Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2003 Feb;77(4):2709–2716. doi: 10.1128/JVI.77.4.2709-2716.2003

Amino Acid Substitutions in VP2 Residues Contacting Sialic Acid in Low-Neurovirulence BeAn Virus Dramatically Reduce Viral Binding and Spread of Infection

A S Manoj Kumar 1,2, Patricia Kallio 1, Ming Luo 3, Howard L Lipton 1,2,4,*
PMCID: PMC141107  PMID: 12552011

Abstract

Theiler's murine encephalomyelitis viruses (TMEV) consist of two groups, the high- and low-neurovirulence groups, based on lethality in intracerebrally inoculated mice. Low-neurovirulence TMEV result in a persistent central nervous system infection in mice, leading to an inflammatory demyelinating pathology and disease. Low- but not high-neurovirulence strains use sialic acid as an attachment factor. The recent resolution of the crystal structure of the low-neurovirulence DA virus in complex with the sialic acid mimic sialyllactose demonstrated that four capsid residues make contact with sialic acid through noncovalent hydrogen bonds. To systematically test the importance of these sialic acid-binding residues in viral entry and infection, we mutated three VP2 puff B amino acids proposed to make contact with sialic acid and analyzed the consequences of each amino acid substitution on viral entry and spread. The fourth residue is in the VP3-VP1 cleavage dipeptide and could not be mutated. Our data suggest that residues Q2161 and G2174 are directly involved in BeAn virus attachment to sialic acid and that substitutions of these two residues result in the loss of or reduced viral binding and hemagglutination and in the inability to spread among BHK-21 cells. In addition, a gain of function-revertant virus was recovered with the Q2161A mutation after prolonged passage in cells.


The cardiovirus Theiler's murine encephalomyelitis virus (TMEV) consists of two groups based on neurovirulence in intracerebrally (i.c.) inoculated mice: high-neurovirulence strains, such as GDVII, produce acute encephalitis, whereas low-neurovirulence TMEV, such as BeAn and DA, produce persistent central nervous system (CNS) infection, leading to an inflammatory demyelinating process (21, 22). Persistent TMEV infection in mice provides a highly relevant experimental animal model for the human demyelinating disease multiple sclerosis, in which a viral infection is believed to play a central pathogenetic role.

Attenuating mutations in the high-neurovirulence GDVII genome enable host survival but do not result in persistent CNS infection, suggesting that a genetic element(s) for TMEV persistence is present in only the low-neurovirulence genome (23, 31). Genetic analyses of recombinant TMEV have mapped a major element for persistence to the sequences encoding the capsid proteins (8, 23, 28). In addition, studies of recombinant viruses in which the capsid sequences of the low-neurovirulence BeAn strain progressively replaced those of the high-neurovirulence GDVII virus starting at the leader N terminus suggest that a conformational determinant involving homologous BeAn sequences in the VP2 puff and VP1 loops is required for persistence (1). The mapping of a genetic element for persistence to the capsid suggests that a virus-receptor interaction(s) underlies TMEV persistence.

The low- but not high-neurovirulence TMEV use sialic acid as an attachment factor, and the sialic acid binding phenotype has been correlated with changes in virulence in several virus-host systems (6, 7, 19). Recently, the crystal structure of the low-neurovirulence DA virus in complex with sialyllactose was resolved to 3 Å (38), revealing three VP2 amino acids on puff B (Q2161, A2163, and G2174) and one VP3 residue (Q3232), all within a positively charged area on the viral surface, that make contact with sialic acid through noncovalent hydrogen bonds (38). Note that the contacts are with sialic acid and not the penultimate sugar galactose. Since these four viral residues are conserved in all TMEV (two high- and six low-neurovirulence capsid sequences are known) and the largest difference in root-mean-square deviation between the Cα coordinates of viruses of the two neurovirulence groups lies in VP2 puff B (25), the capsid conformation of this region may be responsible for sialic acid binding. These data are also consistent with viral genetic studies that suggest the conformational nature of a TMEV persistence determinant involving the two sets of VP1 and VP2 surface loops that interact on the virion surface (1).

Of the three VP2 residues that contact sialic acid, only Q2161 uses its side chain while A2163 and G2174 use their main chains, carbonyl oxygen and amide, respectively. Thus, substitutions at Q2161 are more likely to disrupt the interaction with sialic acid than substitutions at A2163 or G2174. BeAn residue Q3232, which contacts sialic acid, is part of the VP3-VP1 cleavage dipeptide and cannot be mutated. To systematically test the importance of these sialic acid-binding residues in viral entry and infection, we mutated the VP2 puff B amino acids and analyzed the consequences of these single amino acid substitutions on sialic acid binding in a biological context as it is expressed on complex-carbohydrate moieties at the cell surface. Our data indicate the direct involvement of BeAn virus residues Q2161 and G2174 in the viral attachment to sialic acid expressed on mammalian cells and erythrocytes. Mutations at these sites resulted in the loss of or reduced viral binding and hemagglutination and in the inability to spread among BHK-21 cells. Thus, mutations of these sialic acid-binding residues are in effect lethal mutations in BeAn virus.

