15 14 23 10 10 13 11 10
399 iyr-27 iyr India South South Asia Caste-high Dravidian M076 L1 12 12 16 12 22 11 14 11 11 9
400 iyr-28 iyr India South South Asia Caste-high Dravidian M410 J2a 14 14 17 13 23 10 11 12 10 9
401 iyr-30 iyr India South South Asia Caste-high Dravidian M017 R1a1 15 12 18 14 24 10 11 13 10 9
402 iyr-31 iyr India South South Asia Caste-high Dravidian M017 R1a1 17 12 17 14 27 10 11 13 11 9
403 iyr-38 iyr India South South Asia Caste-high Dravidian M124 R2 14 12 16 13 23 10 10 14 10 10
404 iyr-39 iyr India South South Asia Caste-high Dravidian P15 G2 15 12 16 12 22 10 11 15 12 9
405 iyr-40 iyr India South South Asia Caste-high Dravidian M356 C5 15 13 16 14 23 10 12 14 11 10
406 iyr-41 iyr India South South Asia Caste-high Dravidian M410 J2a 14 15 16 14 23 10 11 12 12 11
407 iyr-43 iyr India South South Asia Caste-high Dravidian P15 G2 15 12 16 12 22 10 11 16 13 9
408 iyr-45 iyr India South South Asia Caste-high Dravidian M017 R1a1 15 12 18 14 24 10 11 12 10 9
409 iyr-46 iyr India South South Asia Caste-high Dravidian M069 H 13 12 17 13 23 11 11 14 11 10
410 iyr-48 iyr India South South Asia Caste-high Dravidian M017 R1a1 16 12 17 13 25 11 11 14 10 9
411 iyr-49 iyr India South South Asia Caste-high Dravidian M356 C5 15 14 16 12 23 10 11 14 12 12
412 iyr-50 iyr India South South Asia Caste-high Dravidian M410 J2a 14 14 17 13 24 10 11 12 13 9
413 iyr-51 iyr India South South Asia Caste-high Dravidian M017 R1a1 15 12 17 13 24 10 11 13 10 9
414 kd1-01 kdr India South South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 9
415 kd1-02 kdr India South South Asia Tribe Dravidian M095 O2a 17 12 16 13 25 11 13 14 11 9
416 kd1-03 kdr India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
417 kd1-06 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 16 14 25 11 13 14 12 10
418 kd1-07 kdr India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 12 11 10
419 kd1-13 kdr India South South Asia Tribe Dravidian APT H2 16 12 16 14 21 10 11 13 12 10
420 kd1-16 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 13 11 10
421 kd1-18 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 14 14 25 11 13 14 12 9
422 kd1-19 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 13 11 10
423 kd1-21 kdr India South South Asia Tribe Dravidian M410 J2a 14 16 17 13 23 11 11 14 12 10
424 kd1-23 kdr India South South Asia Tribe Dravidian M089/M213 F* 16 13 16 14 21 11 11 14 13 10
425 kd1-25 kdr India South South Asia Tribe Dravidian M089/M213 F* 16 13 16 14 21 11 11 14 13 10
426 kd1-27 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 14 9
427 kd1-32 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 8
428 kd1-36 kdr India South South Asia Tribe Dravidian M095 O2a 14 12 16 13 25 11 13 13 11 10
429 kd1-37 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 8
430 kd1-38 kdr India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 12 12 10
431 kd1-40 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 13 11 10
432 kd1-41 kdr India South South Asia Tribe Dravidian APT H2 16 12 16 14 21 10 11 13 12 10
433 kd1-46 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 8
434 kd1-47 kdr India South South Asia Tribe Dravidian APT H2 16 12 16 14 21 10 11 13 12 10
435 kd1-48 kdr India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 12 12 10
436 kd1-49 kdr India South South Asia Tribe Dravidian APT H2 16 12 16 14 21 10 11 13 12 10
437 kd1-50 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 15 13 25 10 13 14 12 9
438 kd1-51 kdr India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 13 11 10
439 kd1-55 kdr India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
440 kd1-62 kdr India South South Asia Tribe Dravidian M089/M213 F* 15 13 16 14 21 11 11 14 16 11
441 kot-12 kot India South South Asia Tribe Dravidian M124 R2 14 13 15 13 23 10 10 14 10 11
442 kot-15 kot India South South Asia Tribe Dravidian M017 R1a1 16 12 17 14 25 10 11 13 10 9
443 kot-16 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
444 kot-18 kot India South South Asia Tribe Dravidian M052 H1 15 12 17 13 22 10 11 12 11 10
445 kot-23 kot India South South Asia Tribe Dravidian M017 R1a1 15 12 19 13 23 11 11 14 10 9
446 kot-24 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
447 kot-25 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
448 kot-26 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
449 kot-29 kot India South South Asia Tribe Dravidian M089/M213 F* 14 15 16 14 23 10 11 13 12 10
450 kot-34 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
451 kot-36 kot India South South Asia Tribe Dravidian M124 R2 14 12 15 13 23 10 10 14 10 11
452 kot-40 kot India South South Asia Tribe Dravidian M052 H1
453 kot-41 kot India South South Asia Tribe Dravidian M124 R2 14 12 15 13 23 10 10 14 10 11
454 kot-42 kot India South South Asia Tribe Dravidian M124 R2 14 12 15 13 23 10 10 14 10 11
455 kot-43 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
456 kot-45 kot India South South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
457 kr2-01 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 10 13 14 12 9
458 kr2-02 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 13 9
459 kr2-03 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 12 9
460 kr2-04 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 26 10 13 14 11 9
461 kr2-05 krd India South South Asia Tribe Dravidian M017 R1a1 15 12 17 14 25 10 11 13 10 9
462 kr2-06 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 10 13 14 13 9
463 kr2-07 krd India South South Asia Tribe Dravidian M089/M213 F* 15 12 16 13 25 10 11 13 12 10
464 kr2-08 krd India South South Asia Tribe Dravidian M095 O2a 15 13 16 15 25 11 13 14 12 9
465 kr2-09 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 26 10 13 13 13 9
466 kr2-10 krd India South South Asia Tribe Dravidian M089/M213 F* 16 13 17 13 21 11 11 15 12 10
467 kr2-12 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 15 25 10 13 12 12 9
468 kr2-13 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 10 13 13 13 9
469 kr2-14 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 12 10
470 kr2-15 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 14 25 10 13 14 13 9
471 kr2-18 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 12 9
472 kr2-21 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 12 9
473 kr2-22 krd India South South Asia Tribe Dravidian M089/M213 F* 16 13 16 14 22 10 10 13 12 11
474 kr2-23 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 10 13 14 12 9
475 kr2-24 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 10 13 14 12 9
476 kr2-25 krd India South South Asia Tribe Dravidian M089/M213 F* 17 13 16 13 21 11 11 13 12 10
477 kr2-26 krd India South South Asia Tribe Dravidian M052 H1 12 16 14 22 10 11 12 11 11
478 kr2-27 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 14 25 10 13 14 13 9
479 kr2-33 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 13 9
480 kr2-40 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 13 9
481 kr2-41 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 13 9
482 kr2-43 krd India South South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 10 13 14 12 9
483 kr2-44 krd India South South Asia Tribe Dravidian M089/M213 F* 15 13 16 14 22 10 11 14 11 12
484 kr2-46 krd India South South Asia Tribe Dravidian M017 R1a1 16 12 17 13 25 10 11 13 10 9
485 kr2-47 krd India South South Asia Tribe Dravidian M089/M213 F* 15 13 16 14 22 10 11 14 11 12
486 kr2-56 krd India South South Asia Tribe Dravidian M089/M213 F* 15 13 16 14 22 10 11 14 11 12
487 kur-03 kur India South South Asia Tribe Dravidian M052 H1 15 12 17 13 22 10 11 13 11 10
488 kur-08 kur India South South Asia Tribe Dravidian M069 H 15 13 17 13 24 10 11 13 12 10
489 kur-10 kur India South South Asia Tribe Dravidian M089/M213 F* 16 13 17 13 21 10 11 14 12 10
490 kur-16 kur India South South Asia Tribe Dravidian M052 H1
491 kur-17 kur India South South Asia Tribe Dravidian M076 L1 14 12 17 12 22 10 14 11 12 9
492 kur-23 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 13 11 10
493 kur-26 kur India South South Asia Tribe Dravidian M052 H1 15 12 17 13 22 10 11 13 11 10
494 kur-29 kur India South South Asia Tribe Dravidian M052 H1 15 12 17 13 22 10 11 13 11 10
495 kur-30 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 13 11 10
496 kur-34 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 13 11 10
497 kur-38 kur India South South Asia Tribe Dravidian M124 R2 15 12 16 13 23 10 10 13 10 11
498 kur-39 kur India South South Asia Tribe Dravidian M052 H1 12 12 16 14 22 10 11 13 11 10
499 kur-40 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 11 13 11 10
500 kur-41 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 13 11 10
501 kur-43 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 13 11 10
502 kur-44 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 13 11 10
503 kur-45 kur India South South Asia Tribe Dravidian M124 R2 15 12 17 14 23 10 10 12 12 9
504 kur-46 kur India South South Asia Tribe Dravidian M052 H1 15 12 16 14 22 11 11 13 11 10
505 kur-49 kur India South South Asia Tribe Dravidian M089/M213 F* 15 14 17 14 21 10 11 13 12 11
506 pln-01 pln India South South Asia Caste-low Dravidian M017 R1a1 16 12 18 12 25 11 11 13 10 9
507 pln-03 pln India South South Asia Caste-low Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
508 pln-04 pln India South South Asia Caste-low Dravidian M410 J2a 14 15 18 14 23 10 11 12 11 11
509 pln-05 pln India South South Asia Caste-low Dravidian M089/M213 F* 15 13 15 14 23 10 11 13 13 11
510 pln-06 pln India South South Asia Caste-low Dravidian M216/RPS4Y C* 15 13 17 14 24 10 11 13 12 10
511 pln-07 pln India South South Asia Caste-low Dravidian M076 L1 14 12 16 12 22 10 15 11 12 9
512 pln-08 pln India South South Asia Caste-low Dravidian M017 R1a1 17 12 16 14 25 10 11 13 10 9
513 pln-10 pln India South South Asia Caste-low Dravidian M357 L3 14 12 16 12 22 10 14 11 14 9
514 pln-19 pln India South South Asia Caste-low Dravidian M124 R2 14 12 17 14 23 10 10 14 10 11
515 pln-20 pln India South South Asia Caste-low Dravidian M241 J2b2 15 15 17 12 24 9 11 12 11 7
516 pln-21 pln India South South Asia Caste-low Dravidian M052 H1 15 12 16 12 21 10 11 12 11 10
517 pln-22 pln India South South Asia Caste-low Dravidian M241 J2b2 15 15 15 13 24 9 11 12 11 7
518 pln-23 pln India South South Asia Caste-low Dravidian M076 L1 14 12 16 12 22 10 14 11 13 9
519 pln-24 pln India South South Asia Caste-low Dravidian M017 R1a1 15 12 17 14 25 10 11 13 11 9
520 pln-25 pln India South South Asia Caste-low Dravidian M269 R1b3 14 12 16 14 24 10 13 12 12 9
521 pln-26 pln India South South Asia Caste-low Dravidian M076 L1 14 12 17 12 21 10 14 11 11 9
522 pln-28 pln India South South Asia Caste-low Dravidian M124 R2 14 13 16 12 23 10 10 14 11 10
523 pln-29 pln India South South Asia Caste-low Dravidian M124 R2 15 12 16 14 23 10 10 13 11 10
524 pln-30 pln India South South Asia Caste-low Dravidian M017 R1a1 15 12 18 13 25 11 11 13 10 8
525 pln-31 pln India South South Asia Caste-low Dravidian M017 R1a1 15 12 18 13 26 11 13 10 9
526 pln-32 pln India South South Asia Caste-low Dravidian M241 J2b2 15 15 15 13 24 9 11 12 11 7
527 pln-33 pln India South South Asia Caste-low Dravidian APT H2 16 14 13 21 10 11 13 12 9
528 pln-34 pln India South South Asia Caste-low Dravidian M052 H1 15 12 16 13 20 10 11 12 11 9
529 pln-37 pln India South South Asia Caste-low Dravidian M124 R2 15 12 16 14 23 10 10 14 11 10
530 pln-39 pln India South South Asia Caste-low Dravidian M089/M213 F* 14 12 16 12 25 10 14 11 13 11
531 pln-40 pln India South South Asia Caste-low Dravidian M017 R1a1 15 12 17 14 24 10 11 14 10 9
532 pln-41 pln India South South Asia Caste-low Dravidian M017 R1a1 16 12 18 13 25 11 11 13 10 9
533 pln-42 pln India South South Asia Caste-low Dravidian M076 L1 15 12 18 12 22 10 14 11 13 9
534 pln-44 pln India South South Asia Caste-low Dravidian M052 H1 16 12 17 13 23 10 11 12 11 10
535 tod-08 tod India South South Asia Tribe Dravidian M410 J2a 14 15 16 14 23 11 11 13 12 10
536 tod-17 tod India South South Asia Tribe Dravidian M076 L1 14 12 15 12 22 10 15 11 11 10
537 tod-18 tod India South South Asia Tribe Dravidian M076 L1 14 12 15 12 22 10 15 11 11 10
538 tod-22 tod India South South Asia Tribe Dravidian M410 J2a 14 15 16 14 23 10 11 13 12 10
539 tod-30 tod India South South Asia Tribe Dravidian M076 L1 14 12 16 12 22 10 14 11 13 9
540 tod-34 tod India South South Asia Tribe Dravidian M216/RPS4Y C* 17 13 16 13 25 9 11 14 13 10
541 tod-48 tod India South South Asia Tribe Dravidian M017 R1a1 17 12 17 13 25 10 11 13 10 9
542 tod-51 tod India South South Asia Tribe Dravidian M076 L1 14 12 15 12 22 10 15 11 11 10
543 van-03 van India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 12 8
544 van-04 van India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 11 10
545 van-05 van India South South Asia Caste-middle Dravidian M124 R2 14 12 16 13 23 10 10 14 10 11
546 van-06 van India South South Asia Caste-middle Dravidian M052 H1 16 12 17 14 22 10 11 12 11 9
547 van-07 van India South South Asia Caste-middle Dravidian M052 H1 15 12 17 14 23 11 11 12 13 10
548 van-08 van India South South Asia Caste-middle Dravidian M241 J2b2 15 17 16 12 27 11 11 12 13 7
549 van-09 van India South South Asia Caste-middle Dravidian M124 R2 14 12 16 13 23 10 10 13 11 10
550 van-10 van India South South Asia Caste-middle Dravidian M017 R1a1 15 12 17 13 25 11 11 13 10 9
551 van-12 van India South South Asia Caste-middle Dravidian M410 J2a 14 15 16 13 23 10 11 13 11
552 van-13 van India South South Asia Caste-middle Dravidian M356 C5 15 13 16 13 25 10 11 13 12 11
553 van-14 van India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
554 van-15 van India South South Asia Caste-middle Dravidian M069 H 15 12 17 13 21 10 11 12 11 9
555 van-17 van India South South Asia Caste-middle Dravidian M052 H1 15 12 16 14 22 10 11 12 11 10
556 van-18 van India South South Asia Caste-middle Dravidian M124 R2 14 12 16 14 23 10 10 13 12 10
557 van-19 van India South South Asia Caste-middle Dravidian M410 J2a 14 14 17 13 24 10 11 12 12 10
558 van-20 van India South South Asia Caste-middle Dravidian M089/M213 F* 17 13 16 14 22 10 11 13 12 9
559 van-22 van India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 13 11 9
560 van-23 van India South South Asia Caste-middle Dravidian M076 L1 14 12 15 12 22 10 14 11 11 10
561 van-24 van India South South Asia Caste-middle Dravidian M076 L1 14 12 15 12 22 10 14 11 11 10
562 van-25 van India South South Asia Caste-middle Dravidian M052 H1 14 12 17 14 23 9 11 13 11 10
563 van-27 van India South South Asia Caste-middle Dravidian M069 H 14 12 16 13 24 11 11 14 10 11
564 van-28 van India South South Asia Caste-middle Dravidian M089/M213 F* 15 13 16 13 22 10 11 13 13 10
565 van-29 van India South South Asia Caste-middle Dravidian M089/M213 F* 15 14 15 13 22 10 11 13 12 11
566 van-32 van India South South Asia Caste-middle Dravidian M089/M213 F* 15 14 15 13 22 10 11 13 12 9
567 van-39 van India South South Asia Caste-middle Dravidian M017 R1a1 16 12 16 13 25 11 11 13 10 10
568 vlr-01 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
569 vlr-02 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 16 13 22 10 11 12 12 10
570 vlr-03 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
571 vlr-04 vlr India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
572 vlr-05 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 12 11 7
573 vlr-06 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 17 13 22 10 11 12 12 10
574 vlr-07 vlr India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
575 vlr-08 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 12 12 7
576 vlr-10 vlr India South South Asia Caste-middle Dravidian M346 Q4
577 vlr-12 vlr India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
578 vlr-15 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
579 vlr-16 vlr India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 11 9
580 vlr-17 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
581 vlr-18 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
582 vlr-19 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 17 13 22 10 11 12 10 10
583 vlr-20 vlr India South South Asia Caste-middle Dravidian M076 L1 14 12 16 12 22 10 14 11 12 9
584 vlr-21 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
585 vlr-23 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
586 vlr-24 vlr India South South Asia Caste-middle Dravidian M017 R1a1 15 12 18 13 25 10 11 13 10 9
587 vlr-31 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
588 vlr-32 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
589 vlr-33 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
590 vlr-34 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 17 12 23 10 11 13 12 7
591 vlr-36 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
592 vlr-37 vlr India South South Asia Caste-middle Dravidian M017 R1a1 15 12 17 14 24 11 13 12 9
593 vlr-38 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 16 14 22 10 11 12 12 10
594 vlr-40 vlr India South South Asia Caste-middle Dravidian M017 R1a1 15 12 17 13 25 10 11 13 11 9
595 vlr-41 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 22 9 11 12 13 10
596 vlr-42 vlr India South South Asia Caste-middle Dravidian M017 R1a1 15 12 16 13 24 11 11 13 10 9
597 vlr-43 vlr India South South Asia Caste-middle Dravidian M241 J2b2 15 15 16 12 23 10 11 13 12 7
598 vlr-44 vlr India South South Asia Caste-middle Dravidian M052 H1 15 12 16 13 22 10 11 12 11 10
599 hal-02 hal India Central South Asia Tribe Indo-European M052 H1 15 12 16 12 22 10 11 12 11 10
600 hal-04 hal India Central South Asia Tribe Indo-European M089/M213 F* 15 12 17 12 25 10 14 15 11 10
601 hal-05 hal India Central South Asia Tribe Indo-European M346 Q4
602 hal-06 hal India Central South Asia Tribe Indo-European M017 R1a1 15 13 17 14 24 10 11 12 11 9
603 hal-12 hal India Central South Asia Tribe Indo-European M017 R1a1 15 13 17 14 24 10 11 12 11 9
604 hal-13 hal India Central South Asia Tribe Indo-European M017 R1a1 15 13 18 14 24 10 11 12 11 9
605 hal-14 hal India Central South Asia Tribe Indo-European M017 R1a1 15 13 17 14 24 10 11 12 11 9
606 hal-18 hal India Central South Asia Tribe Indo-European M089/M213 F* 16 13 17 14 23 11 11 14 13 10
607 hal-24 hal India Central South Asia Tribe Indo-European APT H2 15 12 16 14 21 11 11 13 13 12
608 hal-25 hal India Central South Asia Tribe Indo-European M052 H1 15 12 16 14 21 10 11 13 10 9
609 hal-26 hal India Central South Asia Tribe Indo-European APT H2 15 14 17 14 21 11 11 13 11 9
610 hal-28 hal India Central South Asia Tribe Indo-European M052 H1 15 12 17 13 22 10 11 12 11 10
611 hal-29 hal India Central South Asia Tribe Indo-European M089/M213 F* 15 12 16 14 21 12 11 13 12 11
612 hal-30 hal India Central South Asia Tribe Indo-European M052 H1 15 12 16 12 22 10 11 12 11 10
613 hal-31 hal India Central South Asia Tribe Indo-European M095 O2a 15 12 15 13 26 11 13 12 12 9
614 hal-32 hal India Central South Asia Tribe Indo-European M052 H1 16 12 17 13 23 10 11 12 13 10
615 hal-34 hal India Central South Asia Tribe Indo-European M095 O2a 15 12 17 13 25 11 13 14 12 10
616 hal-35 hal India Central South Asia Tribe Indo-European M095 O2a 15 12 16 13 25 10 13 15 12 10
617 hal-40 hal India Central South Asia Tribe Indo-European M095 O2a 15 12 17 13 25 11 13 14 12 9
618 hal-49 hal India Central South Asia Tribe Indo-European M095 O2a 15 12 17 13 25 11 13 14 12 9
619 hal-50 hal India Central South Asia Tribe Indo-European M095 O2a 15 12 16 13 25 10 13 15 12 10
620 kmr-04 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
621 kmr-06 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
622 kmr-07 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
623 kmr-08 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
624 kmr-10 kmr India Central South Asia Tribe Dravidian M069 H 15 12 16 13 22 10 11 12 12 9
625 kmr-11 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
626 kmr-13 kmr India Central South Asia Tribe Dravidian M076 L1 15 12 16 12 22 10 14 11 13 10
627 kmr-16 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
628 kmr-18 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
629 kmr-26 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
630 kmr-27 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
631 kmr-30 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
632 kmr-31 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
633 kmr-33 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
634 kmr-37 kmr India Central South Asia Tribe Dravidian M089/M213 F* 12 12 16 13 22 10 11 12 12 9
635 kmr-38 kmr India Central South Asia Tribe Dravidian M076 L1 14 12 16 12 22 10 14 11 13 10
636 kmr-39 kmr India Central South Asia Tribe Dravidian M052 H1 15 12 16 13 22 10 11 12 12 9
637 kmr-40 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 13 9
638 kmr-41 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 13 9
639 kmr-43 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 16 12 25 10 13 13 12 9
640 kmr-44 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 16 12 25 10 13 13 12 9
641 kmr-45 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 16 12 25 10 13 13 12 9
642 kmr-46 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 9
643 kmr-47 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 9
644 kmr-49 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 12 9
645 kmr-53 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 9
646 kmr-54 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 16 12 25 10 13 13 12 9
647 kmr-55 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 9
648 kmr-56 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 9
649 kmr-57 kmr India Central South Asia Tribe Dravidian M095 O2a 15 12 17 13 25 11 13 14 12 9
650 mur-02 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 14 23 10 11 12 11 10
651 mur-03 mur India Central South Asia Tribe Dravidian M095 O2a 15 12 16 13 24 11 13 12 12 9
652 mur-04 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 10
653 mur-05 mur India Central South Asia Tribe Dravidian M052 H1 15 13 16 12 22 11 12 11 10
654 mur-08 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 10
655 mur-09 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 10
656 mur-13 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 23 10 11 12 11 10
657 mur-14 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 23 10 11 12 11 10
658 mur-15 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 10
659 mur-16 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 10
660 mur-17 mur India Central South Asia Tribe Dravidian M052 H1 15 16 12 22 10 11 12 11 10
661 mur-18 mur India Central South Asia Tribe Dravidian M052 H1 16 12 16 12 22 10 11 12 11 10
662 mur-19 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 10 10
663 mur-20 mur India Central South Asia Tribe Dravidian M089/M213 F* 16 13 17 14 25 11 11 14 14 10
664 mur-21 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 23 10 11 12 11 10
665 mur-24 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 11
666 mur-33 mur India Central South Asia Tribe Dravidian M089/M213 F* 16 13 17 14 21 10 11 14 12 10
667 mur-35 mur India Central South Asia Tribe Dravidian M095 O2a 15 12 16 13 25 11 13 14 12 10
668 mur-36 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 12 22 10 11 12 11 10
669 mur-38 mur India Central South Asia Tribe Dravidian M052 H1 15 12 16 14 22 10 11 12 11 10
670 kbr-01 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 18 15 25 10 11 13 10 9
671 kbr-02 kbr India West South Asia Caste-high Indo-European M410 J2a 14 15 16 13 23 10 11 12 11 10
672 kbr-03 kbr India West South Asia Caste-high Indo-European M124 R2 14 12 16 13 23 10 10 14 11 10
673 kbr-04 kbr India West South Asia Caste-high Indo-European M197 H1 14 13 18 13 22 10 11 12 11 11
674 kbr-05 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 13 17 12 23 10 10 13 10 10
675 kbr-06 kbr India West South Asia Caste-high Indo-European M124 R2 15 12 16 13 23 10 10 14 10 10
676 kbr-07 kbr India West South Asia Caste-high Indo-European M410 J2a 14 16 16 14 22 10 11 13 11 10
677 kbr-08 kbr India West South Asia Caste-high Indo-European M017 R1a1 17 12 18 13 24 10 11 13 10 9
678 kbr-09 kbr India West South Asia Caste-high Indo-European M017 R1a1 16 12 18 13 24 11 11 13 10 9
679 kbr-10 kbr India West South Asia Caste-high Indo-European M052 H1 14 13 18 13 22 11 11 12 11 11
680 kbr-11 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
681 kbr-12 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
682 kbr-14 kbr India West South Asia Caste-high Indo-European M017 R1a1 16 12 17 13 24 10 11 13 10 9
683 kbr-16 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
684 kbr-17 kbr India West South Asia Caste-high Indo-European M410 J2a 15 15 16 13 24 10 11 12 13 10
685 kbr-19 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 16 13 25 10 11 13 10 9
686 kbr-20 kbr India West South Asia Caste-high Indo-European M017 R1a1 16 12 18 13 24 11 11 13 10 9
687 kbr-21 kbr India West South Asia Caste-high Indo-European M124 R2 14 12 16 13 23 10 10 14 10 10
688 kbr-23 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 10
689 kbr-24 kbr India West South Asia Caste-high Indo-European M076 L1 14 12 16 13 21 11 14 11 13 9
690 kbr-25 kbr India West South Asia Caste-high Indo-European M410 J2a 14 14 16 13 24 10 11 12 12 10
691 kbr-26 kbr India West South Asia Caste-high Indo-European M124 R2 14 12 16 13 23 10 10 14 10 10
692 kbr-27 kbr India West South Asia Caste-high Indo-European M124 R2 14 12 16 13 23 10 10 14 10 10
693 kbr-28 kbr India West South Asia Caste-high Indo-European APT H2 15 12 16 14 21 9 11 13 11 10
694 kbr-31 kbr India West South Asia Caste-high Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 10
695 mrt-02 mrt India West South Asia Caste-middle Indo-European M076 L1 14 12 14 14 21 11 14 11 13 9
696 mrt-03 mrt India West South Asia Caste-middle Indo-European M089/M213 F* 15 14 17 14 22 10 11 14 12 10
697 mrt-05 mrt India West South Asia Caste-middle Indo-European M076 L1 14 12 17 14 22 10 15 11 12 9
698 mrt-06 mrt India West South Asia Caste-middle Indo-European M052 H1 13 12 17 13 21 10 11 12 11 10
699 mrt-07 mrt India West South Asia Caste-middle Indo-European M356 C5 17 13 17 12 23 10 11 12 13 10
700 mrt-12 mrt India West South Asia Caste-middle Indo-European APT H2 14 12 16 14 22 10 11 12 12 10
701 mrt-20 mrt India West South Asia Caste-middle Indo-European M241 J2b2 15 15 17 12 25 10 11 12 11 7
702 mrt-21 mrt India West South Asia Caste-middle Indo-European M124 R2 14 12 15 14 23 10 10 14 10 10
703 mrt-22 mrt India West South Asia Caste-middle Indo-European M017 R1a1 16 12 17 13 25 11 11 13 10 9
704 mrt-23 mrt India West South Asia Caste-middle Indo-European M124 R2 14 13 17 13 23 10 10 14 10 10
705 mrt-26 mrt India West South Asia Caste-middle Indo-European M052 H1 15 12 16 13 22 10 11 12 11 10
706 mrt-27 mrt India West South Asia Caste-middle Indo-European M076 L1 14 12 17 14 22 10 16 11 12 9
707 mrt-28 mrt India West South Asia Caste-middle Indo-European M052 H1 16 12 18 13 22 11 10 12 11 10
708 mrt-31 mrt India West South Asia Caste-middle Indo-European M052 H1 15 12 15 13 22 10 11 13 12 10
709 mrt-36 mrt India West South Asia Caste-middle Indo-European M052 H1 15 12 17 14 22 10 11 12 12 10
710 mrt-37 mrt India West South Asia Caste-middle Indo-European M241 J2b2 16 15 16 13 24 9 11 12 13 8
711 mrt-39 mrt India West South Asia Caste-middle Indo-European M124 R2 14 12 17 14 23 10 10 14 12 10
712 mrt-40 mrt India West South Asia Caste-middle Indo-European M017 R1a1 15 12 18 12 24 10 11 13 10 9
713 mrt-41 mrt India West South Asia Caste-middle Indo-European M410 J2a 14 16 17 14 23 11 11 13 12 10
714 mrt-42 mrt India West South Asia Caste-middle Indo-European M124 R2 14 12 15 14 23 10 10 14 11 10
715 nbh-05 nbh India West South Asia Caste-low Indo-European M076 L1 14 12 16 14 22 10 14 11 13 9
716 nbh-07 nbh India West South Asia Caste-low Indo-European M052 H1 15 12 16 12 21 10 11 12 12 9
717 nbh-09 nbh India West South Asia Caste-low Indo-European M052 H1 15 12 16 14 22 10 11 12 12 12
718 nbh-10 nbh India West South Asia Caste-low Indo-European M052 H1 15 12 15 14 22 10 11 12 11 9
719 nbh-11 nbh India West South Asia Caste-low Indo-European M241 J2b2 15 14 17 12 24 11 11 13 11 7
720 nbh-15 nbh India West South Asia Caste-low Indo-European M017 R1a1 16 12 16 13 25 10 11 13 10 9
721 nbh-17 nbh India West South Asia Caste-low Indo-European M158 J2a1e 15 15 16 13 23 10 11 13 11 10
722 nbh-20 nbh India West South Asia Caste-low Indo-European M017 R1a1 15 12 16 13 22 10 11 11 11 10
723 nbh-22 nbh India West South Asia Caste-low Indo-European P15 G2 14 12 16 12 22 11 11 13 12 8
724 nbh-30 nbh India West South Asia Caste-low Indo-European M052 H1 15 12 16 13 21 9 11 12 11 9
725 nbh-31 nbh India West South Asia Caste-low Indo-European M356 C5 13 13 15 13 25 10 11 14 12 12
726 nbh-33 nbh India West South Asia Caste-low Indo-European M017 R1a1 15 12 16 13 24 10 11 14 11 9
727 nbh-34 nbh India West South Asia Caste-low Indo-European M052 H1 15 12 16 13 21 10 11 12 11 9
728 nbh-36 nbh India West South Asia Caste-low Indo-European M052 H1 15 12 15 13 22 10 11 13 11 10
729 HGDP00341 Burusho Pakistan North South Asia Burushaski* M017 R1a1 16 12 16 13 25 10 12 13 10 9
730 HGDP00346 Burusho Pakistan North South Asia Burushaski* M017 R1a1 16 12 16 13 25 10 12 13 11 10
731 HGDP00351 Burusho Pakistan North South Asia Burushaski* M377 G5 17 12 17 13 23 11 11 13 11 10
732 HGDP00359 Burusho Pakistan North South Asia Burushaski* M197 H1 15 13 18 13 22 10 11 12 12 11
733 HGDP00364 Burusho Pakistan North South Asia Burushaski* M009 K* 14 12 16 13 23 9 12 13 11 10
734 HGDP00372 Burusho Pakistan North South Asia Burushaski* M207 R* 15 12 16 14 23 10 12 13 11 10
735 HGDP00376 Burusho Pakistan North South Asia Burushaski* M124 R2 14 12 17 13 24 10 10 14 10 10
736 HGDP00382 Burusho Pakistan North South Asia Burushaski* M357 L3 15 12 16 13 22 10 14 12 13 10
737 HGDP00388 Burusho Pakistan North South Asia Burushaski* M207 R* 14 12 16 14 23 10 12 13 11 10
738 HGDP00392 Burusho Pakistan North South Asia Burushaski* M241 J2b2 15 15 16 12 24 10 11 12 11 7
739 HGDP00397 Burusho Pakistan North South Asia Burushaski* M124 R2 15 12 15 14 24 10 10 14 12 10
740 HGDP00402 Burusho Pakistan North South Asia Burushaski* M207 R* 14 12 16 13 23 10 12 13 11 10
741 HGDP00407 Burusho Pakistan North South Asia Burushaski* M207 R* 14 12 16 13 23 10 12 13 11 10
742 HGDP00412 Burusho Pakistan North South Asia Burushaski* M134 O3e 16 12 17 12 23 10 12 12 13 10
743 HGDP00417 Burusho Pakistan North South Asia Burushaski* M357 L3 16 12 16 13 22 10 14 12 12 10
744 HGDP00423 Burusho Pakistan North South Asia Burushaski* M217 C3 15 13 17 13 23 10 11 15 12 11
745 HGDP00428 Burusho Pakistan North South Asia Burushaski* M052 H1* 15 12 16 14 22 11 11 12 12 10
746 HGDP00433 Burusho Pakistan North South Asia Burushaski* M124 R2 15 12 15 14 24 10 10 14 11 10
747 HGDP00438 Burusho Pakistan North South Asia Burushaski* M052 H1* 15 12 16 15 22 11 11 12 12 10
748 HGDP00445 Burusho Pakistan North South Asia Burushaski* M357 L3 16 12 16 13 22 10 14 12 12 10
749 HGDP00099 Hazara Pakistan North South Asia Indo-European M410 J2a 15 15 16 14 23 10 11 14 11 10
750 HGDP00100 Hazara Pakistan North South Asia Indo-European M120 Q1 13 12 17 14 22 10 15 13 11 11
751 HGDP00102 Hazara Pakistan North South Asia Indo-European M124 R2 14 12 17 13 23 11 13 14 12 9
752 HGDP00103 Hazara Pakistan North South Asia Indo-European M217 C3 16 14 16 13 25 10 11 13 10 10
753 HGDP00104 Hazara Pakistan North South Asia Indo-European M217 C3 16 14 17 13 25 10 11 13 10 10
754 HGDP00105 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 18 13 23 11 13 14 12 9
755 HGDP00106 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 17 13 23 11 13 14 12 9
756 HGDP00108 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 18 13 23 11 13 14 12 9
757 HGDP00109 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 18 13 23 11 13 14 12 9
758 HGDP00110 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 18 13 23 11 13 14 12 9
759 HGDP00111 Hazara Pakistan North South Asia Indo-European M217 C3 16 14 16 13 25 10 11 13 10 10
760 HGDP00112 Hazara Pakistan North South Asia Indo-European M217 C3 16 14 17 13 25 10 11 13 10 10
761 HGDP00113 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 17 13 23 11 13 14 12 9
762 HGDP00115 Hazara Pakistan North South Asia Indo-European M217 C3 17 14 16 13 25 10 11 13 10 10
763 HGDP00116 Hazara Pakistan North South Asia Indo-European M217 C3 16 14 16 13 25 10 11 13 10 10
764 HGDP00118 Hazara Pakistan North South Asia Indo-European M217 C3 17 14 16 13 25 10 11 13 10 10
765 HGDP00119 Hazara Pakistan North South Asia Indo-European M217 C3 16 14 16 13 25 10 11 13 10 10
766 HGDP00120 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 18 12 24 11 13 12 13 10
767 HGDP00121 Hazara Pakistan North South Asia Indo-European M122 O3 14 12 17 13 23 11 13 14 12 9
768 HGDP00122 Hazara Pakistan North South Asia Indo-European M073 R1b2b 14 12 17 13 23 11 13 14 12 9
769 HGDP00124 Hazara Pakistan North South Asia Indo-European M122 O3 16 12 18 12 24 10 13 12 12 10
770 HGDP00125 Hazara Pakistan North South Asia Indo-European M217 C3 17 12 17 12 23 10 11 14 12 10
771 HGDP00127 Hazara Pakistan North South Asia Indo-European M170\M223\M379 I1c2 14 13 16 13 22 10 12 13 11 11
772 HGDP00128 Hazara Pakistan North South Asia Indo-European M217 C3 17 14 17 13 25 10 11 13 10 10
773 HGDP00129 Hazara Pakistan North South Asia Indo-European M378 Q1a 13 12 16 13 22 10 15 13 11 12
774 HGDP00267 Kalash Pakistan North South Asia Indo-European M357 L3 14 12 16 14 22 10 12 12 12 10
775 HGDP00277 Kalash Pakistan North South Asia Indo-European M357 L3 14 12 16 14 22 10 15 12 12 10
776 HGDP00279 Kalash Pakistan North South Asia Indo-European M357 L3 14 12 16 15 22 10 14 12 11 10
777 HGDP00281 Kalash Pakistan North South Asia Indo-European M357 L3 14 12 16 14 22 10 15 12 11 10
778 HGDP00285 Kalash Pakistan North South Asia Indo-European P15 G2 17 12 16 12 23 10 11 14 11 8
779 HGDP00288 Kalash Pakistan North South Asia Indo-European P15 G2 16 12 16 12 23 10 11 14 11 8
780 HGDP00290 Kalash Pakistan North South Asia Indo-European P15 G2 16 12 16 12 23 10 11 14 11 8
781 HGDP00292 Kalash Pakistan North South Asia Indo-European P15 G2 16 12 16 12 23 10 11 14 11 8
782 HGDP00302 Kalash Pakistan North South Asia Indo-European M017 R1a1 17 12 16 13 24 11 11 13 10 9
783 HGDP00307 Kalash Pakistan North South Asia Indo-European M017 R1a1 17 12 16 13 24 11 11 13 10 9
784 HGDP00309 Kalash Pakistan North South Asia Indo-European M410 J2a 14 14 16 14 23 10 11 12 12 10
785 HGDP00311 Kalash Pakistan North South Asia Indo-European M357 L3 14 12 16 14 23 10 14 12 11 10
786 HGDP00313 Kalash Pakistan North South Asia Indo-European M017 R1a1 16 12 16 13 24 11 11 13 10 9
787 HGDP00315 Kalash Pakistan North South Asia Indo-European M017 R1a1 16 12 16 13 24 11 11 13 10 9
788 HGDP00319 Kalash Pakistan North South Asia Indo-European M052 H1* 15 12 16 13 23 10 11 12 11 10
789 HGDP00321 Kalash Pakistan North South Asia Indo-European M052 H1* 15 12 16 13 22 10 11 12 11 10
790 HGDP00326 Kalash Pakistan North South Asia Indo-European M052 H1* 15 12 16 13 22 10 11 12 11 10
791 HGDP00328 Kalash Pakistan North South Asia Indo-European M052 H1* 15 12 16 13 23 10 11 12 11 10
792 HGDP00330 Kalash Pakistan North South Asia Indo-European M207 R* 14 12 16 14 24 11 12 13 12 10
793 HGDP00333 Kalash Pakistan North South Asia Indo-European M241 J2b2 15 15 17 12 24 11 11 12 13 7
794 HGDP00213 Pathan Pakistan North South Asia Indo-European M377 G5 17 12 17 13 23 10 11 13 11 10
795 HGDP00214 Pathan Pakistan North South Asia Indo-European M269 R1b3 14 13 16 13 24 10 13 12 12 9
796 HGDP00216 Pathan Pakistan North South Asia Indo-European M017 R1a1 17 12 17 13 24 12 11 13 10 9
797 HGDP00218 Pathan Pakistan North South Asia Indo-European M207 R* 14 12 16 14 23 10 12 13 12 10
798 HGDP00220 Pathan Pakistan North South Asia Indo-European M217 C3 17 14 16 13 25 10 11 13 10 10
799 HGDP00222 Pathan Pakistan North South Asia Indo-European P15 G2 15 12 16 12 21 11 11 14 11 9
800 HGDP00224 Pathan Pakistan North South Asia Indo-European M052 H1* 14 12 16 14 22 10 11 12 10 11
800 HGDP00224 Pathan Pakistan North South Asia Indo-European M052 H1* 14 12 16 14 22 10 11 12 10 11
801 HGDP00226 Pathan Pakistan North South Asia Indo-European M346 Q4 13 12 16 14 22 10 14 14 13 10
802 HGDP00228 Pathan Pakistan North South Asia Indo-European M017 R1a1 16 12 17 13 24 11 11 13 10 9
803 HGDP00230 Pathan Pakistan North South Asia Indo-European M017 R1a1 17 12 17 13 24 11 11 13 10 9
804 HGDP00234 Pathan Pakistan North South Asia Indo-European M269 R1b3 14 12 17 13 24 11 13 14 12 10
805 HGDP00241 Pathan Pakistan North South Asia Indo-European M017 R1a1 15 12 17 13 24 11 11 13 10 9
806 HGDP00243 Pathan Pakistan North South Asia Indo-European M017 R1a1 17 12 18 13 24 10 11 13 10 9
807 HGDP00248 Pathan Pakistan North South Asia Indo-European M076 L1 14 12 16 12 23 10 14 11 12 9
808 HGDP00251 Pathan Pakistan North South Asia Indo-European M346 Q4 15 12 16 12 24 10 14 14 11 10
809 HGDP00254 Pathan Pakistan North South Asia Indo-European M069 H 14 12 17 14 22 11 11 14 12 9
810 HGDP00258 Pathan Pakistan North South Asia Indo-European M357 L3 15 12 16 13 22 10 14 12 12 10
811 HGDP00259 Pathan Pakistan North South Asia Indo-European M017 R1a1 17 12 18 13 24 10 11 13 10 9
812 HGDP00262 Pathan Pakistan North South Asia Indo-European M017 R1a1 17 12 17 13 24 12 11 13 10 9
813 HGDP00264 Pathan Pakistan North South Asia Indo-European M017 R1a1 17 12 17 13 25 11 11 13 10 9
814 HGDP00052 Balochi Pakistan South South Asia Indo-European M269 R1b3 14 12 15 13 25 11 14 12 13 8
815 HGDP00054 Balochi Pakistan South South Asia Indo-European M076 L1 14 12 16 12 22 10 14 11 13 10
816 HGDP00056 Balochi Pakistan South South Asia Indo-European M410 J2a 14 16 16 13 23 10 11 13 11 11
817 HGDP00057 Balochi Pakistan South South Asia Indo-European M267 J1 14 16 17 13 23 10 11 12 11 10
818 HGDP00058 Balochi Pakistan South South Asia Indo-European M357 L3 15 12 16 13 22 10 14 12 13 10
819 HGDP00060 Balochi Pakistan South South Asia Indo-European M269 R1b3 14 12 16 13 24 11 13 12 12 9
820 HGDP00062 Balochi Pakistan South South Asia Indo-European M052 H1* 15 12 16 15 23 10 11 12 12 10
821 HGDP00064 Balochi Pakistan South South Asia Indo-European M017 R1a1 16 12 17 12 25 11 11 14 11 9
822 HGDP00066 Balochi Pakistan South South Asia Indo-European M017 R1a1 16 12 17 12 25 11 11 14 11 9
823 HGDP00068 Balochi Pakistan South South Asia Indo-European M076 L1 14 12 16 12 22 10 14 11 13 10
824 HGDP00070 Balochi Pakistan South South Asia Indo-European M124 R2 14 12 16 13 23 10 10 14 11 9
825 HGDP00072 Balochi Pakistan South South Asia Indo-European M124 R2 14 12 16 13 24 10 10 13 12 9
826 HGDP00074 Balochi Pakistan South South Asia Indo-European M267 J1 14 15 17 13 22 10 11 12 11 9
827 HGDP00076 Balochi Pakistan South South Asia Indo-European M017 R1a1 15 12 17 13 25 10 11 13 10 9
828 HGDP00078 Balochi Pakistan South South Asia Indo-European M076 L1 14 12 16 12 22 10 14 11 13 9
829 HGDP00080 Balochi Pakistan South South Asia Indo-European M017 R1a1 16 12 16 12 25 11 11 14 11 9
830 HGDP00082 Balochi Pakistan South South Asia Indo-European M076 L1 14 12 15 12 22 10 13 11 11 9
831 HGDP00084 Balochi Pakistan South South Asia Indo-European M076 L1 14 12 15 12 22 10 13 11 11 9
832 HGDP00086 Balochi Pakistan South South Asia Indo-European M124 R2 14 13 16 12 24 10 10 14 10 10
833 HGDP00088 Balochi Pakistan South South Asia Indo-European M017 R1a1 16 12 17 12 25 11 11 14 11 9
834 HGDP00090 Balochi Pakistan South South Asia Indo-European M035\M078 E3b1 14 12 17 13 24 10 10 13 12 10
835 HGDP00092 Balochi Pakistan South South Asia Indo-European M017 R1a1 15 12 16 14 25 11 11 13 12 9
836 HGDP00094 Balochi Pakistan South South Asia Indo-European M410 J2a 14 14 16 14 23 10 11 12 12 10
837 HGDP00096 Balochi Pakistan South South Asia Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
838 HGDP00098 Balochi Pakistan South South Asia Indo-European M035\M078 E3b1 14 12 17 13 24 10 12 13 12 10
839 HGDP00001 Brahui Pakistan South South Asia akin to Dravidian M017 R1a1 15 12 18 14 24 10 11 12 11 10
840 HGDP00003 Brahui Pakistan South South Asia akin to Dravidian M357 L3 15 12 16 13 23 10 14 12 13 10
841 HGDP00005 Brahui Pakistan South South Asia akin to Dravidian M124 R2 14 13 16 13 23 9 10 14 10 10
842 HGDP00007 Brahui Pakistan South South Asia akin to Dravidian M067 J2a1b 14 14 16 13 22 10 11 12 12 11
843 HGDP00009 Brahui Pakistan South South Asia akin to Dravidian M410 J2a 14 15 16 13 22 10 11 13 11 10
844 HGDP00011 Brahui Pakistan South South Asia akin to Dravidian M017 R1a1 15 12 18 14 24 10 11 12 11 10
845 HGDP00013 Brahui Pakistan South South Asia akin to Dravidian M076 L1 14 12 15 12 22 10 14 11 11 9
846 HGDP00015 Brahui Pakistan South South Asia akin to Dravidian M267 J1 14 16 17 14 23 10 11 12 11 9
847 HGDP00017 Brahui Pakistan South South Asia akin to Dravidian P15 G2 15 12 18 12 22 10 11 13 11 10
848 HGDP00019 Brahui Pakistan South South Asia akin to Dravidian M122 O3 17 12 15 12 25 11 13 12 11 10
849 HGDP00021 Brahui Pakistan South South Asia akin to Dravidian M410 J2a 15 15 16 13 24 10 11 12 12 10
850 HGDP00023 Brahui Pakistan South South Asia akin to Dravidian M124 R2 14 13 16 13 23 10 10 14 10 10
851 HGDP00025 Brahui Pakistan South South Asia akin to Dravidian M067 J2a1b 14 14 16 13 22 10 11 12 12 11
852 HGDP00027 Brahui Pakistan South South Asia akin to Dravidian M017 R1a1 15 12 18 14 25 11 11 13 10 9