MATERIALS AND METHODS

Cells and viruses.

Baby hamster fibroblast cells (BHK-21) were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 2 mM l-glutamine, 100 mg of streptomycin/ml, 100 U of penicillin/ml, 7.5% fetal bovine serum (FBS), and 6.5 mg of tryptose phosphate broth (Life Technologies, Rockville, Md.)/ml at 37°C in 95% air containing 5% CO2 (designated DMEM plus). Lec-2 cells (American Type Culture Collection, Manassas, Va.) were maintained in minimum essential medium supplemented with 2 mM l-glutamine, 100 mg of streptomycin/ml, 100 U of penicillin/ml, and 10% FBS. Virus infections were carried out on 90% confluent monolayers in medium containing 1% FBS. The origin and passage history of the BeAn and GDVII viruses have been described previously (29, 30). Virus stocks were prepared as clarified lysates in BHK-21 cells (titers of >108 PFU/ml).

Full-length cDNA BeAn virus clones.

Mutant BeAn viruses were derived from a plasmid containing the full-length parental BeAn cDNA in pGEM4 (Promega, Madison, Wis.) immediately downstream from the T7 RNA polymerase promoter (8). The plasmid was modified so that only 2 nucleotides separated the T7 RNA polymerase promoter and the 5′ end of the virus, and an XbaI site was engineered immediately downstream of the poly(A) tract at the 3′ end. A noninfectious BeAn clone, designated ΔBeAn, was generated by digesting BeAn with SalI (nucleotide 1597 near the N terminus of VP2) and XhoI (nucleotide 3825 at the VP1-2A cleveage dipeptide), which removed a 2.2-kb fragment containing most of the P1 coding sequence. This plasmid was self-ligated to generate ΔBeAn, and in vitro-transcribed RNA was used as a control for the cytotoxicity of noninfectious RNA in the electroporation experiments.

Site-directed mutagenesis.

A sequence containing the VP2 region from the full-length BeAn plasmid in pGEM4 was ligated into M13mp18 (Bio-Rad, Hercules, Calif.), and mutagenesis was performed according to the method described by Kunkel et al. (20). Escherichia coli CJ236 cells (Bio-Rad) were used in preparation of the uracil-rich, single-stranded M13 template, and E. coli MV1190 (Bio-Rad) was used for the propagation of M13. After mutagenesis, the sequence was ligated back into the full-length BeAn plasmid. Table 1 lists the mutations generated and the sequences of mutagenic oligonucleotides. Sequencing reactions of single-stranded M13 DNA and plasmid DNA carried out with an ABI Prism Big Dye terminator cycle sequencing kit were analyzed on an ABI Prism 310 genetic analyzer (Applied Biosystems, Shelton, Conn.).

TABLE 1.

Mutations in BeAn VP2 residues that contact sialic acid

Original mutation Sequence of mutagenic oligonucleotide Original codon change Revertant codon
Q2161A 5′ GGGTGCACCCGCCGGGCTGCGC 3′ CAG → GCG GCG → CAG
Q2161R 5′ GGGTGCACCCCGCGGGCTGCGC 3′ CAG → CGG —a
Q2161W 5′ GGGTGCACCCCACGGGCTG 3′ CAG → TGG —
Q2163F 5′ GTAGCCTGTGGGGAAAAACCCTGC 3′ GCA → TTT —
G2174F 5′ GGCAAAGAAGAAGGTTCGACTG 3′ GGC → TTC —
G2174W 5′ GGCAAAGAACCAGGTTCGACTG 3′ GGC → TGG —
a

—, no change.

Transfection.

BHK-21 cells were transfected with in vitro-transcribed viral RNA by using electro-cell manipulator model 600 (BTX, San Diego, Calif.). Conditions were optimized with TMEV RNA transcribed in vitro from a full-length GDVII virus cDNA in which a green fluorescent protein (GFP) sequence was inserted into the leader protein (designated GDVII-GFP) (provided by Miriam Calenoff, Northwestern University Medical School). Briefly, trypsinized BHK-21 cells from 50% confluent monolayers were washed with phosphate-buffered saline (PBS) without divalent cations, pH 7.4 (PBS−), resuspended in PBS− to a density of 107 cells/ml, and mixed (5 × 106 cells) with 1 μg of in vitro-transcribed RNA. The mixture was transferred to a 2-mm-inside-diameter electroporation cuvette and pulsed twice at 600 V (high-voltage mode), 100 μF, and 720 Ω, giving an output of 500 V and a 3.5-ms pulse length and resulting in 50% cell lysis. The cell suspension was kept at 24°C for 3 min, DMEM plus was added to a final volume of 6 ml with mixing, and 5 × 105 viable cells were seeded in 35-mm-diameter dishes. Cells allowed to adhere to plastic at 37°C for 2 h were gently washed with DMEM plus supplemented with 2% FBS, refed with the same medium, and incubated at 37°C in a 5% CO2 atmosphere. The appearance of green fluorescing cells after the transfection of GDVII-GFP RNA was monitored with a Zeiss inverted fluorescence microscope. Transfection efficiency was determined by flow cytometry of fluorescent cells at 24 h.

In vitro RNA transcription and translation.

Parental and mutant BeAn cDNAs were transcribed and translated in vitro. DNA was linearized with XbaI 3′ to the poly(A) tract and transcribed with T7 RNA polymerase (Ampliscribe; Epicentre, Madison, Wis.) for 2 h; the RNA transcripts were incubated with 10 U of RNase-free DNase for 15 min at 37°C, phenol-chloroform extracted, and ethanol precipitated. In vitro translation reactions were carried out as described by Roos et al. (33) with 0.5 to 1 μg of viral RNA transcript for 3 h at 30°C in rabbit reticulocyte lysate (Promega) with final concentrations of 10 mM potassium isothiocyanate, 0.04 mg of creatinine kinase, and 0.5 mCi of [35S]methionine (Amersham, Piscataway, N.J.)/ml. Translation reactions were resolved on 12% polyacrylamide gels containing sodium dodecyl sulfate. Gels were dried, fluorographed by soaking in 1 M sodium salicylate, and exposed to Kodak XAR-5 film at −70°C.

Real-time reverse transcription-PCR.

The TaqMan system (Applied Biosystems), a fluorogenic-probe-based PCR assay that exploits the 5′-to-3′ endonuclease activity of Taq polymerase, was used to quantitate BeAn virus RNA copy numbers as described previously (36).

Immunodetection of viral antigens.

Viral antigens were detected by staining-transfected monolayers and monolayers infected with rabbit anti-BeAn serum (1:500) and horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin (1:75; BD Biosciences, San Diego, Calif.). Soluble viral antigen levels in RNA-transfected cells were quantitated by flow cytometry as described previously (32).

Cell viability assay.

Cell viability was determined by the conversion of 3-(4,5-dimethyl-thiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) to blue formazan crystals as described previously (15). Briefly, 104 electroporated cells were seeded in each well of 96-well plates and incubated at 37°C. At the indicated times, cells were incubated for 2 to 4 h with 50 μl of MTT (1 mg/ml). Formazan crystals were dissolved in 100 μl of dimethyl sulfoxide, and the optical density at 560 nm was read on a UV Max microplate reader (Molecular Diagnostics, Palo Alto, Calif.). Results from eight samples were analyzed using Student's t test.

Hemagglutination assay.

Hemagglutination was performed in 96-well round-bottom plates containing serial dilutions of virus in 100 μl of PBS per well. An equal volume of 0.5% suspension of human type O erythrocytes was added to each well, and plates were incubated at 4°C for 2 h. Erythrocytes were incubated with 50 mU of neuraminidase (Clostrium perfringens, type V) and viruses with 50 μg of glycophorin A (Sigma, St. Louis, Mo.) to inhibit hemagglutination.

Binding assay.

BHK-21 cells were detached from monolayers with PBS−, washed, resuspended to a concentration of 106 cells/ml in DMEM containing 20 mM HEPES and 1% bovine serum albumin, and incubated on ice for 1 h before the addition of [35S]methionine-labeled virus (20,000 particles/cell). At the indicated times, an aliquot of the virus-cell suspension was removed and diluted in DMEM containing 20 mM HEPES before centrifugation at 12,000 × g for 30 s. The supernatant- and cell-associated radioactivity was determined for triplicate samples in a Beckman LS5000TD scintillation counter and plotted as the percentage of cell-associated radioactivity (counts per minute).

RESULTS

BeAn Q2161 mutant viruses are defective in cell-to-cell spread.