853 HGDP00029 Brahui Pakistan South South Asia akin to Dravidian M356 C5 15 13 15 13 25 10 11 14 11 11
854 HGDP00031 Brahui Pakistan South South Asia akin to Dravidian M017 R1a1 15 12 18 14 24 10 11 12 11 10
855 HGDP00033 Brahui Pakistan South South Asia akin to Dravidian M017 R1a1 15 12 19 14 24 10 11 12 11 10
856 HGDP00035 Brahui Pakistan South South Asia akin to Dravidian M017 R1a1 15 12 18 14 24 10 11 12 11 10
857 HGDP00037 Brahui Pakistan South South Asia akin to Dravidian P15 G2 15 12 17 12 23 10 11 13 11 10
858 HGDP00039 Brahui Pakistan South South Asia akin to Dravidian P15 G2 14 12 19 12 22 10 11 13 11 10
859 HGDP00041 Brahui Pakistan South South Asia akin to Dravidian M052 H1* 17 12 16 14 22 10 11 12 12 10
860 HGDP00043 Brahui Pakistan South South Asia akin to Dravidian M267 J1 14 16 17 14 23 10 11 12 11 9
861 HGDP00045 Brahui Pakistan South South Asia akin to Dravidian M267 J1 14 16 17 14 23 10 11 12 11 9
862 HGDP00047 Brahui Pakistan South South Asia akin to Dravidian M124 R2 15 13 16 13 24 10 10 14 10 10
863 HGDP00049 Brahui Pakistan South South Asia akin to Dravidian M285 G1 14 12 17 12 23 11 12 12 11 10
864 HGDP00130 Makrani Pakistan South South Asia Indo-European M017 R1a1 15 12 17 12 26 11 11 14 11 9
865 HGDP00131 Makrani Pakistan South South Asia Indo-European M317 L2 15 12 17 13 24 10 14 11 12 10
866 HGDP00133 Makrani Pakistan South South Asia Indo-European M410 J2a 14 14 16 14 23 10 11 12 12 11
867 HGDP00134 Makrani Pakistan South South Asia Indo-European M317 L2 15 12 16 14 24 10 15 11 12 10
868 HGDP00135 Makrani Pakistan South South Asia Indo-European M017 R1a1 15 12 18 14 24 10 11 12 11 10
869 HGDP00136 Makrani Pakistan South South Asia Indo-European M017 R1a1 17 12 18 13 25 10 11 13 10 9
870 HGDP00137 Makrani Pakistan South South Asia Indo-European M410 J2a 14 15 16 14 23 10 11 13 11 10
871 HGDP00139 Makrani Pakistan South South Asia Indo-European M076 L1 14 12 16 12 22 10 14 11 13 9
872 HGDP00140 Makrani Pakistan South South Asia Indo-European M410 J2a 15 14 16 13 24 10 11 12 12 10
873 HGDP00141 Makrani Pakistan South South Asia Indo-European M124 R2 14 12 16 14 23 10 10 14 10 10
874 HGDP00143 Makrani Pakistan South South Asia Indo-European M269 R1b3 14 12 15 15 24 11 14 12 12 10
875 HGDP00144 Makrani Pakistan South South Asia Indo-European M346 Q4 13 12 17 14 21 11 14 14 11 10
876 HGDP00145 Makrani Pakistan South South Asia Indo-European M002 E3a 15 12 18 13 21 11 11 13 12 11
877 HGDP00146 Makrani Pakistan South South Asia Indo-European M124 R2 14 12 16 14 23 10 10 14 11 10
878 HGDP00148 Makrani Pakistan South South Asia Indo-European M017 R1a1 17 12 17 13 23 11 11 13 10 10
879 HGDP00149 Makrani Pakistan South South Asia Indo-European M076 L1 14 12 16 13 22 10 14 11 13 10
880 HGDP00150 Makrani Pakistan South South Asia Indo-European M173 R1* 15 12 18 14 25 10 11 13 10 9
881 HGDP00158 Makrani Pakistan South South Asia Indo-European M017 R1a1 17 12 17 12 25 11 11 14 11 9
882 HGDP00160 Makrani Pakistan South South Asia Indo-European M410 J2a 15 15 15 13 24 10 11 14 10 11
883 HGDP00161 Makrani Pakistan South South Asia Indo-European M410 J2a 15 15 15 13 24 10 11 14 10 10
884 HGDP00163 Sindhi Pakistan South South Asia Indo-European M017 R1a1 15 12 18 13 25 11 11 13 10 9
885 HGDP00165 Sindhi Pakistan South South Asia Indo-European M378 Q1a 13 12 16 14 22 10 15 13 12 9
886 HGDP00167 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 18 13 25 10 11 13 10 9
887 HGDP00169 Sindhi Pakistan South South Asia Indo-European M410 J2a 14 14 16 14 23 10 11 13 12 11
888 HGDP00171 Sindhi Pakistan South South Asia Indo-European M017 R1a1 15 13 17 12 25 11 11 13 11 9
889 HGDP00173 Sindhi Pakistan South South Asia Indo-European M410 J2a 15 15 17 14 23 11 11 13 13 10
890 HGDP00175 Sindhi Pakistan South South Asia Indo-European M241 J2b2 17 15 17 12 24 10 11 12 11 7
891 HGDP00177 Sindhi Pakistan South South Asia Indo-European M357 L3 15 12 15 13 22 10 14 13 13 11
892 HGDP00179 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 18 13 25 11 11 13 10 9
893 HGDP00181 Sindhi Pakistan South South Asia Indo-European M410 J2a 14 15 16 14 23 10 11 13 11 10
894 HGDP00183 Sindhi Pakistan South South Asia Indo-European M241 J2b2 17 15 16 12 23 9 12 12 12 8
895 HGDP00185 Sindhi Pakistan South South Asia Indo-European M017 R1a1 14 12 16 13 24 11 11 13 10 9
896 HGDP00187 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 17 12 25 11 11 14 11 9
897 HGDP00189 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 17 13 26 11 11 13 10 9
898 HGDP00191 Sindhi Pakistan South South Asia Indo-European M124 R2 14 12 16 13 23 11 10 13 11 10
899 HGDP00197 Sindhi Pakistan South South Asia Indo-European M267 J1 14 13 16 13 23 10 11 12 11 10
900 HGDP00199 Sindhi Pakistan South South Asia Indo-European M017 R1a1 15 12 18 14 25 10 11 13 10 9
901 HGDP00201 Sindhi Pakistan South South Asia Indo-European M410 J2a 13 15 15 13 24 10 11 12 12 9
902 HGDP00203 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 18 13 25 10 11 13 10 9
903 HGDP00205 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 18 14 25 10 12 13 10 10
904 HGDP00208 Sindhi Pakistan South South Asia Indo-European M017 R1a1 17 12 17 13 25 10 11 13 12 9
905 HGDP00711 Cambodian Cambodia East Asia Austro-Asiatic M095 O2a 15 12 16 13 25 10 13 14 11 10
906 HGDP00714 Cambodian Cambodia East Asia Austro-Asiatic M095 O2a 16 12 17 13 25 11 13 13 14 9
907 HGDP00715 Cambodian Cambodia East Asia Austro-Asiatic M231 N 14 13 15 14 23 11 14 13 12 9
908 HGDP00716 Cambodian Cambodia East Asia Austro-Asiatic M134 O3e 14 10 15 12 25 10 14 12 12 11
909 HGDP00717 Cambodian Cambodia East Asia Austro-Asiatic M095 O2a 15 12 15 13 25 10 13 15 12 10
910 HGDP00720 Cambodian Cambodia East Asia Austro-Asiatic M039 H1 15 12 16 14 22 10 11 12 11 10
911 HGDP01307 Dai China East Asia Sino-Tibetan M268 O2* 15 12 17 13 23 11 13 14 13 9
912 HGDP01308 Dai China East Asia Sino-Tibetan M217 C3 15 14 17 13 24 11 11 13 12 11
913 HGDP01309 Dai China East Asia Sino-Tibetan M122 O3 16 14 17 14 26 11 13 12 11 10
914 HGDP01310 Dai China East Asia Sino-Tibetan M216/RPS4Y C* 14 13 16 12 21 10 11 12 11 11
915 HGDP01311 Dai China East Asia Sino-Tibetan M095 O2a 15 12 16 13 24 11 13 14 12 9
916 HGDP01312 Dai China East Asia Sino-Tibetan M095 O2a 15 12 15 13 25 11 13 14 12 9
917 HGDP01313 Dai China East Asia Sino-Tibetan M095 O2a 15 12 17 13 25 11 13 14 10 9
918 HGDP01213 Daur China East Asia Altaic M217 C3 15 14 16 14 24 10 11 14 10 10
919 HGDP01214 Daur China East Asia Altaic M015 D1 16 12 17 12 24 10 10 12 12 11
920 HGDP01216 Daur China East Asia Altaic M175 O* 15 12 17 12 24 9 14 13 10 11
921 HGDP01217 Daur China East Asia Altaic M095 O2a 15 12 15 12 23 10 13 14 11 9
922 HGDP01218 Daur China East Asia Altaic M217 C3 16 14 16 13 25 10 11 13 10 10
923 HGDP01220 Daur China East Asia Altaic M134 O3e 14 10 16 12 23 10 14 12 12 10
924 HGDP01221 Daur China East Asia Altaic TAT N3 14 12 16 14 23 10 14 12 11 10
925 HGDP00774 Han China East Asia Sino-Tibetan M119 O1 15 12 16 12 23 10 14 13 12 10
926 HGDP00775 Han China East Asia Sino-Tibetan M268 O2* 15 12 17 13 23 9 15 14 11 10
927 HGDP00777 Han China East Asia Sino-Tibetan M073 R1b2b 13 12 15 14 24 9 14 14 11 9
928 HGDP00778 Han China East Asia Sino-Tibetan M134 O3e 14 10 16 12 25 11 14 12 13 10
929 HGDP00779 Han China East Asia Sino-Tibetan M134 O3e 14 10 16 12 24 10 14 12 11 10
930 HGDP00780 Han China East Asia Sino-Tibetan M119 O1 15 12 15 12 23 10 14 13 12 10
931 HGDP00782 Han China East Asia Sino-Tibetan M095 O2a 16 12 16 13 22 10 13 14 12 9
932 HGDP00785 Han China East Asia Sino-Tibetan M119 O1 15 12 18 12 23 11 14 13 11 10
933 HGDP00786 Han China East Asia Sino-Tibetan M268 O2* 15 12 15 14 24 10 13 14 12 8
934 HGDP00815 Han China East Asia Sino-Tibetan M134 O3e 14 10 16 12 23 10 14 12 11 10
935 HGDP00819 Han China East Asia Sino-Tibetan M122 O3 15 12 15 13 24 10 14 12 13 10
936 HGDP00821 Han China East Asia Sino-Tibetan M134 O3e 15 10 14 13 24 10 13 12 11 10
937 HGDP00822 Han China East Asia Sino-Tibetan M134 O3e 15 10 17 12 24 10 14 12 11 10
938 HGDP00971 Han China East Asia Sino-Tibetan M122 O3 16 12 16 13 21 10 13 12 11 9
939 HGDP00973 Han China East Asia Sino-Tibetan M122 O3 15 12 15 12 24 10 13 14 12 11
940 HGDP00977 Han China East Asia Sino-Tibetan M119 O1 16 12 18 12 23 10 14 13 14 10
941 HGDP01288 Han China East Asia Sino-Tibetan M407 C3a2 16 12 15 14 23 10 11 15 14 10
942 HGDP01289 Han China East Asia Sino-Tibetan M095 O2a 15 12 17 12 24 10 13 14 12 9
943 HGDP01290 Han China East Asia Sino-Tibetan M134 O3e 16 10 15 12 24 10 13 12 12 12
944 HGDP01292 Han China East Asia Sino-Tibetan M231 N 14 13 17 13 23 11 14 13 12 9
945 HGDP01293 Han China East Asia Sino-Tibetan M231 N 14 12 16 13 23 10 15 13 11 10
946 HGDP01294 Han China East Asia Sino-Tibetan M122 O3 16 12 16 13 25 10 13 12 12 10
947 HGDP01295 Han China East Asia Sino-Tibetan M231 N 14 13 16 14 23 11 14 13 11 9
948 HGDP01296 Han China East Asia Sino-Tibetan M217 C3 16 13 16 14 24 10 11 13 12 10
949 HGDP01233 Hezhen China East Asia Altaic M217 C3 16 12 16 14 24 10 11 14 12 10
950 HGDP01235 Hezhen China East Asia Altaic M217 C3 16 12 16 14 24 10 11 14 12 10
951 HGDP01236 Hezhen China East Asia Altaic M134 O3e 16 12 15 12 23 10 12 12 13 10
952 HGDP01237 Hezhen China East Asia Altaic M217 C3 15 13 16 13 24 10 12 13 13 10
953 HGDP01240 Hezhen China East Asia Altaic M176 O2b 16 12 15 14 23 10 13 13 12 10
954 HGDP01241 Hezhen China East Asia Altaic M134 O3e 14 10 16 12 24 9 14 12 13 11
955 HGDP01317 Lahu China East Asia Sino-Tibetan M427\M428 F2 13 11 16 13 23 10 11 14 12 12
956 HGDP01318 Lahu China East Asia Sino-Tibetan M427\M428 F2 13 11 16 13 23 10 11 14 12 12
957 HGDP01319 Lahu China East Asia Sino-Tibetan M122 O3 15 12 17 13 25 10 13 12 12 10
958 HGDP01320 Lahu China East Asia Sino-Tibetan M427\M428 F2 13 11 16 13 23 10 11 14 12 12
959 HGDP01321 Lahu China East Asia Sino-Tibetan M427\M428 F2 13 11 16 13 23 10 11 14 12 12
960 HGDP01322 Lahu China East Asia Sino-Tibetan M427\M428 F2 13 11 16 13 23 10 11 14 12 11
961 HGDP01326 Lahu China East Asia Sino-Tibetan M134 O3e 15 12 16 12 23 10 11 12 12 11
962 HGDP01189 Miaozu China East Asia Sino-Tibetan M095 O2a 16 12 16 13 23 10 13 14 11 9
963 HGDP01190 Miaozu China East Asia Sino-Tibetan M095 O2a 16 12 16 14 23 10 13 14 11 9
964 HGDP01191 Miaozu China East Asia Sino-Tibetan M095 O2a 16 12 16 12 24 11 13 14 12 9
965 HGDP01192 Miaozu China East Asia Sino-Tibetan M231 N 15 13 16 13 25 11 14 13 10 9
966 HGDP01193 Miaozu China East Asia Sino-Tibetan M095 O2a 16 12 16 13 24 11 13 14 11 9
967 HGDP01194 Miaozu China East Asia Sino-Tibetan M122 O3 17 12 16 12 24 10 13 12 12 10
968 HGDP01195 Miaozu China East Asia Sino-Tibetan M122 O3 17 12 16 12 24 10 13 12 12 10
969 HGDP01224 Mongola China East Asia Altaic TAT N3 14 12 17 15 23 10 15 14 10 9
970 HGDP01225 Mongola China East Asia Altaic M134 O3e 14 10 16 12 25 10 15 12 12 9
971 HGDP01226 Mongola China East Asia Altaic M174 D* 15 12 16 14 25 10 7 13 12 10
972 HGDP01227 Mongola China East Asia Altaic M073 R1b2b 13 12 17 13 23 10 14 13 13 11
973 HGDP01228 Mongola China East Asia Altaic M134 O3e 15 12 17 12 23 10 13 12 11 11
974 HGDP01229 Mongola China East Asia Altaic M134 O3e 15 10 15 12 24 10 14 12 11 11
975 HGDP01230 Mongola China East Asia Altaic M217 C3 15 14 16 13 26 10 11 13 10 10
976 HGDP01337 Naxi China East Asia Sino-Tibetan M073 R1b2b 13 12 16 14 23 9 14 14 11 10
977 HGDP01338 Naxi China East Asia Sino-Tibetan M134 O3e 14 10 16 12 23 10 14 13 12 10
978 HGDP01339 Naxi China East Asia Sino-Tibetan M231 N 14 13 16 14 23 11 14 13 11 10
979 HGDP01340 Naxi China East Asia Sino-Tibetan M073 R1b2b 13 12 17 14 24 9 14 14 10 10
980 HGDP01341 Naxi China East Asia Sino-Tibetan M073 R1b2b 13 12 17 14 24 9 14 14 10 10
981 HGDP01342 Naxi China East Asia Sino-Tibetan M268 O2* 15 13 16 14 23 9 13 13 14 10
982 HGDP01343 Naxi China East Asia Sino-Tibetan M073 R1b2b 13 12 17 14 24 9 14 14 10 10
983 HGDP01344 Naxi China East Asia Sino-Tibetan M231 N 14 13 16 14 23 11 14 13 12 10
984 HGDP01203 Oroqen China East Asia Altaic TAT N3 14 12 16 14 23 10 14 12 11 10
985 HGDP01204 Oroqen China East Asia Altaic M217 C3 17 13 16 13 24 9 11 13 11 10
986 HGDP01205 Oroqen China East Asia Altaic M217 C3 15 14 16 14 24 10 11 14 10 10
987 HGDP01206 Oroqen China East Asia Altaic M217 C3 16 13 16 13 24 9 11 13 11 10
988 HGDP01207 Oroqen China East Asia Altaic M217 C3 17 13 16 14 23 10 11 14 11 10
989 HGDP01208 Oroqen China East Asia Altaic M217 C3 16 13 16 13 24 9 11 13 11 10
990 HGDP01210 Oroqen China East Asia Altaic TAT N3 14 12 16 14 23 10 14 12 11 10
991 HGDP01327 She China East Asia Sino-Tibetan M119 O1 15 12 16 12 23 10 14 13 11 10
992 HGDP01328 She China East Asia Sino-Tibetan M134 O3e 16 12 16 12 24 10 12 12 12 11
993 HGDP01329 She China East Asia Sino-Tibetan M122 O3 17 12 16 12 24 10 13 12 11 10
994 HGDP01330 She China East Asia Sino-Tibetan M119 O1 15 12 16 12 23 10 14 13 11 10
995 HGDP01331 She China East Asia Sino-Tibetan M122 O3 17 12 16 12 25 10 13 12 11 10
996 HGDP01332 She China East Asia Sino-Tibetan M122 O3 17 12 16 12 24 10 13 12 11 10
997 HGDP01333 She China East Asia Sino-Tibetan M122 O3 16 12 16 12 24 10 13 12 12 10
998 HGDP01347 Tu China East Asia Altaic M134 O3e 15 12 15 12 23 10 12 12 12 11
999 HGDP01348 Tu China East Asia Altaic M231 N 14 12 18 14 23 10 14 13 10 10
1000 HGDP01349 Tu China East Asia Altaic M095 O2a 15 12 16 13 22 10 13 13 11 9
1001 HGDP01350 Tu China East Asia Altaic M073 R1b2b 16 12 18 12 25 11 11 13 10 9
1002 HGDP01351 Tu China East Asia Altaic M134 O3e 15 12 17 12 23 10 12 12 12 12
1003 HGDP01352 Tu China East Asia Altaic M231 N 14 12 17 14 23 10 14 13 10 10
1004 HGDP01353 Tu China East Asia Altaic M134 O3e 16 12 18 12 23 10 12 12 12 11
1005 HGDP01095 Tujia China East Asia Sino-Tibetan M095 O2a 16 12 16 13 24 10 13 14 13 9
1006 HGDP01096 Tujia China East Asia Sino-Tibetan M134 O3e 14 10 16 12 24 10 14 12 12 10
1007 HGDP01097 Tujia China East Asia Sino-Tibetan M134 O3e 14 10 16 12 23 10 14 12 12 10
1008 HGDP01099 Tujia China East Asia Sino-Tibetan M122 O3 15 12 19 13 23 10 13 12 11 10
1009 HGDP01100 Tujia China East Asia Sino-Tibetan M119 O1 15 12 17 12 22 10 14 13 13 11
1010 HGDP01101 Tujia China East Asia Sino-Tibetan M231 N 14 13 16 13 23 10 14 13 12 9
1011 HGDP01102 Tujia China East Asia Sino-Tibetan M122 O3 16 12 18 12 25 11 13 12 11 10
1012 HGDP01103 Tujia China East Asia Sino-Tibetan M134 O3e 15 12 16 12 23 10 12 13 12 11
1013 HGDP01104 Tujia China East Asia Sino-Tibetan M217 C3 15 13 17 13 23 10 11 15 11 10
1014 HGDP01297 Uygur China East Asia Altaic M073 R1b2b 15 12 17 13 25 10 11 13 10 9
1015 HGDP01298 Uygur China East Asia Altaic M317 L2 15 12 16 13 22 10 14 12 13 10
1016 HGDP01299 Uygur China East Asia Altaic M073 R1b2b 15 12 16 14 24 9 13 13 11 10
1017 HGDP01300 Uygur China East Asia Altaic M073 R1b2b 15 12 19 14 25 11 11 13 10 10
1018 HGDP01301 Uygur China East Asia Altaic M269 R1b3 13 12 17 13 24 10 13 12 12 9
1019 HGDP01302 Uygur China East Asia Altaic M217 C3 16 12 17 14 24 9 11 13 11 10
1020 HGDP01303 Uygur China East Asia Altaic M134 O3e 14 12 17 12 23 11 11 12 13 11
1021 HGDP01304 Uygur China East Asia Altaic M410 J2a 14 14 16 13 24 10 11 12 11 11
1022 HGDP01243 Xibo China East Asia Altaic M410 J2a 14 15 16 15 23 10 11 12 12 10
1023 HGDP01244 Xibo China East Asia Altaic M217 C3 15 13 17 13 24 10 13 13 12 10
1024 HGDP01245 Xibo China East Asia Altaic M070 K2 13 12 17 13 23 10 13 12 11 9
1025 HGDP01246 Xibo China East Asia Altaic M134 O3e 15 12 18 11 23 11 12 12 12 10
1026 HGDP01247 Xibo China East Asia Altaic M217 C3 16 13 17 14 25 9 11 13 11 10
1027 HGDP01248 Xibo China East Asia Altaic M122 O3 14 12 16 13 24 11 13 12 12 10
1028 HGDP01249 Xibo China East Asia Altaic TAT N3 14 12 16 14 23 10 14 14 10 10
1029 HGDP01250 Xibo China East Asia Altaic M217 C3 17 13 16 13 24 9 11 13 11 10
1030 HGDP01179 Yizu China East Asia Sino-Tibetan M095 O2a 15 12 16 13 25 11 13 14 11 9
1031 HGDP01180 Yizu China East Asia Sino-Tibetan M095 O2a 15 12 16 13 25 11 13 13 13 9
1032 HGDP01181 Yizu China East Asia Sino-Tibetan M095 O2a 15 12 15 13 24 11 13 14 12 9
1033 HGDP01182 Yizu China East Asia Sino-Tibetan M231 N 14 13 16 14 23 11 14 13 11 10
1034 HGDP01183 Yizu China East Asia Sino-Tibetan M015 D1 14 10 16 14 24 10 11 12 10 10
1035 HGDP01184 Yizu China East Asia Sino-Tibetan M095 O2a 15 12 15 13 25 11 13 14 11 10
1036 HGDP01185 Yizu China East Asia Sino-Tibetan M015 D1 14 12 16 13 24 10 11 13 12 10
1037 HGDP01186 Yizu China East Asia Sino-Tibetan M134 O3e 14 10 16 12 24 11 13 12 13 11
1038 HGDP01187 Yizu China East Asia Sino-Tibetan M122 O3 15 12 17 12 25 10 13 12 12 10
1039 HGDP00747 Japanese Japan East Asia Altaic M015 D1 15 12 17 13 25 10 11 13 13 11
1040 HGDP00748 Japanese Japan East Asia Altaic M176 O2b 15 12 15 14 22 10 13 13 13 10
1041 HGDP00749 Japanese Japan East Asia Altaic M134 O3e 14 10 16 11 23 10 14 12 12 11
1042 HGDP00750 Japanese Japan East Asia Altaic M176 O2b 15 12 15 14 22 10 13 13 12 10
1043 HGDP00751 Japanese Japan East Asia Altaic M122 O3 16 12 15 13 22 10 14 12 13 9
1044 HGDP00752 Japanese Japan East Asia Altaic M015 D1 16 12 17 14 25 10 11 13 12 11
1045 HGDP00753 Japanese Japan East Asia Altaic M134 O3e 15 12 18 12 23 10 12 12 12 10
1046 HGDP00755 Japanese Japan East Asia Altaic M176 O2b 14 12 16 14 22 10 13 13 13 10
1047 HGDP00757 Japanese Japan East Asia Altaic M015 D1 15 12 17 14 23 10 11 13 13 10
1048 HGDP00758 Japanese Japan East Asia Altaic M008 C1 13 12 16 13 24 10 11 14 12 10
1049 HGDP00759 Japanese Japan East Asia Altaic M122 O3 17 13 17 12 24 10 13 12 12 9
1050 HGDP00762 Japanese Japan East Asia Altaic M176 O2b 15 12 15 14 22 10 13 13 12 10
1051 HGDP00763 Japanese Japan East Asia Altaic M176 O2b 15 12 16 13 22 10 13 13 12 10
1052 HGDP00764 Japanese Japan East Asia Altaic M122 O3 17 13 16 12 25 11 13 12 11 10
1053 HGDP00766 Japanese Japan East Asia Altaic M176 O2b 15 12 15 14 23 10 13 13 12 10
1054 HGDP00767 Japanese Japan East Asia Altaic M093 C3a1 15 15 16 13 23 10 11 16 10 10
1055 HGDP00768 Japanese Japan East Asia Altaic M217 C3 15 13 16 13 23 9 11 13 12 10
1056 HGDP00769 Japanese Japan East Asia Altaic M015 D1 17 12 17 14 24 10 11 13 11 11
1057 HGDP00770 Japanese Japan East Asia Altaic M073 R1b2b 13 12 16 13 23 10 14 13 13 10
1058 HGDP00790 Japanese Japan East Asia Altaic M015 D1 17 12 17 13 25 10 11 13 12 11
1059 HGDP00791 Japanese Japan East Asia Altaic M176 O2b 15 12 15 13 23 10 13 13 12 10
1060 HGDP00828 Japanese Japan East Asia Altaic M015 D1 17 12 16 14 25 11 11 13 12 10
1061 HGDP01025 Japanese Japan East Asia Altaic M268 O2* 15 12 15 14 22 10 13 13 12 10
1062 HGDP00945 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 16 14 10 10
1063 HGDP00946 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 15 14 10 10
1064 HGDP00947 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 15 14 10 10
1065 HGDP00948 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1066 HGDP00949 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 15 14 10 10
1067 HGDP00950 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 15 14 10 9
1068 HGDP00951 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 16 14 10 10
1069 HGDP00952 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1070 HGDP00953 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1071 HGDP00954 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 15 14 10 10
1072 HGDP00958 Yakut Siberia East Asia Altaic M407 C3a2 15 12 15 13 23 10 15 14 12 10
1073 HGDP00960 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1074 HGDP00961 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1075 HGDP00962 Yakut Siberia East Asia Altaic M407 C3a2 17 12 16 14 23 10 11 13 13 11
1076 HGDP00964 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1077 HGDP00965 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1078 HGDP00968 Yakut Siberia East Asia Altaic TAT N3 14 12 18 14 23 11 16 14 10 10
1079 HGDP00969 Yakut Siberia East Asia Altaic TAT N3 14 12 17 14 23 11 16 14 10 10
1080 CA01 Central Asian Central Asia Altaic M017 R1a1 16 12 18 13 25 10 11 13 10 9
1081 CA02 Central Asian Central Asia Altaic M017 R1a1 16 12 18 13 25 11 11 13 11 9
1082 CA03 Central Asian Central Asia Altaic M017 R1a1 16 12 19 13 25 12 11 14 10 9
1083 CA04 Central Asian Central Asia Altaic M017 R1a1 16 12 19 13 25 12 11 14 10 9
1084 CA05 Central Asian Central Asia Altaic M017 R1a1 15 12 16 13 25 10 11 13 10 9
1085 CA06 Central Asian Central Asia Altaic M017 R1a1 16 12 16 13 25 12 11 13 10 9
1086 CA07 Central Asian Central Asia Altaic M017 R1a1 16 12 19 13 25 11 12 13 10 9
1087 CA08 Central Asian Central Asia Altaic M017 R1a1 15 12 19 13 25 10 11 14 10 9
1088 CA09 Central Asian Central Asia Altaic M017 R1a1 16 12 17 13 25 10 11 13 11 9
1089 CA10 Central Asian Central Asia Altaic M017 R1a1 16 12 17 13 24 11 11 13 11 9
Open in a new tab