The conditions for electroporation of TMEV RNA in BHK-21 cells were optimized using a GDVII virus infectious clone in which GFP replaced leader protein sequences (see Materials and Methods). BeAn viral antigen was detected in 50% of cells by immunostaining and microscopy by 15 to 18 h, with a cytopathic effect (CPE) developing between 48 and 120 h in transfected monolayers. Mutations were introduced into the sequences of all three BeAn VP2 residues (Q2161, A2163, and G2174), but those at Q2161 were examined first. Figure 1 shows the predicted effect of mutations at residue Q2161 on binding to sialic acid. The substitutions (in blue) should only be viewed as an illustration of what might happen locally to secondary structure. The targeted VP2 nucleotide sequence was mutated in a 622-bp cassette subcloned into M13mp18 and assembled into a full-length infectious clone. In vitro-transcribed mutant BeAn virus RNAs for Q2161A, Q2161R, and Q2161W were electroporated into BHK-21 cells, and the number of virus-infected cells at the indicated times after electroporation was determined by light microscopic examination of immunostained cell monolayers and by flow cytometric analysis of immunostained cells. CPE was based on the MTT assay of cell survival. Electroporation of the ΔBeAn virus RNA served as the control. The numbers of virus antigen-containing cells from the initial round of infection were similar for parental and mutant viruses at 15 and 24 h, with 30 to 40% of the cells infected at 15 h (Fig. 2A). Subsequently, the three Q2161 mutant viruses showed a loss of infected cells from monolayers while parental BeAn virus monolayers showed an increase in infected cell numbers at 48 h (Fig. 2A). In addition, flow cytometric analysis at 24 and 48 h revealed that antigen-containing cells in the Q2161 monolayers decreased by ∼20% while those in the parental monolayer had increased. The MTT assay at 18 h revealed a significant reduction (P < 0.02) in the number of viable cells infected with the parental virus constructs and all mutant constructs compared to that of cells transfected with the ΔBeAn construct; however, at 48 h, a further loss of viable cells was seen with only the parental construct (Fig. 2B). Thus, only the parental virus was capable of cell-to-cell spread. Finally, none of the mutant viruses exhibited a CPE when the cultures were observed for 7 days. Together, these results suggest that the kinetics of viral replication and induction of CPE proceed normally in cells transfected with the Q2161 mutant viruses; however, these viruses are incapable of cell-to-cell spread to initiate additional rounds of infection.

FIG. 1.

FIG. 1.

Stick model showing the binding site on sialic acid (SAL) for VP2 puff B residue Q2161. Carbon atoms are off white, nitrogen blue, and oxygen red, and hydrogen bonds are yellow. (A) The Q2161 side chain nitrogen forms a hydrogen bond with a sialic acid hydroxyl group (OH1). Residues A2163 and G2174 near the binding site are labeled. LAC, lactose moiety of sialyllactose bound in the crystal structure. (B) Substitution of the glutamate side chain with that of the alanine eliminates the group that binds sialic acid in this site. (C) Substitution of the glutamate side chain with that of arginine is too bulky to allow binding of sialic acid. (D) Substitution of the glutamate side chain with that of tryptophan is too bulky to allow binding to sialic acid.

FIG. 2.

FIG. 2.

Viral replication in BHK-21 cells after electroporation of parental and mutant virus RNA transcripts. (A) BHK-21 cells were seeded on plastic, and monolayers were fixed and stained with an immunoperoxidase conjugate to detect BeAn virus antigens at 15 and 48 h after electroporation. Photomicrographs were taken at ×400. Results are representative of three independent experiments. (B) BHK-21 cells were seeded at 104 cells/well in 96-well microplates after electroporation, and cell viability was determined by MTT assay in eight replicate samples from three independent experiments. Results are mean number of viable cells (± standard deviation) at 18 and 48 h. OD560, optical density at 560 nm.

Mutations at G2174 also result in viruses defective in cell-to-cell spread.

Substitutions of two large hydrophobic residues were made at G2174 and one was made at A2163 which made contact with sialic acid through the main-chain amide and carbonyl oxygen, respectively (Fig. 1). The three mutant BeAn viruses, A2163F, G2174F, and G2174W, were assembled into full-length cDNAs. Mutant virus A2163F showed no evidence of replication in BHK-21 cells following electroporation, i.e., no virus antigen-containing cells were detected at 18 or 48 h, reflecting a defect in the polyprotein processing observed in the in vitro translation of transcribed RNA (data not shown). The numbers of virus antigen-containing cells electroporated with mutant virus G2174F and G2174W RNAs were similar at 18 h to that with parental virus RNA and did not increase at 48 h in three independent experiments (data not shown). However, the MTT assay of the transfected monolayers demonstrated a loss of cells at 18 h but only a minimal increase in cell numbers at 48 h in contrast to that for the Q2161 mutants (Fig. 2B). These results suggest that the G2174 mutant viruses have only a limited potential, if any, to produce infectious virus to initiate cell-to-cell spread in the monolayers.

BeAn Q2161 and G2174 mutant viruses form 160S virion peaks in sucrose gradients.

BHK-21 cells were electroporated with parental and mutant virus RNAs, and the viral proteins were radiolabeled with l-[35S]methionine between 5 and 24 h. Approximately 1.5 × 107 viable cells were plated after electroporation in six 100-mm2 dishes, and at 24 h, viral lysates were harvested, concentrated, and run on 20 to 70% sucrose gradients. As shown in Fig. 3A, radioactivity peaked in fraction 5 of the gradients for the parental BeAn and five mutant viruses, i.e., the location of 160S virion particles in the gradients. The capsid protein profile of fraction 5 was also characteristic of mature virions (Fig. 3B), i.e., VP0 was processed into VP2 and VP4, a capsid cleavage event that occurs in the final step in the assembly of mature virions. These data indicate that the mutant viruses were assembled into mature virions.

FIG. 3.

FIG. 3.

BHK-21 cells were electroporated with either parental or mutant BeAn RNA transcripts, seeded in 100-mm2 wells, labeled with l-[35S]methionine at 5 h, harvested at 24 h, and run on 20 to 70% sucrose gradients. (A) Gradient fractions (0.5 ml) were assessed for radioactivity by scintillation counting, and the first 16 fractions were plotted; 160 S peaks were seen in fraction 5. (B) An aliquot of each peak fraction was analyzed by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis. Molecular weight markers are indicated on the left, and capsid proteins are indicated on the right. Lanes: 1, parental BeAn; 2, Q2161A; 3, Q2161R; 4, Q2161W; 5, G2174F; 6, G2174W; 7, purified stock BeAn virus.

Q2161 and G2174 mutant viruses are defective in binding to BHK-21 cells.

Binding assays performed using virus purified from [35S]methionine-labeled 160S virion peaks indicated that >50% of the parental BeAn virus bound to BHK-21 cells at 30 min, whereas only 10% of the Q2161A, Q2161R, Q2161W, and G2174F mutant viruses showed binding (Fig. 4). This level of binding was only slightly greater than that of background binding of parental BeAn virus to neuraminidase-treated cells (Fig. 4). Thus, the Q2161 mutants completely lost the ability to bind to BHK-21 cells. In contrast, the G2174W mutant showed 22% binding, indicating an only partial loss in the ability to bind BHK-21 cells, and therefore was potentially infectious. Since the G2174 mutant did not spread to other cells, it is possible it has a defect in internalization.

FIG. 4.

FIG. 4.

(A) Viral binding to BHK-21 cells in suspension was performed at 4°C by using peak fractions of the sucrose gradient (5 × 103 cpm) shown in Fig. 3. (B) Viral binding to untreated and neuraminidase (NA)-treated (50 mU) BHK-21 cells was carried out with stock BeAn virus labeled with l-[35S]methionine. Cell-associated radioactivity (means ± standard deviations of three samples) at 1 and 30 min was determined by scintillation counting as described in Materials and Methods.

BeAn mutant viruses show lost or altered hemagglutination.

The TMEV-related cardioviruses mengovirus and encephalomyocarditis virus (EMCV) require sialic acid on glycophorin A for hemagglutination (27). To determine whether BeAn virus also uses sialic acid for hemagglutination, human type O erythrocytes were digested with 50 mU of neuraminidase or PBS at 24°C for 1 h, before hemagglutination assay with a tissue-culture-derived BeAn virus stock. A hemagglutination titer of 1:256 for the BeAn virus (stock) was completely inhibited by neuraminidase treatment of the erythrocytes (Fig. 5A). BeAn hemagglutination was also completely inhibited when virus was incubated at 24°C for 30 min with 50 μg of glycophorin A (Fig. 5A); however, glycophorin A preincubated with neuraminidase had no effect on hemagglutination (titer, 1:256 [data not shown]). In contrast, GDVII virus hemagglutination was not affected by neuraminidase treatment of erythrocytes but was inhibited by glycophorin A. Thus, BeAn virus uses sialic acid on glycophorin A for hemagglutination. Analysis of the mutant-purified virions from the 160S peaks revealed the complete loss of hemagglutinating ability in all of the Q2161 mutant viruses, while the G2174 mutants retained low hemagglutination titers (≥128- to 256-fold lower than parental BeAn virus titers) (Fig. 5B). Thus, the ability of BeAn virus to bind sialic acid was lost or dramatically reduced by single amino acid substitutions at positions 2161 and 2174, respectively, and consequently, the hemagglutination ability was lost.

FIG. 5.

FIG. 5.

Hemagglutination analysis of stock BeAn virus (lysate) and parental and mutant BeAn viruses from sucrose gradient peak fractions shown in Fig. 3. (A) Human type O erythrocytes (0.5%) were pretreated with either 50 mU neuraminidase or PBS at 24°C for 1 h, or BeAn virus was preincubated with glycophorin A and used in a hemagglutination inhibition assay with BeAn stock virus. (B) Sucrose gradient peak fractions (5 × 103 cpm) of parental and mutant BeAn viruses were compared in the hemagglutination assay.

Revertant viruses are generated by prolonged culture of mutant viruses.