Analysis of Haplotype Data

Microsatellite variances were estimated for each population with a sample size of at least five individuals over 10 loci for most binary HGs, to assess the relative amount of accumulated diversity as a function of geography. Spatial surfaces of both binary HG frequency and HG-associated microsatellite variance distributions for the India and Pakistan samples were computed using the Kriging procedure (Delfiner 1976) with Surfer Systems Golden software. The J2a-M410 frequency distribution across Eurasia was plotted using the Mapping Toolbox in The MathWorks MATLAB software package. This tool uses biharmonic spline interpolation to generate the surface data, as described by Sandwell (1987). In addition, frequency surface distributions for HGs J2a*-M410 were also generated, with use of 82 sets of data (sample size ⩾20) spanning portions of Africa, Europe, the Near East, and West Asia (see table 4). The age of a binary HG was estimated from microsatellite variation within the HG with use of the method described by Zhivotovsky et al. (2004), with slight modifications (details provided in appendix A [online only]). Of note, there was no modal microsatellite haplotype within many HGs. Whereas the modal haplotype can reasonably be assumed to be the founding haplotype, the absence of such a haplotype prevented us from arbitrarily assuming any other existing haplotype as the founding one; instead, we used a logical and consistent procedure across all HGs. We used the median values of repeat scores at each microsatellite locus within each HG and assumed that the haplotype formed by the median values of the repeat scores is the founding haplotype. Although the median and the founding haplotypes coincide in the beginning of growth of microsatellite variation (L.A.Z., unpublished observations), working under that assumption would result in an underestimate of microsatellite variation if the median haplotype deviates far from an actual founder. However, since we used the median haplotype, irrespective of the presence of a modal haplotype, across all HGs, we believe that estimates of the relative ages of the HGs will be correct, even if their actual ages are underestimates. The Y-chromosome microsatellite diversity and variance in repeat number were calculated using the software package Microsat, version 1.5d. Equality of proportions of HGs among subsets of populations (e.g., social or linguistic categories) was tested using contingency χ2 tests, with Yates’s correction when required. Analysis of molecular variance (AMOVA) of microsatellite data was performed using the Arlequin package, version 2.000. Within specific HGs, median-joining networks of microsatellite haplotypes were constructed using the Network package, version 4.1.0.9 (Fluxus Engineering).