As a further measure of cell-to-cell spread, cell monolayers were harvested 24 h after electroporation with parental BeAn and the mutant virus RNAs when 30 to 40% of cells expressed viral antigens (Fig. 2A) and were disrupted by freezing and thawing to prepare clarified lysates for the infection of fresh monolayers in six-well plates. While the parental BeAn virus produced cytolysis within 12 to 24 h, the monolayers in which the mutant viruses were passed remained intact (Fig. 6). The absence of CPE produced by the G2174W mutant, which showed a partial binding phenotype, suggests that this mutant was in fact defective in entry and/or in a later step in the viral life cycle. However, repeated observation of the Q2161A mutant virus for >7 days revealed small foci of CPE in 1 of 10 wells of 12-well plates; passage of this mutant virus led to complete cytolysis within 24 h, and a virus able to bind and infect BHK-21 cells was isolated. This experiment was repeated two more times with the recovering of a revertant virus in only one of the experiments (1 of 10 and 0 of 10 wells). Nucleotide sequencing of the capsid region revealed reversion to the parental sequence at the mutated codon, i.e., GCG → CAG (Table 1). No revertants were recovered for any of the other mutant viruses (0 of 10 wells developed a CPE for each mutant virus in each of two experiments). The Q2161A revertant virus produced pinpoint plaques similar to those produced by parental BeAn virus and had a hemagglutination titer of 1:256 that was inhibited by neuraminidase treatment of erythrocytes (Fig. 7A and B). The Q2161A revertant also failed to induce a CPE in Lec-2 cells (Fig. 7C), which are deficient in the CMP sialic acid transporter and in the cell surface expression of sialic acid. These results suggest that the Q2161A revertant regained the ability to bind sialic acid and acquired other phenotypic features of the BeAn parental virus.

FIG. 6.

FIG. 6.

CPE after passage of lysates from BHK-21 cells electroporated with parental and mutant BeAn virus RNA transcripts. When extensive CPE developed in the parental BeAn virus-infected monolayers at 24 h postinfection, cells were fixed and stained with crystal violet stain and photographed. The lack of staining of monolayer C indicates complete CPE. (A) Uninfected control; (B) ΔBeAn; (C) parental BeAn; (D) Q2161A; (E) Q2161R; (F) Q2161W; (G) G2174F; (H) G2174W; (I) A2163F.

FIG. 7.

FIG. 7.

Characteristics of the Q2161A revertant virus. (A) The mutant virus plaque size was compared to the small plaque size of parental BeAn and the large plaque size of the high-neurovirulence GDVII virus. (B) Hemagglutination was abolished by neuraminidase (NA) treatment of erythrocytes (RBC), whereas the mutant Q2161A virus did not hemagglutinate (Fig. 5B). (C) MTT cell viability assay in sialic acid-deficient Lec-2 cells after infection with GDVII, parental BeAn, and Q2161A revertant viruses is shown. OD560, optical density at 560 nm.

DISCUSSION

Members of the two TMEV neurovirulence groups use different attachment factors.

TMEV is unique among picornaviruses because of the existence of two naturally occurring neurovirulence groups with distinct disease phenotypes and highly similar amino acid sequences (>90%) and capsid structures (9, 29). Since nonenveloped viruses, such as picornaviruses, are unable to fuse with the cellular lipid membrane bilayer, their internalization is thought to require a specific protein entry receptor. The TMEV capsid carries a protein receptor recognition site, the pit (13), analogous to a depression on the surface of poliovirus and the major group of human rhinoviruses (14, 34). While it is possible that members of the two TMEV neurovirulence groups use the same receptor protein (12, 17), the attachment factors (coreceptors) clearly differ. Low-neurovirulence strains bind α2,3-linked sialic acid moieties on N-linked oligosaccharides (12, 35, 37), while high-neurovirulence strains bind the proteoglycan heparan sulfate (32). In neither instance is the use of attachment factors an artifact of cell culture adaptation of TMEV strains since suckling mouse brain virus stocks that have never been passed in cells also require attachment factors for the infection of mammalian cells (32) (unpublished data).

Substitutions at BeAn residues Q2161 and G2174 indicate contact with sialic acid.

Our present results support the crystallographic findings (38) that TMEV residues Q2161 and G2174 contact sialic acid. Mutation of parental virus residue Q2161 to A, R, or W and mutation of G2174 to F or W eliminated or reduced viral binding to BHK-21 cells such that cell-to-cell spread after electroporation was lost. Mutation of A2163, another residue identified as contacting sialic acid (38), to F resulted in a virus with defective polyprotein processing and no evidence of virus antigen production after electroporation; however, it is possible that the substitution of other less bulky residues at A2163 would not have been lethal and would have led to altered sialic acid binding. Our results demonstrate that mutations of these residues affect BeAn binding to the sialic acid expressed in its native state on complex carbohydrates, presumably on N-linked glycoproteins (35). The fact that infectivity was observed only by reversion to the wild type at position 2161 suggests that substitutions at other BeAn residues (in the VP2 puff B location) are unable to contact sialic acid and restore viral binding.