Table 4.

Frequencies of HG J2a*-M410 in Different Populations, with Latitudes and Longitudes

Population Sample Size Frequency(%) Latitude (N) Longitude (E) Reference
Azerbaijan 46 23.90 40.38 49.85 Di Giacomo et al. 2004
Bulgaria 39 12.90 43.22 27.92 Di Giacomo et al. 2004
Czech Republic 94 1.10 50.08 14.43 Di Giacomo et al. 2004
Egypt 47 10.60 30.05 31.25 Di Giacomo et al. 2004
Crete 137 32.10 35.33 25.13 Di Giacomo et al. 2004
Greece 249 14.40 37.97 23.72 Di Giacomo et al. 2004
Northern Italy 126 7.20 45.12 10.03 Di Giacomo et al. 2004
Southern Italy 407 17.90 40.63 15.82 Di Giacomo et al. 2004
Sardinia 51 5.90 40.32 9.33 Di Giacomo et al. 2004
Morocco 37 .00 33.65 −7.58 Di Giacomo et al. 2004
Romania 130 10.10 44.43 26.10 Di Giacomo et al. 2004
Russia 223 1.30 55.75 37.58 Di Giacomo et al. 2004
Slovakia 23 .00 48.15 17.12 Di Giacomo et al. 2004
Syria 50 14.00 33.50 36.30 Di Giacomo et al. 2004
United Arab Emirates 34 5.90 24.47 54.37 Di Giacomo et al. 2004
United Kingdom 20 .00 51.50 −.17 Di Giacomo et al. 2004
Sudan 40 .00 15.60 32.55 Semino et al. 2004
Tunisia 73 1.40 36.80 10.18 Semino et al. 2004
Algeria 20 .00 36.78 3.05 Semino et al. 2004
Ethiopia, Amhara 48 2.10 9.03 38.70 Semino et al. 2004
Ethiopia, Oromo 78 .00 9.03 38.70 Semino et al. 2004
Iraq 156 19.90 33.35 44.42 Semino et al. 2004
Lebanon 40 25.00 33.88 35.50 Semino et al. 2004
Istanbul 73 17.80 41.02 28.97 Semino et al. 2004
Turkey, Konya 129 27.10 37.87 32.52 Semino et al. 2004
Georgia 45 26.60 41.72 44.82 Semino et al. 2004
Macedonia 56 7.20 40.63 22.93 Semino et al. 2004
Greece 92 11.90 37.97 23.72 Semino et al. 2004
Albania 56 5.40 41.33 19.83 Semino et al. 2004
Croatia 48 .00 45.80 15.97 Semino et al. 2004
Hungary 49 2.00 47.50 19.08 Semino et al. 2004
Ukraine 82 4.80 50.43 30.52 Semino et al. 2004
Poland 97 .00 52.25 21.00 Semino et al. 2004
Volterra 52 17.30 43.40 10.85 Semino et al. 2004
Italy, Calabria 57 21.00 39.28 16.25 Semino et al. 2004
Italy, Apulia 86 25.60 40.38 18.18 Semino et al. 2004
Sicily 42 16.70 37.57 14.27 Semino et al. 2004
Sardinia 144 7.70 40.32 9.33 Semino et al. 2004
Dutch 34 .00 52.28 4.95 Semino et al. 2004
Bearnais 26 3.80 43.30 −.37 Semino et al. 2004
French Basque 44 13.60 43.48 −1.57 Semino et al. 2004
Spanish Basque 48 .00 43.25 −2.97 Semino et al. 2004
Catalan 28 3.60 41.38 2.18 Semino et al. 2004
Andalusian 93 6.50 37.22 −3.68 Semino et al. 2004
India, Hindu 76 3.90 28.66 77.22 Semino et al. 2004
Nepal, Tharu 50 8.00 27.72 85.32 Semino et al. 2004
Nea Nikomedeia 58 3.40 40.50 22.20 R.K., unpublished data
Sesklo 56 8.80 39.35 22.93 R.K., unpublished data
Peloponnese 57 14.00 37.40 23.00 R.K., unpublished data
Marmara 52 30.80 40.92 28.09 Cinnioğlu et al. 2004
Western Pontic 29 28.60 41.48 33.65 Cinnioğlu et al. 2004
Eastern Pontic 83 17.90 40.84 38.60 Cinnioğlu et al. 2004
Eastern Anatolia 82 23.20 39.19 40.65 Cinnioğlu et al. 2004
Southeastern Anatolia 43 23.30 37.45 39.09 Cinnioğlu et al. 2004
Mediterranean Anatolia 33 21.20 36.72 34.50 Cinnioğlu et al. 2004
Central Anatolia 90 28.90 39.31 34.70 Cinnioğlu et al. 2004
Aegean Anatolia 30 13.30 38.27 28.61 Cinnioğlu et al. 2004
Istanbul 81 17.30 40.97 29.08 Cinnioğlu et al. 2004
Ferrara 78 10.30 44.83 11.58 P.A.U., unpublished data
Oman 121 6.00 23.62 58.58 Luis et al. 2004
Egypt 147 11.00 30.05 31.25 Luis et al. 2004
Central Asia 176 9.90 39.80 64.42 Underhill et al. 2000
Northern Pakistan 85 2.40 34.79 71.41 Present study
Southern Pakistan 91 16.60 28.36 66.53 Present study
Uygur 68 5.90 40.00 90.00 Karafet et al. 2001
Uzbeks 54 7.40 39.80 64.42 Karafet et al. 2001
Kazakhs 30 3.30 48.00 70.00 Karafet et al. 2001
Iran 150 19.30 29.62 52.55 P.A.U., unpublished data
Belarus 39 .00 53.90 27.57 Di Giacomo et al. 2004
Cantabria 118 3.40 43.47 −3.80 Maca-Meyer et al. 2003
Northern India 80 6.30 27.10 80.90 Present study
Northeastern India 87 .00 23.60 91.80 Present study
Eastern India 129 1.60 22.80 86.30 Present study
Southern India 303 5.00 13.00 79.10 Present study
Central India 73 .00 21.70 81.40 Present study
Western India 59 10.20 18.90 72.80 Present study
Central African Republic 33 .00 5.00 20.00 P.A.U., unpublished data
Tanzania 43 .00 −5.00 35.00 Luis et al. 2004
Kenya 29 .00 .00 40.00 Luis et al. 2004
Cameroon 99 .00 2.00 10.00 Luis et al. 2004
Benin 100 .00 10.00 2.00 Luis et al. 2004
Rwanda 163 .00 −2.00 30.00 Luis et al. 2004
Open in a new tab

Results

The Phylogeny of South Asian Y-Chromosome Binary HGs

The phylogenetic relationships of Y-chromosome binary HGs determined for 1,079 samples are presented in figure 1. A total of 69 of 71 polymorphisms genotyped were informative and defined 52 HGs in the data set. The pooled frequency distributions of HGs for the 36 Indian, 8 Pakistani and 18 East Asian populations are given in table 5. (Additional detailed HG frequencies are given in tables 6 and 7.) Eight HGs display frequencies >5% within India and account for 95.8% of the samples. They are, in descending frequency order, HGs H and its subclades H1*, H1c, H1a, and H2 (26.4%); R1a1-M17 (15.8%); O2a-M95 (14.6%); R2-M124 (9.3%); J2-M172 (9.1%); O3e-M134 (8.0%); L1-M76 (6.3%); and F*-M89 (5.2%). In Pakistan, nine HGs exceed 5% frequency and account for 83.6% of the samples. They include HGs R1a1-M17 (24.4%), L*-M20 (13.1%), J2-M172 (11.9%), R2-M124 (7.4%), R1b-P25 (7.4%), G-M201 (6.3%), C3-M217 (6.8%), H-M69* (6.3%), and L1-M76 (5.1%). In the East Asian samples studied, the following seven HGs exceed 5% frequency and account for 75.4% of the total: O3e-M134 (15.4%), C3-M217 (13.1%), N3-TAT (12.0%), O2a-M95 (10.9%), O3-M122(xO3e) (11%), N-M231(xN3) (6.3%), and R1b2-M73 (6.3%). The HG frequency distributions among the three geographical regions and those between any pair of regions are all significantly different (all P values <.0001).

Table 5.

Y-Chromosome HG Frequencies in India, Pakistan, and East Asia

No. (%) of Y-Chromosome HGs
HG India(n=728) Pakistan(n=176) East Asia(n=175)
C*-M216/RPS4Y 2 (.27) 1 (.57)
C1-M008 1 (.57)
C3-M217 12 (6.82) 19 (10.86)
C3a1-M093 1 (.57)
C3a2-M407 3 (1.71)
C5-M356 11 (1.51) 1 (.57)
D*-M174 1 (.57)
D1-M015 9 (5.14)
E3a-M002 1 (.57)
E3b1-M035\M078 2 (1.14)
F*-M089/M213 38 (5.22)
F2-M427\M428 5 (2.86)
G1-M285 1 (.57)
G2-P15 9 (1.24) 8 (4.55)
G5-M377 2 (1.14)
H-M069* 29 (3.98) 1 (.57)
H1-M039 1 (.57)
H1-M052 146 (20.05)
H1-M197 1 (.14) 1 (.57)
H1*-M052 9 (5.11)
H2-APT 16 (2.2)
I1c2-M170\M223\M379 1 (.57)
J1-M267 2 (.27) 6 (3.41)
J2a-M410 26 (3.57 15 (8.52) 2 (1.14)
J2a1b-M067 2 (1.14)
J2a1e-M158 2 (.27)
J2b2-M241 38 (5.22) 4 (2.27)
K*-M009 1 (.57)
K2-M070 1 (.57)
L1-M076 46 (6.32) 9 (5.11)
L2-M317 2 (1.14) 1 (.57)
L3-M357 3 (.41) 12 (6.82)
N-M231 11 (6.29)
N3-TAT 21 (12)
O*-M175 1 (.57)
O1-M119 7 (4)
O2*-M268 5 (2.86)
O2a-M095 106 (14.56) 19 (10.85)
O2b-M176 8 (4.57)
O3-M122 3 (.41) 3 (1.7) 19 (10.86)
O3e-M134 58 (7.97) 1 (.57) 27 (15.43)
Q1-M120 1 (.57)
Q1a-M378 2 (1.14)
Q4-M346 3 (.41) 3 (1.7)
R*-M207 2 (.27) 6 (3.41)
R1*-M173 1 (.57)
R1a1-M017 115 (15.8) 43 (24.43)
R1b2b-M073 8 (4.55) 11 (6.29)
R1b3-M269 4 (.55) 5 (2.84) 1 (.57)
R2-M124 68 (9.34) 13 (7.39)
Open in a new tab

Table 6.

HG Frequencies in Social and Linguistic Subgroups of Indian Populations[Note]

No. (%) of HGs
Tribe
 Dravidian Caste
 Indo-European Caste
HG Austro-Asiatic(M=3; n=64) Dravidian(M=8; n=180) Tibeto-Burman(M=5; n=87) Indo-European(M=1; n=21) Upper(M=2; n=59) Middle(M=3; n=85) Lower(M=1; n=29) Upper(M=4; n=86) Middle(M=4; n=48) Lower(M=4; n=50)
C*-M216/RPS4Y 1 (.56) 1 (3.45)
C5-M356 1 (1.56) 1 (.56) 1 (1.15) 2 (3.39) 1 (1.18) 1 (1.16) 2 (4.17) 2 (4.00)
F*-M089/M213 25 (13.89) 3 (14.29) 6 (7.06) 2 (6.90) 1 (1.16) 1 (2.08)
G2-P15 7 (11.86) 1 (1.18) 1 (2.00)
H-M069* 5 (7.81) 2 (1.11) 1 (1.69) 12 (14.12) 1 (1.16) 1 (2.08) 7 (14.00)
H1-M052 9 (14.06) 66 (36.67) 2 (2.30) 5 (23.81) 4 (6.78) 17 (20.00) 4 (13.79) 9 (10.47) 16 (33.33) 14 (28.00)
H1-M197 1 (1.16)
H2-APT 1 (1.56) 9 (5.00) 2 (9.52) 1 (3.45) 1 (1.16) 1 (2.08) 1 (2.00)
J1-M267 1 (.56) 1 (1.16)
J2a-M410 3 (1.67) 8 (13.56) 2 (2.35) 1 (3.45) 8 (9.30) 2 (4.17) 1 (2.00)
J2a1e-M158 1 (1.69) 1 (2.00)
J2b2-M241 7 (10.94) 2 (3.39) 16 (18.82) 3 (10.34) 4 (4.65) 4 (8.33) 1 (2.00)
L1-M076 10 (5.56) 10 (16.95) 16 (18.82) 4 (13.79) 2 (2.33) 3 (6.25) 1 (2.00)
L3-M357 1 (3.45) 2 (2.33)
O2a-M095 34 (53.13) 48 (26.67) 16 (18.39) 6 (28.57) 1 (2.08) 1 (2.00)
O3-M122 2 (2.30) 1 (2.00)
O3e-M134 57 (65.52) 1 (1.16)
Q4-M346 1 (4.76) 1 (1.18) 1 (1.16)
R*-M207 1 (1.69) 1(2.00)
R1a1-M017 5 (2.78) 4 (4.60) 4 (19.05) 17 (28.81) 10 (11.76) 7 (24.14) 39 (45.35) 5 (10.42) 13 (26.00)
R1b3-M269 1 (3.45) 3 (6.25)
R2-M124 7 (10.94) 9 (5.00) 5 (5.75) 6 (10.17) 3 (3.53) 4 (13.79) 14 (16.28) 9 (18.75) 5 (10.00)
Open in a new tab

Note.— M = no. of population groups, n = no. of chromosomes.

Table 7.

HG Frequencies in Countries Other Than India (Companion to Table 6)[Note]

No. (%) of HGs
Pakistan
HG (P=4; n=85) South(P=4; n=91) Cambodia(P=1; n=6) China(P=15; n=128) Japan(P=1; n=23) Siberia(P=1; n=18)
C*-M216/RPS4Y 1 (.78) 1 (4.35)
C1-M008
C3-M217 12 (14.12) 18 (14.06) 1 (4.35)
C3a1-M093 1 (4.35)
C3a2-M407 1 (.78) 2 (11.11)
C5-M356 1 (1.10)
D*-M174 1 (.78)
D1-M015 3 (2.34) 6 (26.09)
E3a-M002 1 (1.10)
E3b1 – M035\M078 2 (2.20)
F*-M089/M213
F2-M427\M428 5 (3.91)
G1-M285 1 (1.10)
G2-P15 5 (5.88) 3 (3.30)
G5-M377 2 (2.35)
H-M069* 1 (1.18)
H1c-M039 1 (16.67)
H1*-M052
H1a-M197 1 (1.18)
H1*-M052 7 (8.24) 2 (2.20)
H2-APT
I1c2-M170\M223\M379 1 (1.18)
J1-M267 6 (6.59)
J2a-M410 2 (2.35) 13 (14.29) 2 (1.56)
J2a1b-M067 2 (2.20)
J2a1e-M158
J2b2-M241 2 (2.35) 2 (2.20)
K*-M009 1 (1.18)
K2-M070 1 (.78)
L1-M076 1 (1.18) 8 (8.79)
L2-M317 2 (2.20) 1 (.78)
L3-M357 9 (10.59) 3 (3.30)
N-M231 1 (16.67) 10 (7.81)
N3-TAT 5 (3.91 16 (88.89)
O*-M175 1 (.78)
O1-M119 7 (5.47)
O2*-M268 4 (3.13) 1 (4.35)
O2a-M095 3 (50.00) 16 (12.50)
O2b-M176 1 (.78) 7 (30.43)
O3-M122 2 (2.35) 1 (1.10) 16 (12.50) 3 (13.04)
O3e-M134 1 (1.18) 1 (16.67) 24 (18.75) 2 (8.70)
Q1-M120 1 (1.18)
Q1a-M378 1 (1.18) 1 (1.10)
Q4-M346 2 (2.35) 1 (1.10)
R*-M207 6 (7.06)
R1*-M173 1 (1.10)
R1a1-M017 14 (16.47) 29 (31.87)
R1b2b-M073 8 (9.41) 10 (7.81) 1 (4.35)
R1b3-M269 2 (2.35) 3 (3.30) 1 (.78)
R2-M124 4 (4.71) 9 (9.89)
Open in a new tab

Note.— P = no. of population groups; n = no. of chromosomes.

The J2-M172 Clade Is Composed of Two Sister Clades

New phylogenetic resolution has been achieved within the J2-M172 clade with the discovery of the M410 nucleotide A→G substitution (table 2). Now, all J2-M172–derived lineages can be assigned to one of two sister clades—namely, J2a*-M410 or J2b*-M12—which necessitates an updated revision of the previous “haplogroup by lineage” YCC nomenclature for J2 (Jobling and Tyler-Smith 2003). The J2*-M172 phylogenetic revisions are presented in figure 2. We include the DYS413⩽18 allele-repeat node in the phylogeny, as suggested by Di Giacomo et al. (2004). It is notable that no J2*-M172 HG lacking both M410- and M12-derived alleles has yet been observed. The DYS413 locus was typed in M410-derived samples from India, Pakistan, and Turkey. The vast majority displayed the ⩽18 allele repeat, although 16/118 in Turkey had alleles ⩾19, as did 5/17 in Pakistan and 5/28 in India, 4 of which were restricted to the Dravidian-speaking Iyengar and Iyer upper castes. The J2 clade is nearly absent among Indian tribals, except among Austro-Asiatic–speaking tribals (11%). Among the Austro-Asiatic tribals, the predominant J2b2 HG occurs only in the Lodha. J2 is present in significantly higher (P<.001) frequency among Dravidian castes (19%) than among Indo-European castes (11%). In Pakistan, the frequency (12%) is similar to that among Indian Indo-European castes, but this clade is nearly absent (1%) in East Asia.

Figure 2.

Figure 2

Open in a new tab

Revised phylogenetic relationships and nomenclature for Y-chromosome HG J2

Discovery of Five New Clades That Improve HG Topology

We report five new clades that improve the HG topology within the Y-chromosome genealogy. The new subclade C5-M356 accounts for 85% of the former C* HGs. Although its overall frequency is only 1.4% in the Indian sample, it occurs in all linguistic groups and in both tribes and castes. It also occurs in one Dravidian Brahui in Pakistan (table 5). The new L3-M357 subclade accounts for 86% of L-M20(xL1xL2) chromosomes in Pakistan but occurs only sporadically (3/728) in India. All Indian HG Q representatives belong to the new M346-subclade. This new Q clade will aid in future studies attempting to narrow the candidate Asian/Siberian precursors of Native American chromosomes. The G5-M377 substitution is independent of G1-M285 and G2-P15 subclades (Cinnioğlu et al. 2004) and occurs in Pakistan. The M379 polymorphism defines the I1c2 subclade, which occurs only among the Pakistani in our study sample.

Phylogeography of J2a-M410 across Eurasia

Our new understanding of the phylogenetic structure concerning HG J2a-M410 has allowed us to combine both our new Indian and Pakistani data (n=905) and relevant data from the literature (6,678 samples from 82 populations; n per population ⩾20) to construct a geographic map of its distribution based on 76 geographic regions (fig. 3). The J2a-M410 data used in the frequency surface plots are presented in table 4. The sister clade to J2a-M410 is J2b-M12. In India and Pakistan, all J2b members comprise the J2b2-M241 derivative HG. Notable is the high frequency (in 39 of 42 Indian and Pakistani samples only) of a 7-repeat motif at the A7.2 microsatellite locus, in contrast to the 8-repeat motif in Europe.

Figure 3.

Figure 3

Open in a new tab

Spatial frequency distribution of Eurasian HG J2a-M410–related lineages. Plus signs (+) indicate geographic locations of population samples listed in table 4.

Inference of HG Expansions and Polarity of Spread

Geographic origins of HG expansions can be inferred from both frequency and associated diversity (Barbujani 2000), with spatial levels of accumulated microsatellite variability providing a metric for assessing directionality of movement and to help disentangle complexities associated with population stratification. It is important to recognize that regions of highest HG frequency are not necessarily representative of origin. An obvious example is HG C, which displays its highest frequency in Polynesia (Kayser et al. 2000), but Polynesia is one of the last regions known to be colonized by modern humans. Associated microsatellite diversification can detect clines not obvious in binary HG-frequency data. In Turkey, for example, the most frequent HG, J2-M172, showed no clinal pattern with geography, but its associated average Y-chromosome microsatellite variation was significantly inversely correlated with latitude (Cinnioğlu et al. 2004), consistent with a model of demic expansion (Edmonds et al. 2004). However, highly associated microsatellite variance may not always be a reflection of just in situ processes. In some cases, it could also be a consequence of repeated gene flow from diverse sources (Tambets et al. 2003), as evidenced in Central Asia, where high Y-chromosome diversity is attributed to multiple recent events (Zerjal et al. 2002). Thus, regions of high frequency and high variance need not always overlap. HGs H1, R1a1, and R2 (fig. 4) are examples of nonoverlap between regions of highest frequency and highest variance. The region of high variance can also reflect the area from which a subset of chromosomal diversity migrated and then underwent subsequent demographic growth. Despite the potential consequences of population stratification and language shift, additional important insights into geographic origins of Y chromosome HGs can be deduced (see the “Pre–Indo-European Expansions Shape the South Asian Y-Chromosome Landscape” section) from the proportions of HGs distributed among the different social and linguistic groups found in India (table 6). (HG frequencies in Pakistan and other countries are given in table 7.)

Figure 4.

Figure 4

Figure 4

Open in a new tab

Spatial frequency and mean microsatellite variance distributions of Y-chromosome HGs in present-day India and Pakistan

We computed FST values between linguistic subgroups of Indian populations and populations of Pakistan and East Asia. The trend of FST values with populations of Pakistan is that the Indo-European–speaking population groups of India show small values (0.079) compared with the Dravidian (0.121), Tibeto-Burman (0.229), or Austro-Asiatic (0.139) groups. In general, the FST values with populations of the southern Pakistan are lower than those of northern Pakistan. These FST values are consistent with known historical events. However, the FST values of Indian populations with those of East Asia do not follow an expected pattern; for example, the FST value between East Asian and Indian Tibeto-Burman populations (0.253) is higher than that between Indian Indo-European populations (0.163). This might be because of pooling East Asian populations with varied demographic histories. The pattern does not substantially change with the exclusion of the Japanese, who may have a considerably different population history from that of other East Asian populations. When the Japanese are excluded, the FST value between East Asians and Tibeto-Burmans reduces to 0.238, whereas that between East Asians and Indo-Europeans remains essentially unchanged (0.161).

We also performed AMOVA using the microsatellite haplotype data. The results are presented in table 8. The AMOVA results show that the percentage of between-population variation is much higher in India (18%) and East Asia (17%) than in Pakistan (6%). In India, the variation within a linguistic category is far greater for tribal populations (16%) than for castes (6%). In Pakistan, genetic differences between northern and southern regions is low (0.01%).

Table 8.

AMOVA Results Based on Y-Microsatellite Haplotype Frequencies

Total Variation (%)
Region and Group WithinPopulations Between Populations(within Groups) BetweenGroups
India:
 All (36 populations considered one group) 82.38 17.62 …
 Caste:
  Two linguistic groups (Indo-European and Dravidian) 91.59 6.38 2.03
 Tribal:
  Four linguistic groups 71.40 15.90 12.70
Pakistan:
 All (8 populations considered one group) 93.86 6.14 …
 Two geographical groupsa 93.75 6.24 .01
East Asia:
 All (18 populations considered one group) 82.62 17.38 …
Open in a new tab
a

South: Sindhi, Balochi, Brahui, and Makrani; north: Burusho, Hazara, Kalash, and Pathan.

Figure 4 shows spatial maps of HG frequencies and microsatellite variance distributions across India and Pakistan for several HGs that are based on pooled variances of repeat numbers at the microsatellite loci within HGs. The variances at individual loci within HGs are presented in table 9. It is noteworthy that contributions of individual microsatellite loci to the pooled variances are quite variable within and across HGs. These variations in the contribution of individual loci are certainly a reflection of founding events and also possibly of the variation in mutation rates across microsatellite loci. HGs L1-M76 and H1-M52 have peak variance distributions in the Maharashtra region in coastal western India. Other lineages (F*-M89; H2-APT) have higher variance patterns in Tamil Nadu and Andhra Pradesh near coastal eastern India. Alternatively, the H-M69* and O2a-M95 HGs display higher variances in northeastern India and the West Bengal region, respectively. These two HGs also display significant correlations with latitude and longitude, respectively (table 10). Lastly, HG J2b2-M241–related microsatellite variance is higher in Uttar Pradesh near the border of Nepal. It should be noted that numerous Mesolithic sites have been observed in this region (Kennedy 2000).

Table 9.

SDs of Repeat Numbers at 10 Microsatellite Loci within HGs with Sample Sizes >20, in Various Regions of India and Pakistan

SD by Marker
Region and HG (n) DYS19 DYS388 DYS389AB DYS389CD DYS390 DYS391 DYS392 DYS393 DYS439 DYSA7.2
Northern India:
 R1a1 (32) .762 .369 .803 .508 .581 .543 .390 .309 .246 .354
Eastern India:
 All H (36) .692 1.158 .893 .898 .841 .525 .167 .766 .756 .586
 O2a (36) .398 .000 .681 .319 .401 .467 .232 .560 .618 .554
Southern India:
 F* (30) .844 .664 .740 .740 1.095 .484 .640 .820 .973 .858
 F* and all H (116) .720 .705 .858 .657 1.010 .486 .399 .773 .844 .700
 All H (86) .649 .260 .891 .629 .937 .490 .275 .569 .709 .563
 H1 (62) .459 .000 .459 .704 .658 .409 .319 .505 .696 .522
 J2b2 (21) .218 .498 .590 .359 .928 .632 .000 .512 .680 .436
 L1 (38) .434 .453 .569 .000 .162 .226 .311 .453 .788 .437
 O2a (33) .394 .174 .500 .561 .242 .489 .000 .517 .781 .545
 R1a1 (39) .683 .223 .785 .595 .686 .486 .160 .354 .451 .320
 R2 (22) .492 .294 .610 .581 .526 .213 .000 .716 .703 .685
Central India:
 F* and all H (43) .575 .413 .374 .764 .814 .413 .457 .708 .796 .674
 All H (37) .229 .363 .277 .702 .468 .229 .000 .277 .689 .676
 H1 (34) .442 .247 .625 .666 .466 .254 .146 .247 .605 .682
 O2a (21) .000 .000 .598 .402 .316 .463 .000 .784 .301 .402
Southern Pakistan:
 R1a1 (29) .978 .186 .736 .817 .636 .509 .186 .680 .622 .455
Open in a new tab

Table 10.

Spearman’s Rank Correlation Coefficients between Y-Chromosome HG Frequency and Latitude and Longitude

Spearman’s RankCorrelation Coefficient
HG Latitude Longitude
Entire H −.76a .33
H-M69* −.37 .37
H1-M52 −.74a .17
H2-APT −.91b .03
F and H −.76a .33
F-M89 −.79a .00
O2a-M95 −.44 .77a
L1-M76 −.40 −.63
R1a1-M17 .40 −.64
R2-M124 .02 .00
Open in a new tab
a

P<.05 (two-tailed test).

b

P<.01 (two-tailed test).

Indigenous and Exogenous HGs Represented in India

On the basis of the combined phylogeographic distributions of haplotypes observed among populations defined by social and linguistic criteria, candidate HGs that most plausibly arose in situ within the boundaries of present-day India include C5-M356, F*-M89, H-M69* (and its sub-clades H1-M52 and H2-APT), R2-M124, and L1-M76. The congruent geographic distribution of H-M69* and potentially paraphyletic F*-M89 Y chromosomes in India suggests that they might share a common demographic history.

A median-joining network analysis (not shown) of F*-M89 microsatellite haplotypes in Indians and East Asian Lahu suggested divergence between these two populations. This is confirmed by the discovery of the linked HG F2-M427 and M428 markers (table 2) that are restricted to the Lahu in our data set. HG R2-M124 occurs with a frequency of 9.3% in India, consistent with 8%–10% reported elsewhere (Kivisild et al. 2003a; Cordaux et al. 2004). The decreasing frequency of R2—from 7.4% in Pakistan to 3.8% in Central Asia (Wells et al. 2001) to 1% in Turkey (Cinnioğlu et al. 2004)—is consistent with the pattern observed for the autochthonous Indian H1-M52 HG.

It is noteworthy that no C3-M217–derived lineages typical of East and Central Asia have been observed in the Indian samples reported thus far (Redd et al. 2002; Kivisild et al. 2003a; the present study). Conversely, HGs of likely exogenous origin include J2a-M410 and J2b-M12 in the Indus Valley, whereas HGs O2a-M95 and O3e-M134 have their most likely origin in Southeast Asia, judging from the fact that the HG O lineages observed in India represent a minor subset of East Asian variation (Su et al. 1999). Interestingly, within India, R1a1-M17, R2-M124, and L1-M76 display considerable frequency and HG-associated microsatellite variance (table 9). The widespread geographic distribution of HG R1a1-M17 across Eurasia and the current absence of informative subdivisions defined by binary markers leave uncertain the geographic origin of HG R1a1-M17. However, the contour map of R1a1-M17 variance shows the highest variance in the northwestern region of India (fig. 4).

The Age of Microsatellite Variation in the Majority of Indian HGs Exceeds 10,000–15,000 Years

Variances in repeat numbers of Y-chromosome microsatellites, pooled over the 10 loci, within HGs with sample size of n⩾5 are given in table 9. Table 11 presents the estimates of the age of microsatellite variation by HG, computed in India overall as well as by language and social hierarchy.

Table 11.

Age of Microsatellite Variations within Various Y HGs in India

Agea±SD (n) of Microsatellite Variation
Dravidian
 Indo-European
HG Pooled Austro-Asiatic Tribe Tibeto-Burman Tribe Tribe Caste Tribe Caste Muslim
C5-M356 19.4±4.2 (11) 24.6±8.0 (5)
F*-M89 28.9±4.4 (38) 26.7±5.7 (25) 28.1±5.3 (8)
G2-P15 10.5±3.9 (9) 8.6±3.7 (8)
H1-M52 10.6±1.8 (145) 9.7±4.4 (9) 9.8±2.0 (64) 12.6±3.8 (25) 10.9±3.6 (5) 10.0±2.1 (40)
H2-Apt 17.8±4.3 (16) 11.3±6.4 (9)
H-M69* 30.4±7.7 (29) 8.0±4.0 (5) 20.9±9.5 (13) 30.6±12.5 (9)
J2*-M410/M158 13.7±2.9 (28) 15.8±5.3 (12) 12.4±2.0 (12)
J2b2-M241 13.8±3.8 (38) 3.6±1.7 (7) 12.1±3.4 (21) 12.0±3.1 (9)
L1-M76 9.1±1.9 (46) 6.0±2.4 (10) 7.1±2.1 (30) 13.6±4.3 (6)
O2a-M95b 11.7±1.6 (106) 8.8±2.0 (34) 12.9±3.1 (16) 8.2±1.9 (48) 8.5±3.8 (6)
O3e-M134c 9.2±2.7 (58) 9.3±2.7 (57)
R1a1-M17d 14.0±3.1 (114) 10.9±3.8 (5) 12.2±3.0 (34) 14.6±3.5 (57) 10.5±3.0 (11)
R2-M124 11.6±2.1 (68) 9.8±2.4 (7) 10.1±4.3 (5) 18.1±4.6 (9) 8.9±2.3 (13) 12.7±3.5 (28) 8.5±4.8 (6)
Open in a new tab
a

In KYA.

b

In Cambodia, 11.9±3.5 (n=7); in China, 17.9±5.5 (n=14).

c

In the Tibeto-Burman tribe, excluding Mizo, 6.7±2.1 (n=44); in Mizo, 15.1±7.0 (n=13); in Southeast Asia, 26.2±7.0 (n=27).

d

In Pakistan, 15.6±3.0 (n=50); in Oman, 12.5±2.9 (n=11); in western Eurasia, 12.8±2.5 (n=16); in Greece, 9.3±2.8 (n=19); in Turkey, 10.0±2.6 (n=36); in Central Asia, 11.2±5.0 (n=10).

Discussion

The HG composition for southwestern Asia is complex and represents HGs that likely originated in situ as well as those that arrived from external sources. Although it is generally accepted that Indo-European languages were introduced to present-day India relatively recently (∼3.6 thousand years ago [KYA]) from the northwest (Beekes 1995), interpretations differ regarding their influence on the pre-existing gene pool (Kivisild et al. 2003a; Cordaux et al. 2004). We investigated this issue, using a combination of more-extensive population sampling and higher molecular resolution, and determined both the polarity and temporality of different Y-chromosome HGs, using not only HG frequencies but also the extent of microsatellite variability within HGs.

Pre–Indo-European Expansions Shape the South Asian Y-Chromosome Landscape

On the basis of a broad distribution—involving all social and linguistic categories in India—and relatively high diversification patterns, it can be concluded that representatives of HGs C5-M356 H-M69*, F*, L1, and R2 have ancestry indigenous to the Asian subcontinent. The relatively high frequency of O2a-M95 lineages centered in Orissa and neighboring regions (fig. 4) across all linguistic categories of tribes (table 6)—coupled with its virtual absence in all caste groups—supports a model of independent origins (Cordaux et al. 2004). However, the considerable age of Y-microsatellite variation of R1a1, R2, and L1 (table 11) and the spatial frequency plots of these lineages (fig. 4) do not support the claim that the presence of these lineages among tribes could be due to occasional recent admixture only (Cordaux et al. 2004). Interestingly, a median-joining network analysis (fig. 5) of O2a-M95 microsatellite haplotypes in Indians suggests a partition between (1) Tibeto-Burman speakers and (2) Austro-Asiatic and Dravidian speakers who display more Y-microsatellite diversification than the Tibeto-Burmans.

Figure 5.

Figure 5

Open in a new tab

Median-joining network of Y-microsatellite haplotypes with HG O2a-M95 HG among Austro-Asiatic and Dravidian (gray nodes) and Tibto-Burman (black nodes) populations.

Admixture analysis cannot distinguish between recent and ancient gene flow or directionality of flow. In addition, inferences based on basal HG frequencies alone and limited geographic sampling can be misleading and potentially incorrect. This shortcoming is especially magnified when coupled with inadequately resolved HG structure and small sample sizes. In HGs R1a1 and R2, the associated mean microsatellite variance is highest in tribes (table 12), not castes. This is a clear contradiction of what would be expected from an explanation involving a model of recent occasional admixture. Beyond taking advantage of highly resolved phylogenetic hierarchy as just an efficient genotyping convenience, a comprehensive approach that leverages the phylogeography of Y-chromosome diversification by using a combination of HG diversification with geography and expansion-time estimates provides a more insightful and accurate perspective to the complex human history of South Asia. The data regarding HG L are particularly instructive in this regard. Tables 5 and 6 indicate that HGs L1-M76, R1a1-M17, and R2-M124 occur in all Dravidian-speaking castes but are rare in tribes (with the exception of R2 in the Austro-Asiatic Lodha tribe and R1a1 in the Indo-European–speaking Halba). Such limited exceptions may be a result of drift. The temptation is to view R1a1 and R2 as terminal HGs with recent shared ancestry, without consideration of levels of subsequent diversification at either the sub-HG or microsatellite haplotype level. Knowledge of HG L diversification reveals a potentially significant flaw in this regard. HG L is defined by the M20 mutation with numerous companion markers (e.g., M11, M27, and M61) that reinforce the definition of this clade. When considered at the general HG level, L, R1a, and R2 all display approximate similarity with respect to population-category apportionment and frequency (Cordaux et al. 2004). With the exception of that of Kivisild et al. (2003a), who showed that all Indians were M27-M76 derived, other previous studies of HG L in India have not considered binary diversification beyond the HG L-M20 node. What is distinctive about HG L relative to the other two HGs and other relevant previous studies (Wells et al. 2001; Zerjal et al. 2002), however, is new knowledge concerning the subsequent binary diversification observed in the present study. Specifically, all HG L chromosomes studied apportion to one of three informative sub-HGs—namely, L1-M76, L2-M317, and L3-M357, each with distinctive geographic affiliation and polarity of spread based on microsatellite diversity that help considerably to localize their origins, especially L1 and L3. Noteworthy is the fact that, in India, virtually all members of HG L are L1 derivatives. When analyzed at more-informative levels of HG diversification, previous conclusions obtained at the coarser level become suspect. This critical knowledge imbues HG L with considerably more insight than simple frequency analysis for R1a1 and R2. Although it would be convenient to assume that R1a1 and R2 representatives reflect a recent common demography (Cordaux et al. 2004), it is entirely plausible that they harbor as-yet-undiscovered subsequent haplogroup diversification that approximates the phylogeographic patterns revealed for HG L. The frequency of R1a varies widely in Central Asia and is highest (63%) in the eastern Kyrgyz (Altaic) and Tajiks (Indo-European), both of whom display quite recent times to the most recent common ancestor (Zerjal et al. 2002). The question remains of how distinctive is the history of L1 relative to some or all of R1a1 and R2 representatives. This uncertainty neutralizes previous conclusions that the intrusion of HGs R1a1 and R2 from the northwest in Dravidian-speaking southern tribes is attributable to a single recent event. Rather, these HGs contain considerable demographic complexity, as implied by their high haplotype diversity. Specifically, they could have actually arrived in southern India from a southwestern Asian source region multiple times, with some episodes considerably earlier than others. Considerable archeological evidence exists regarding the presence of Mesolithic peoples in India (Kennedy 2000), some of whom could have entered the subcontinent from the northwest during the late Pleistocene epoch. The high variance of R1a1 in India (table 12), the spatial frequency distribution of R1a1 microsatellite variance clines (fig. 4), and expansion time (table 11) support this view.