TMEV has been shown to hemagglutinate type O human erythrocytes (11), but this interaction has not been previously characterized. The prototype cardioviruses mengovirus and EMCV, agglutinate human erythrocytes (10), and their attachment to erythrocyte membranes has provided a useful tool for studying virus-receptor interactions. Both mengovirus and EMCV use glycophorin A, a major sialoglycoprotein on the surface of mammalian erythrocytes, for hemagglutination (2, 3). In the present study, pretreatment of erythrocytes with neuraminidase demonstrated that sialic acid is required for BeAn virus hemagglutination. Moreover, incubation of glycophorin A but not neuraminidase-treated glycophorin with BeAn virus inhibited hemagglutination. These results indicate that BeAn virus uses sialoglycophorin A for hemagglutination, providing a useful measure of sialic acid binding by parental and mutant BeAn viruses. Unlike mutations at Q2161, those at G2174 did not completely inhibit hemagglutination; nonetheless, hemagglutination titers were dramatically reduced, indicating reduced sialic acid binding compared to that of the parental virus. Although the G2174W mutant showed greater binding to BHK-21 cells than did the G2174F mutant, the hemagglutination titers were similar.

The atomic structures of the mengovirus and Theiler's virions are remarkably similar (24, 26), but the structural sites on the virion for hemagglutination appear to differ. Our present results indicate that two residues, Q2161 and G2174, and possibly a third, A2163, on VP2 puff B are used by the low-neurovirulence TMEV for hemagglutination. In contrast, acridine mutagenesis of mengovirus led to the isolation of two hemagglutination-defective mutants with changes in residues 1231 and 1232 (27). These mengovirus residues are part of the VP1 H-I loop at the icosahedral fivefold axis, whereas the TMEV hemagglutination site on VP2 puff B is closer to the threefold axis and the pit. The proximity of the low-neurovirulence TMEV sialic acid-binding site to the pit raises the possibility that a sialylated receptor protein analogous to that of sialoglycophorin A is engaged for entry into mammalian cells.

Sialic acid binding is a neurovirulence factor.

Several studies have related sialic acid binding to the virulence of animal virus infections (6, 7, 19, 27). Since our BeAn mutants were not infectious and a BeAn revertant with other than a sialic acid binding phenotype was not obtained, infection of mice with the mutant viruses seemed unlikely to be informative. However, in a separate study, a low-neurovirulence TMEV similar to BeAn (VL virus), was adapted to Lec-2 cells which lack cell surface sialic acid; this sialic acid-deficient virus was markedly attenuated after i.c. inoculation in mice (A. S. M. Kumar, H. Reddi, A. Kung, and H. L. Lipton, unpublished data). Recently, Jnaoui et al. (16) reported that a DA recombinant virus (OT11) with two mutations in the VP1 CD loop II (G1099S and G1100D) (and apparently unable to bind sialic acid) had a reduced ability to persist in the CNS of mice, thus linking persistence to this phenotype. VP1 loop II interacts with VP2 puff B on the surface of the Theiler's virion; hence, mutations in VP1 loop II residues may influence the VP2 puff B conformation and the sialic acid contact sites. Since Jnaoui et al. (16) tested only sialic acid binding in the virus (KJ27) providing the VP1 sequences for DA recombinant OT11, the correlation of sialic acid binding to TMEV persistence needs to be confirmed.

Moreover, two hemagglutination-negative, avirulent mutants of mengovirus selected by chemical mutagenesis reverted to hemagglutination positive, with the partial restoration of neurovirulence when inoculated i.c. into mice, indicating an association between sialic binding and neurovirulence for another cardiovirus (4, 5, 27). Krempl and colleagues (18) reported that sialic acid binding activity contributes to the enterotropism (and pathogenicity) of transmissible gastroenteritis virus, a coronavirus that causes fatal diarrhea in piglets; point mutations or deletions within residues 145 to 155 of the viral S protein, the site of hemagglutinin activity, lead to reduced enteropathogenicity (19). Those authors speculated that sialic acid binding activity might increase the stability of the virions in the alimentary tract by binding to sialoglycoconjugates. Finally, Barton et al. (6) demonstrated that T3 sialic acid-binding reoviruses preferentially target bile duct epithelium, resulting in biliary disease. In all of these instances, the ability of a virus to bind sialic acid was associated with increased virulence and/or targeting to a specific tissue. Because our results indicate that sialic acid-binding residues are essential for the viability of a low-neurovirulence TMEV and the sialic acid binding phenotype appears to be important in TMEV CNS persistence, further molecular and animal studies will be required to fully understand this aspect of TMEV pathogenesis.

Acknowledgments

We thank Mark Trottier for helpful discussions and Aisha Kung and Brian P. Schlitt for technical assistance.

This work was supported by NIH grant NS21913.