Table 12.

Y-Microsatellite Variances Pooled over 10 Loci within HGs R1a1 and R2

Variance (No.) ofY Microsatelliteby HG
Sample R1a1-M17 R2-M124
India:
 Tribal .39 (12) .34 (21)
 Muslim .22 (11) .19 (6)
 Upper caste .26 (56) .24 (20)
 Middle caste .22 (15) .25 (12)
 Lower caste .36 (20) .35 (9)
 All castes .28 (91) .27 (41)
Pakistan .36 (43) .33 (13)
Turkey .25 (36) .34 (5)
Open in a new tab

J2-M172 Clade and Holocene Expansionsto Southwestern Asia

One interpretation of the presence of J2a-M410 chromosomes in North Africa and Eurasia is that it reflects the demographic spread of Neolithic farmers. This is consistent with previous interpretations of M172-associated HGs (Semino et al. 2000; King and Underhill 2002). Figure 3 demonstrates the eastward expansion of J2a-M410 to Iraq, Iran, and Central Asia coincident with painted pottery and ceramic figurines, well documented in the Neolithic archeological record (Cauvin 2000). Near the Indus Valley, the Neolithic site of Mehrgarh, estimated to have been founded ∼7 KYA (Kenoyer 1998), displays the presence of these types of material culture correlated with the spread J2a-M410 in Pakistan. Although the association of agriculture with J2a-M410 is recognized, the spread of agriculture may not be the only explanation for the spread of this HG. Despite an apparent exogenous frequency spread pattern of HG J2a toward North and Central India from the west (fig. 3), it is premature to attribute the spread to a simplistic demic expansion of early agriculturalists and pastoralists from the Middle East. It reflects the overall net process of spread that may contain numerous as-yet-unrevealed movements embedded within the general pattern. It may also reflect a combination of elements of earlier prehistoric Holocene epi-Paleolithic peoples from the Middle East, subsequent Bronze Age Harappans of uncertain provenance, and succeeding Iron Age Indo-Aryans from Central Asia (Kennedy 2000). Although the overall age of J2a Y-microsatellite variation (table 11) exceeds the appearance of agriculture in the Indus Valley (∼6 KYA), the current lack of informative subdivision within HG J2a in southwestern Asia prevents analysis of such potential layers, which are currently more evident in Anatolia, southeastern Europe, and the Mediterranean. In these regions, HGs J2a1b-M67(xM92) and J2a1b1-M92 have spatial and temporal characteristics consistent with the spread of early farmers and Bronze Age cultures (Di Giacomo et al. 2004). Besides the notable absence of J2a1b-M67(xM92) and J2a1b1-M92 in southwestern Asia, HGs J1-M267 and G-M201 that, respectively, occur at 9% and 10.9% in Turkey (Cinnioğlu et al. 2004), 33.1% and 2.2% in Iraq (Al-Zahery et al. 2003), and 3.4% and 6% in Pakistan are also virtually absent in India (table 5), indicating differential influences from the Middle East in southeastern Europe and southwestern Asia. Similarly, the presence of HG E lineages, thought to possibly be associated with the spread of agriculturalists in southeastern Europe (Hammer et al. 1998; Semino et al. 2004), are absent in India except in specific populations known to have recent African heritage (Thangaraj et al. 1999). Until the paraphyletic J2a-M410* with DYS413 short-alleles chromosomes are better resolved molecularly in southeastern European, western Asian, and southwestern Asian regions, the magnitude of the contribution of agriculturalists within this HG remains uncertain. The mean variance for J2b2-M241 chromosomes is highest in southwestern Asia (0.33), in contrast with Turkey (0.24) (Cinnioğlu et al. 2004) and the Balkans (<0.2) (Pericic et al. 2005). Further, the mean expansion time of J2b2 in India is 13.8 KYA (table 11), clearly earlier than the appearance of agriculture. Perhaps the three J2b2 chromosomes with eight or more repeats for A7.2 are reflective of more-recent agriculturalists.

A view of the genetics of the spread of language and farming in India that emphasizes mtDNA data (Kivisild et al. 2003b) underscores an inherent indigenous and geographically constrained presence of HGs and the challenge of sieving out ancient from relatively more-recent gene flow. Population origins and demic expansions other than those attributable to the recent arrival of immigrants from the northwest have undoubtedly also influenced the genetic population structure of the region but, for the most part, have either been neglected as immaterial or treated as less important. The two least ambiguous HGs most likely to be attributable to having arisen in situ within India, on the basis of phylogeography and accumulated diversification, are F*-M89 and H-M69*; they constitute ∼25%–31% of the Y-chromosome census (Kivisild et al. 2003a; Cordaux et al. 2004; the present study). Besides the diffusion of the agricultural economy eastward of the Indus Valley during pre-Harappan times (6–7 KYA) and subsequently into the Gangetic plain and the appearance of rice agriculture in northeastern India, the archaeobotanical evidence implicating the potential importance of independent centers of plant domestication within the Indian peninsula by local aboriginal peoples must be acknowledged (Fuller 2003).

Limited Impact of Central Asian Agriculturalists

Besides the two main limitations of the previous competing studies (inadequate samples and inadequate molecular resolution), some studies ignore information intrinsic to the unequivocal binary HG phylogenetic structure. Rather, an approach is applied in which frequencies of lineages are viewed as terminal rather than potentially paraphyletic interior nodes in the phylogeny. The best example is the case of HG L-M20. The potential pitfalls regarding miscomprehension regarding the internal diversification of HG L is reminiscent of that previously discussed concerning the African-versus-Asian origin of the YAP polymorphism that lies at the root of HGs D and E (Underhill and Roseman 2001) and issues relating to the phylogeography of rare deep-rooting basal lineages for HG E that support an African origin (Weale et al. 2003). At the basal M20 level of molecular resolution, the results show presumed equivalent affinity across the geographic expanse of Anatolia, southwestern Asia, and South Asia. However, the failure to recognize subsequent binary and associated microsatellite haplotype diversification patterns—coupled with a lack of expansion or divergence times or their erroneous underestimation—undercuts the apparent recentness of its spread and leads to a convenient but incorrect conclusion. By comprehensively describing the next level of binary molecular resolution within the L clade, it becomes evident from the phylogeography that HG L1-M76 underwent early diversification in South India and subsequently expanded toward peripheral regions. The expansion time for L1-M76 spans at least the early Holocene period, well before the Neolithic. The phylogeography and the similarity of microsatellite variation of HGs R1a1 and R2 to L1-M76 in South Asian tribes argues that they likely share a common demographic history.

Expansion of HGs R1a1-M17 and R2-M124

The phylogeography of the HG R*-M207 spans Europe, the Caucasus, West Asia, Central Asia, and South Asia; therefore, the hypothesis that there is an HG R*-M207 expansion locus central to all these regions is both plausible and parsimonious. This is consistent with our observation that HG R*-M207 is observed at a maximum of 3.4% frequency in Baluchistan and Punjab regions, whereas, in inner India, it is 0.3%. HG R1a1 displays both high frequencies and widespread geography, ranging from India to Norway (Quintana-Murci et al. 2001; Passarino et al. 2002), but is rare in East Asia (Su et al. 1999). The distribution of HG R2-M124 is more circumscribed relative to R1a1, but it has been observed at informative levels in Central Asia, Turkey, Pakistan, and India. The distribution of R1a1 and R2 within India is similar, as are the levels of associated microsatellite variance (table 12). The ages of the Y-microsatellite variation (table 11) for R1a1 and R2 in India suggest that the prehistoric context of these HGs will likely be complex. A principal-components plot of R1a1-M17 Y-microsatellite data (fig. 6) shows several interesting features: (a) one tight population cluster comprising southern Pakistan, Turkey, Greece, Oman, and West Europe; (b) one loose cluster comprising all the Indian tribal and caste populations, with the tribal populations occupying an edge of this cluster; and (c) Central Asia and Turkey occupy intermediate positions. The divergence time between the two clusters was 8–12 KYA. The pattern of clustering does not support the model that the primary source of the R1a1-M17 chromosomes in India was Central Asia or the Indus Valley via Indo-European speakers. Further, the relative position of the Indian tribals (fig. 6), the high microsatellite variance among them (table 12), the estimated age (14 KYA) of microsatellite variation within R1a1 (table 11), and the variance peak in western Eurasia (fig. 4) are entirely inconsistent with a model of recent gene flow from castes to tribes and a large genetic impact of the Indo-Europeans on the autochthonous gene pool of India. Instead, our overall inference is that an early Holocene expansion in northwestern India (including the Indus Valley) contributed R1a1-M17 chromosomes both to the Central Asian and South Asian tribes prior to the arrival of the Indo-Europeans. The results of our more comprehensive study of Y-chromosome diversity are in agreement with the caveat of Quintana-Murci et al. (2001, p. 541), that “more complex explanations are possible,” rather than their simplistic conclusion that HGs J and R1a1 reflect demic expansions of southwestern Asian Dravidian-speaking farmers and Central Asian Indo-European–speaking pastorialists.

Figure 6.

Figure 6

Open in a new tab

Plot of R1a1-M17–derived chromosomes against values for the first two principal components for 10 microsatellite loci. Indian population codes are as described in table 1. The Central Asian data include 10 chromosomes described by Underhill et al. (2000). The Turkish data are from Cinnioğlu et al. (2004). The Greek data (R.K., unpublished data) include 19 chromosomes.

On the basis of frequency differences between castes and southern non–Indo-European–speaking tribes, Cordaux et al. (2004) concluded that the R HGs reflect the impact of Indo-European pastoralists from Central Asia, thus linking HG frequency to specific historical events. Although any recent immigration from Central Asia would have undoubtedly contributed some R HGs to the pre-existing gene pool (together with other lineages frequent in Central Asia, such as C3 and O sub groups), other potential events—such as range expansions of Ice Age hunter-gatherers into peninsular India from other source regions, not necessarily far from the mountains extending from Baluchistan to Hindu Kush, on both sides of which the R1a frequency is currently the highest—could have also contributed significantly to the observed distributions, both in India and in Central Asia (Kennedy 2000). In other words, there is no evidence whatsoever to conclude that Central Asia has been necessarily the recent donor and not the receptor of the R1a lineages. The current absence of additional informative binary subdivision within this HG obfuscates potential different histories hidden within this HG, making such interpretations as the sole and recent source area overly simplistic. The same can be said in respect to HG R2-M124.

C5-M356 Is an Ancient HG That Originated in India

The phylogeography, frequency (tables 5 and 6), and age of Y-microsatellite variation (table 11) of HG C5-M356 lineages are indicative of an in situ Indian origin and considerable antiquity. HG C(xC3) lineages occur at considerable frequency in Australia (Kayser et al. 2000). Some have interpreted that the paraphyletic HG C(xC3) reflects the Paleolithic colonization event concerning the peopling of Australia via a southern coastal migration route involving India (Kivisild et al. 1999, 2003a; Underhill et al. 2001a), whereas others (Redd et al. 2002) argued that such C*-defined chromosomes reflects recent (⩽5 KYA) genetic affinity between Indian tribes and Australian Aborigines. Interestingly, the Australian Aborigines with the C(xC3) HG display a large multistep deletion at the DYS390 microsatellite locus (Forster et al. 1998) that is considered to be a unique mutational event (Kayser et al. 2000), whereas the Indians do not. These Australian DYS390.1-deletion HG C chromosomes lack the M356 mutation (M. Kayser, personal communication), which undermines claims of a recent common shared ancestry with India. Conversely, the C5 data support a more-ancient affinity that is consistent with that observed with respect to mtDNA polymorphisms (Macaulay et al. 2005).

Y-Chromosome Substructure and the Geographic Origins of Dravidian Speakers

The impact that Neolithic pastoralists had on the gene pool remains an outstanding topic, as is the origin of the Dravidian language. However, despite the potential consequences of population stratification and language shift, the irregular distributions of Y-chromosome HGs among the various social and linguistic groups provide important insights (table 6). HG L1-M76 has phylogeographic hallmarks consistent with an indigenous-origin model and an age of Y-microsatellite variation consistent with the early Holocene (∼9 KYA). Fuller (2003), using archeobotanical evidence, suggests that Dravidian originated in India, in contrast to western Asia (McAlpin 1974, 1981). The Dravidian-speaking castes essentially display similar levels of HGs R1a1, R2-M124, and L1-M76. On the basis of linguistic and religious evidence, if pastoralists arrived recently on a track from the north via Bactria, southern Tajikistan, northern Afghanistan, and the Hindu Kush into the northern Pakistan plains (Witzel 2004), one would expect to see L3-M357 in India. Although this HG occurs with an intermediate frequency in Pakistan (6.8%), it is very rare in India (0.4%). Conversely, L1-M76 occurs at a frequency of 7.5% in India and 5.1% in Pakistan. Lastly, the L1-M76 mean microsatellite variance is higher in India (0.35) than in Pakistan (0.19).

Further, the distribution of J2a-M410 and J2b-M12 extends from Europe to India, and the virtual absence of HGs J1, E, and G in India indicates a complex scenario of movements not all associated with a single Neolithic and Indo-European spread from a common origin. Recently, mtDNA evidence was brought to bear on the model of an external northwest Indo-Iranian borderland as the Elamo-Dravidian source (Quintana-Murci et al. 2004). The result was cautiously interpreted as consistent with the proto-Elamite hypothesis. However, the possibility that the observed mtDNA HG frequency differences could also reflect the relocation of a more-ancient Indian Dravidian-speaking population that expanded toward the Indus and subsequently experienced gene flow from southwestern Asian sources could not be excluded (Quintana-Murci et al. 2004). The HG F*-M89 and H-M69* data are not in agreement with an exogenous-origin model, but the presence of these HGs in all subgroup classifications does not unequivocally support the indigenous model of Dravidian origins either. However, HG L1-M76, because it is clearly predominant in Dravidian speakers, corresponds most closely with the indigenous model. Further, the microsatellite variance within L1 is greater in southern India than in the Indus region (table 9). The spatial distributions of both L1 HG frequency and associated microsatellite variance (fig. 4) show a pattern of spread emanating from southern India. HG J2a-M410 is confined to upper-caste Dravidian and Indo-European speakers, with little occurrence in the middle and lower castes. This absence of even modest admixture of J2a in southern Indian tribes and middle and lower castes is inconsistent with the L1 data. Overall, therefore, our data provide overwhelming support for an Indian origin of Dravidian speakers.

Acknowledgments

We thank all the men who donated DNA used in this study. This study was supported by grants from the Department of Biotechnology (DBT), Government of India, and the Indian Statistical Institute (to P.P.M.); National Institutes of Health grant GM28428 (to L.L.C.-S.); and Russian Foundation for Basic Research grant 04-04-48639 (to L.A.Z.). We thank P. J. Oefner for calibrating DYS413-allele–repeats controls using Mass Spectrophotometric analyses. We thank DBT for providing permission for S.S. to genotype a fraction of the Indian samples in the Stanford laboratory, for purposes of protocol standardization.

Appendix A: Methodology for Analysis of Microsatellite Variation within a Binary HG

The age of microsatellite variation within a binary HG was estimated as the average squared difference in the number of repeats between all current chromosomes and the founder haplotype, averaged over microsatellite loci and divided by w=6.9×10 per 25 years, with the SE computed over loci (Zhivotovsky et al. 2004; Zhivotovsky and Underhill 2005). The majority of India’s HGs are ancient, which causes a lack of unimodality of the contemporary frequency distribution of microsatellite haplotypes. This is not unexpected with the passage of long evolutionary time and high mutation rates. Processes of fission of populations resulting in bottlenecks and strong effects of genetic drift accelerate the loss of founding haplotypes. The lack of microsatellite-haplotypes at high frequencies within many HGs prevented us from assuming with certainty that a haplotype was a founder. Therefore, to use an identical method for analysis of all HGs, we applied the following approach: for each locus, we computed the median value of repeat scores to form a median (rather than modal) haplotype, which is then taken as a founder. This method gives an underestimate of microsatellite variation if the median haplotype deviates far from an actual founder. However, it is important to mention that the founding and median haplotypes coincide for a few hundred generations after the appearance of the HG (L.A.Z., unpublished observations). The exact period during which these haplotypes coincide depends on the population size and the frequency of multistep mutations. We should emphasize that estimating the age of microsatellite variation gives the time when variation occurred at the microsatellite loci observed in the given population within the HG (although the HG and its microsatellite variation could have arisen long before in a different population in a different geographic location). Some HGs are poorly represented in some tribes or castes; therefore, we did not estimate their ages when our subsamples had fewer than five individuals. For estimating an age of the total microsatellite variation of an HG over populations and regions, all data were pooled together from all samples.

The upper bound for the time of divergence of populations within an HG was calculated as TD, with the assumption of microsatellite variance in repeat scores at the beginning of population separation (V0) equal to zero, with the SE computed over loci (Zhivotovsky 2001). The lower bound for divergence time was calculated as TD, with V0 taken as a predicted value of the within-population microsatellite variance prior to population split. The latter was computed as a linear approximation of the within-population variance in repeat scores as a function of time (because the linearity can be achieved in a case of infinite population size only and, because each surviving HG started from one individual and could maintain low size for a long time, the linear approximation overestimates V0 and thus brings a lower bound for divergence time) (L.A.Z., unpublished data). The lower bound for expansion time gives times “at least that old,” whereas the upper bound gives times “at most that old.” Analytical expression for the SE of lower bounds is unknown. Population samples (e.g., caste, tribe) within an HG of fewer than five individuals were not considered for estimating their divergence time.

We performed a principal-components analysis of R1a1 microsatellite variation on the basis of the correlation matrix; the ij cell of the matrix (ith row and jth column) is the coefficient of correlation between mean values in the number of repeats in population i and population j (Zhivotovsky 1999).

Web Resources

The URLs for data presented herein are as follows:

  1. Arlequin, http://anthro.unige.ch/arlequin/ (for version 2.000)
  2. Fluxus Engineering, http://www.fluxus-technology.com/sharenet.htm (for Network, version 4.1.0.9)
  3. Microsat, http://hpgl.stanford.edu/projects/microsat/ (for version 1.5)

References

  1. Al-Zahery N, Semino O, Benuzzi G, Magri C, Passarino G, Torroni A, Santachiara-Benerecetti AS (2003) Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal and of post-Neolithic migrations. Mol Phylogenet Evol 28:458–472 10.1016/S1055-7903(03)00039-3 [DOI] [PubMed] [Google Scholar]
  2. Bamshad M, Kivisild T, Watkins WS, Dixon ME, Ricker CE, Rao BB, Naidu JM, Prasad BVR, Reddy PG, Rasanayagam A, Papiha SS, Villems R, Redd AJ, Hammer MF, Nguyen SV, Carroll ML, Batzer MA, Jorde LB (2001) Genetic evidence on the origins of Indian caste populations. Genome Res 11:994–1004 10.1101/gr.GR-1733RR [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bamshad MJ, Watkins WS, Dixon ME, Jorde LB, Rao BB, Naidu JM, Prasad BV, Rasanayagam A, Hammer MF (1998) Female gene flow stratifies Hindu castes. Nature 395:651–652 10.1038/27103 [DOI] [PubMed] [Google Scholar]
  4. Barbujani G (2000) Geographic patterns: how to identify them and why. Hum Biol 72:133–153 [PubMed] [Google Scholar]
  5. Basu A, Mukherjee N, Roy S, Sengupta S, Banerjee S, Chakraborty M, Dey B, Roy M, Roy B, Bhattacharyya NP, Roychoudhury S, Majumder PP (2003) Ethnic India: a genomic view, with special reference to peopling and structure. Genome Res 13:2277–2290 10.1101/gr.1413403 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Beekes RSP (1995) Comparative Indo-European linguistics: an introduction. J Benjamins, Amsterdam/Philadelphia [Google Scholar]
  7. Blazek V, Boisson C (1992) The diffusion of agricultural terms from Mesopotamia. Archiv Orientalni 60:16–23 [Google Scholar]
  8. Cann HM, de Toma C, Cazes L, Legrand MF, Morel V, Piouffre L, Bodmer J, et al (2002) A human genome diversity cell line panel. Science 296: 261–262 10.1126/science.296.5566.261b [DOI] [PubMed] [Google Scholar]
  9. Cauvin J (2000) The birth of the gods and the origins of agriculture. Cambridge University Press, Cambridge, United Kingdom [Google Scholar]
  10. Cinnioğlu C, King R, Kivisild T, Kalfoglu E, Atasoy S, Cavalleri GL, Lillie AS, Roseman CC, Lin AA, Prince K, Oefner PJ, Shen P, Semino O, Cavalli-Sforza LL, Underhill PA (2004) Excavating Y-chromosome haplotype strata in Anatolia. Hum Genet 114:127–148 10.1007/s00439-003-1031-4 [DOI] [PubMed] [Google Scholar]
  11. Cordaux R, Aunger R, Bentley G, Nasidze I, Sirajuddin SM, Stoneking M (2004) Independent origins of Indian caste and tribal paternal lineages. Curr Biol 14:231–235 10.1016/S0960-9822(04)00040-5 [DOI] [PubMed] [Google Scholar]
  12. Delfiner P (1976) Linear estimation of non-stationary spatial phenomena. In: Guarasio M, David M, Haijbegts C (Ed.) Advanced geostatistics in the mining industry. Dordrecht, Reidel, Austria, pp 49–68 [Google Scholar]
  13. Di Giacomo F, Luca F, Popa LO, Akar N, Anagnou N, Banyko J, Brdicka R, et al (2004) Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe. Hum Genet 115:357–371 [DOI] [PubMed] [Google Scholar]
  14. Edmonds C, Lillie A, Cavalli-Sforza L (2004) Mutations arising in the wave front of an expanding population. Proc Natl Acad Sci USA 101:975–979 10.1073/pnas.0308064100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Forster P, Kayser M, Meyer E, Roewer L, Pfeiffer H, Benkmann H, Brinkmann B (1998) Phylogenetic resolution of complex mutational features at Y-STR DYS390 in aboriginal Australians and Papuans. Mol Biol Evol 15:1108–1114 [DOI] [PubMed] [Google Scholar]
  16. Fuller D (2003) An agricultural perspective on Dravidian historical linguistics: archaeological crop packages, livestock and Dravidian crop vocabulary. In: Bellwood P, Renfrew C (eds) Examining the farming/language dispersal hypothesis. McDonald Institute for Archaeological Research, Cambridge, United Kingdom, pp 191–213 [Google Scholar]
  17. Hammer MF, Karafet T, Rasanayagam A, Wood ET, Altheide TK, Jenkins T, Griffiths RC, Templeton AR, Zegura SL (1998) Out of Africa and back again: nested cladistic analysis of human Y chromosome variation. Mol Biol Evol 15:427–441 [DOI] [PubMed] [Google Scholar]
  18. Hammer MF, Karafet TM, Redd AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchical patterns of global human Y-chromosome diversity. Mol Biol Evol 18:1189–1203 [DOI] [PubMed] [Google Scholar]
  19. Jobling MA, Tyler-Smith C (2003) The human Y chromosome: an evolutionary marker comes of age. Nat Rev Genet 4:598–612 10.1038/nrg1124 [DOI] [PubMed] [Google Scholar]
  20. Kayser M, Brauer S, Weiss G, Underhill PA, Roewer L, Schiefenhovel W, Stoneking M (2000) Melanesian origin of Polynesian Y chromosomes. Curr Biol 10:1237–1246 10.1016/S0960-9822(00)00734-X [DOI] [PubMed] [Google Scholar]
  21. Kennedy KAR (2000) God-apes and fossil men: palaeoanthropology of South Asia. University of Michigan Press, Ann Arbor, pp 165–171 [Google Scholar]
  22. Kenoyer J (1998) Ancient cities of the Indus Valley civilization. Oxford University Press, Oxford, United Kingdom [Google Scholar]
  23. King R, Underhill PA (2002) Congruent distribution of Neolithic painted pottery and ceramic figurines with Y-chromosome lineages. Antiquity 76:707–714 [Google Scholar]
  24. Kivisild T, Bamshad MJ, Kaldma K, Metspalu M, Metspalu E, Reidla M, Laos S, Parik J, Watkins WS, Dixon ME, Papiha SS, Mastana SS, Mir MR, Ferak V, Villems R (1999) Deep common ancestry of Indian and western-Eurasian mitochondrial DNA lineages. Curr Biol 9:1331–1334 10.1016/S0960-9822(00)80057-3 [DOI] [PubMed] [Google Scholar]
  25. Kivisild T, Rootsi S, Metspalu M, Mastana S, Kaldma K, Parik J, Metspalu E, Adojaan M, Tolk H-V, Stepanov V, Gölge M, Usanga E, Papiha SS, Cinnioğlu C, King R, Cavalli-Sforza L, Underhill PA, Villems R (2003a) The genetic heritage of earliest settlers persist in both the Indian tribal and caste populations. Am J Hum Genet 72:313–332 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kivisild T, Rootsi S, Metspalu M, Metspalu E, Parik J, Kaldma K, Usanga E, Mastana S, Papiha SS, Villems R (2003b) The genetics of language and farming spread in India. In: Bellwood P, Renfrew C (eds) Examining the farming/language dispersal hypothesis. McDonald Institute for Archaeological Research, Cambridge, United Kingdom, pp 215–222 [Google Scholar]
  27. Macaulay V, Hill C, Achilli A, Rengo C, Clarke D, Meehan W, Blackburn J, Semino O, Scozzari R, Cruciani F, Taha A, Shaari NK, Raja JM, Ismail P, Zainuddin Z, Goodwin W, Bulbeck D, Bandelt HJ, Oppenheimer S, Torroni A, Richards M (2005) Single rapid coastal settlement of Asia revealed by analysis of complete mitochondrial genomes. Science 308:1034–1036 10.1126/science.1109792 [DOI] [PubMed] [Google Scholar]
  28. Majumder PP (2001) Indian caste origins: genomic insights and future outlook. Genome Res 11:931–932 10.1101/gr.192401 [DOI] [PubMed] [Google Scholar]
  29. Malaspina P, Ciminelli BM, Viggiano L, Jodice C, Cruciani F, Santolamazza P, Sellitto D, Scozzari R, Terrenato L, Rocchi M, Novelletto A (1997) Characterization of a small family (CAIII) of microsatellite-containing sequences with X-Y homology. J Mol Evol 44:652–659 [DOI] [PubMed] [Google Scholar]
  30. McAlpin DW (1974) Toward proto-Elamo-Dravidian. Language 50:89–101 [Google Scholar]
  31. ——— (1981) Proto-Elamo-Dravidian: the evidence and its implications. Trans Am Phil Soc 71:3–155 [Google Scholar]
  32. Passarino G, Cavalleri GL, Lin AA, Cavalli-Sforza LL, Børresen-Dale A-L, Underhill PA (2002) Different genetic components in the Norwegian population revealed by the analysis of mtDNA and Y chromosome polymorphisms. Eur J Hum Genet 10:521–529 10.1038/sj.ejhg.5200834 [DOI] [PubMed] [Google Scholar]
  33. Pericic M, Lauc LB, Klaric IM, Rootsi S, Janicijevic B, Rudan, I, Terzic R, Colak I, Kvesic A, Popovic D, Sijacki A, Behluli I, Dordevic D, Efemovska L, Bajec DD, Stefanovic BD, Villems R, Rudan P (2005) High-resolution phylogenetic analysis of southeastern Europe (SEE) traces major episodes of paternal gene flow among Slavic populations. Mol Biol Evol 22:1964–197522:1964–1975 10.1093/molbev/msi185 [DOI] [PubMed] [Google Scholar]
  34. Qamar R, Ayub Q, Mohyuddin A, Helgason A, Mazhar K, Mansoor A, Zerjal T, Tyler-Smith C, Mehdi SQ (2002) Y-chromosomal DNA variation in Pakistan. Am J Hum Genet 70:1107–1124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Quintana-Murci L, Chaix R, Wells RS, Behar DM, Sayar H, Scozzari R, Rengo C, Al-Zahery N, Semino O, Santachiara-Benerecetti AS, Coppa A, Ayub Q, Mohyuddin A, Tyler-Smith C, Qasim Mehdi S, Torroni A, McElreavey K (2004) Where west meets east: the complex mtDNA landscape of the southwest and Central Asian corridor. Am J Hum Genet 74:827–845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Hammer MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin A, Radhakrishna U, Jobling MA, Tyler-Smith C, McElreavey K (2001) Y-chromosome lineages trace diffusion of people and languages in southwestern Asia. Am J Hum Genet 68:537–542 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ramana GV, Su B, Jin L, Singh L, Wang N, Underhill P, Chakraborty R (2001) Y-chromosome SNP haplotypes suggest evidence of gene flow among caste, tribe, and the migrant Siddi populations of Andhra Pradesh, South India. Eur J Hum Genet 9:695–700 10.1038/sj.ejhg.5200708 [DOI] [PubMed] [Google Scholar]
  38. Redd A, Roberts-Thomson J, Karafet T, Bamshad M, Jorde L, Naidu J, Walsh B, Hammer MF (2002) Gene flow from the Indian subcontinent to Australia: evidence from the Y chromosome. Curr Biol 12:673–677 10.1016/S0960-9822(02)00789-3 [DOI] [PubMed] [Google Scholar]
  39. Renfrew C (1996) Language families and the spread of farming. In: Harris DR (ed) The origins and spread of agriculture and pastoralism in Eurasia. Smithsonian Institution Press, Washington, DC, pp 70–92 [Google Scholar]
  40. Roychoudhury S, Roy S, Basu A, Banerjee R, Vishwanathan H, Usha Rani MV, Sil SK, Mitra M, Majumder PP (2001) Genomic structures and population histories of linguistically distinct tribal groups of India. Hum Genet 109:339–350 10.1007/s004390100577 [DOI] [PubMed] [Google Scholar]
  41. Sandwell DT (1987) Biharmonic spline interpolation of GEOS-3 and SEASAT altimeter data. Geophys Res Letters 2:139–142 [Google Scholar]
  42. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, Battaglia V, Maccioni L, Triantaphyllidis C, Shen P, Oefner PJ, Zhivotovsky LA, King R, Torroni A, Cavalli-Sforza LL, Underhill PA, Santachiara-Benerecetti AS (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the Neolithization of Europe and later migratory events in the Mediterranean area. Am J Hum Genet 74:1023–1034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Semino O, Passarino G, Oefner PJ, Lin AA, Arbuzova S, Beckman LE, De Benedictis G, Francalacci P, Kouvatsi A, Limborska S, Marcikiæ M, Mika A, Mika B, Primorac D, Santachiara-Benerecetti A, Cavalli-Sforza LL, Underhill PA (2000) The genetic legacy of Palaeolithic Homo sapiens sapiens in extant Europeans: a Y-chromosome perspective. Science 290:1155–1159 10.1126/science.290.5494.1155 [DOI] [PubMed] [Google Scholar]
  44. Su B, Xiao J, Underhill P, Deka R, Zhang W, Akey J, Huang W, Shen D, Lu D, Luo J, Chu J, Tan J, Shen P, Davis R, Cavalli-Sforza L, Chakraborty R, Xiong M, Du R, Oefner P, Chen Z, Jin L (1999) Y-chromosome evidence for a northward migration of modern humans in East Asia during the last Ice Age. Am J Hum Genet 65:1718–1724 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tambets K, Tolk H-V, Kivisild T, Metspalu E, Parik J, Reidla M, Voevoda M, Damba L, Bermisheva M, Khusnutdinova E, Golubenko M, Stepanov V, Puzyrev V, Usanga E, Rudan P, Beckmann, L, Villems R (2003) Complex signals for population expansions in Europe and beyond. In: Bellwood P, Renfrew C (eds) Examining the farming/language dispersal hypothesis. McDonald Institute for Archaeological Research, Cambridge, United Kingdom, pp 449–457 [Google Scholar]
  46. Thangaraj K, Ramana GV, Singh L (1999) Y-chromosome and mitochondrial DNA polymorphisms in Indian populations. Electrophoresis 20:1743–1747 [DOI] [PubMed] [Google Scholar]
  47. Underhill PA, Passarino G, Lin AA, Marzuki S, Cavalli-Sforza LL, Chambers G (2001a) Maori origins, Y chromosome haplotypes and implications for human history in the Pacific. Hum Mutat 17:271–280 10.1002/humu.23 [DOI] [PubMed] [Google Scholar]
  48. Underhill PA, Passarino G, Lin AA, Shen P, Foley RA, Mirazón Lahr M, Oefner PJ, Cavalli-Sforza LL (2001b) The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations. Ann Hum Genet 65:43–62 10.1046/j.1469-1809.2001.6510043.x [DOI] [PubMed] [Google Scholar]
  49. Underhill PA, Roseman CC (2001) The case for an African rather than an Asian origin of the human Y-chromosome YAP insertion. In: Jin L, Seielstad M, Xiao C (eds) Recent advances in human biology. Vol. 8: Genetic, linguistic and archaeological perspectives on human diversity in Southeast Asia. World Scientific, New Jersey, pp 43–56 [Google Scholar]
  50. Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonné-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells R S, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner, PJ (2000) Y chromosome sequence variation and the history of human populations. Nat Genet 26:358–361 10.1038/81685 [DOI] [PubMed] [Google Scholar]
  51. Weale ME, Shah T, Jones AL, Greenhalgh J, Wilson JF, Nymadawa P, Zeitlin D, Connell BA, Bradman N, Toomas MG (2003) Rare deep-rooting Y chromosome lineages in humans: lessons for phylogeography. Genetics 165:229–234 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wells RS, Yuldasheva N, Ruzibakiev R, Underhill PA, Evseeva I, Blue-Smith J, Jin L, Su B, et al (2001) The Eurasian heartland: a continental perspective on Y-chromosome diversity. Proc Natl Acad Sci USA 98:10244–10249 10.1073/pnas.171305098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Witzel M (2004) Central Asian roots and acculturation in South Asia: linguistic and archaeological evidence from western central Asia, the Hindukush and northwestern south Asia for early Indo-Aryan language and religion. In: Osada T (ed) Linguistics, archaeology and the human past. Indus Project, Research Institute for Humanity and Nature, Kyoto, pp 87–211 [Google Scholar]
  54. Wooding S, Ostler C, Prasad BVR, Watkins WS, Sung S, Bamshad M, Jorde LB (2004) Directional migration in the Hindu castes: inferences from mitochondrial, autosomal and Y-chromosomal data. Hum Genet 115:221–229 [DOI] [PubMed] [Google Scholar]
  55. Zerjal T, Wells RS, Yuldasheva N, Ruzibakiev R, Tyler-Smith C (2002) A genetic landscape reshaped by recent events: Y-chromosomal insights into central Asia. Am J Hum Genet 71:466–482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhivotovsky LA (2001) Estimating divergence time with use of microsatellite genetic distances: impacts of population growth and gene flow. Mol Biol Evol 18:700–709 [DOI] [PubMed] [Google Scholar]
  57. Zhivotovsky LA, Underhill PA (2005) On the evolutionary mutation rate at Y-chromosome STRs: comments on paper by Di Giacomo et al (2004). Hum Genet 116:529–532 10.1007/s00439-005-1281-4 [DOI] [PubMed] [Google Scholar]
  58. Zhivotovsky LA, Underhill PA, Cinnioğlu C, Kayser M, Morar B, Kivisild T, Scozzari R, Cruciani F, Destro-Bisol G, Spedini G, Chambers GK, Herrera RJ, Yong KK, Gresham D, Tournev I, Feldman MW, Kalaydjieva L (2004) The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Am J Hum Genet 74:50–61 [DOI] [PMC free article] [PubMed] [Google Scholar]

Supplemental References

  1. Karafet T, Xu L, Du R, Wang W, Feng S, Wells RS, Redd AJ, Zegura SL, Hammer MF (2001) Paternal population history of East Asia: sources, patterns, and microevolutionary processes. Am J Hum Genet 69:615–628 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Luis JR, Rowold DJ, Regueiro M, Caeiro B, Cinnioğlu C, Roseman C, Underhill PA, Cavalli-Sforza LL, Herrera RJ (2004) The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Am J Hum Genet 74:532–544 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Maca-Meyer N, Sanchez-Velasco P, Flores C, Larruga JM, Gonzalez AM, Oterino A, Leyva-Cobian F (2003) Y chromosome and mitochondrial DNA characterization of Pasiegos, a human isolate from Cantabria (Spain). Ann Hum Genet 67:329–239 10.1046/j.1469-1809.2003.00045.x [DOI] [PubMed] [Google Scholar]
  4. Zhivotovsky LA (1999) A new genetic distance with application to constrained variation at microsatellite loci. Mol Biol Evol 16:467–471 [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Human Genetics are provided here courtesy of American Society of Human Genetics

RESOURCES