REFERENCES

  • 1.Adami, C., A. E. Pritchard, T. Knauf, M. Luo, and H. L. Lipton. 1997. Mapping a determinant for central nervous system persistence in the capsid of Theiler's murine encephalomyelitis virus (TMEV) with recombinant viruses. J. Virol. 71:1662-1665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Allaway, G. P., and A. T. H. Burness. 1986. Site of attachment of encephalomyocarditis virus on human erythrocytes. J. Virol. 59:768-770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Allaway, G. P., and A. T. H. Burness. 1987. Analysis of the bond between encephalomyocarditis virus and its human erythrocyte receptor by affinity chromatography on virus-sepharose columns. J. Gen. Virol. 68:1849-1856. [DOI] [PubMed] [Google Scholar]
  • 4.Anderson, K., and C. W. Bond. 1987. Biological properties of mengovirus: characterization of avirulent, hemagglutination-defective mutants. Arch. Virol. 93:31-49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Anderson, K., and C. W. Bond. 1987. Structural and physiological properties of mengovirus: avirulent, hemagglutination-defective mutants express altered alpha (1D) proteins and are absorption-defective. Arch. Virol. 93:13-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Barton, E. S., D. H. Ebert, J. C. Forrest, J. L. Connolly, T. Valyi-Nagy, J. D. Wetzel, and T. S. Dermody. Utilization of sialic acid as a co-receptor targets reovirus replication to bile duct epithelial cells. J. Clin. Investig. in press.
  • 7.Bauer, P. H., C. Cui, T. Stehle, S. C. Harrison, J. A. DeCaprio, and T. L. Benjamin. 1999. Discrimination between sialic acid-containing receptors and pseudoreceptors regulates polyomavirus spread in the mouse. J. Virol. 73:5826-5832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Calenoff, M. A., K. S. Faaberg, and H. L. Lipton. 1990. Genomic regions of neurovirulence and attenuation in Theiler's murine encephalomyelitis. Proc. Natl. Acad. Sci. USA 87:978-982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Clarke, P., T. Beer, R. Cohrs, and D. H. Gilden. 1995. Configuration of latent varicella-zoster virus DNA. J. Virol. 69:8151-8154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ellem, K. A. O., and J. S. Colter. 1961. The isolation of three variants of mengovirus differing in plaque morphology and hemagglutination characteristics. Virology 190:340-347. [DOI] [PubMed] [Google Scholar]
  • 11.Fastier, L. B. 1951. Factors involved in haemagglutination by the GDVII strain of murine encephalomyelitis virus. J. Immunol. 66:365-378. [PubMed] [Google Scholar]
  • 12.Fotiadis, C., D. R. Kilpatrick, and H. L. Lipton. 1991. Comparison of the binding characteristics to BHK-21 cells of viruses representing the two Theiler's virus neurovirulence groups. Virology 182:365-370. [DOI] [PubMed] [Google Scholar]
  • 13.Hertzler, S., M. Luo, and H. L. Lipton. 2000. Mutation of predicted virion pit residues alters binding of Theiler's murine encephalomyelitis virus to BHK-21 cells. J. Virol. 74:1994-2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hogle, J. M., M. Chow, and D. J. Filman. 1985. Three-dimensional structure of poliovirus at 2.9 Å resolution. Science 229:1358-1365. [DOI] [PubMed] [Google Scholar]
  • 15.Jelachich, M. L., P. Bandyopadhyay, K. Blum, and H. L. Lipton. 1995. Theiler's virus growth in murine macrophage cell lines depends on the state of differentiation. Virology 209:437-444. [DOI] [PubMed] [Google Scholar]
  • 16.Jnaoui, K., M. Minet, and T. Michiels. 2002. Mutations that affect the tropism of DA and GDVII strains of Theiler's virus in vitro influence sialic acid binding and pathogenesis. J. Virol. 76:8138-8147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kilpatrick, D. R., and H. L. Lipton. 1991. Predominant binding of Theiler's viruses to a 34-kilodalton receptor protein on susceptible cell lines. J. Virol. 65:5244-5249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Krempl, C., M.-L. Ballesteros, G. Zimmer, L. Enjuanes, H.-D. Klenk, and G. Herrler. 2000. Characterization of the sialic acid binding activity of transmissible gastroenteritis coronavirus by analysis of haemagglutination-deficient mutants. J. Gen. Virol. 81:489-496. [DOI] [PubMed] [Google Scholar]
  • 19.Krempl, C., B. Schultze, H. Laude, and G. Herrler. 1997. Point mutations in the S protein connect the sialic acid binding activity with the enteropathogenicity of transmissible gastroenteritis coronavirus. J. Virol. 71:3285-3287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382. [DOI] [PubMed] [Google Scholar]
  • 21.Lehrich, J. R., B. G. W. Arnason, and F. H. Hochberg. 1976. Demyelinating myelopathy in mice induced by the DA virus. J. Neurol. Sci. 29:149-160. [DOI] [PubMed] [Google Scholar]
  • 22.Lipton, H. L. 1975. Theiler's virus infection in mice: An unusual biphasic disease process leading to demyelination. Infect. Immun. 11:1147-1155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lipton, H. L., A. E. Pritchard, P. K. Bandyopadhyay, and M. A. Calenoff. 1998. Theiler's murine encephalomyelitis virus (TMEV) strain GDVII strain does not contain a determinant for central nervous system persistence. J. Gen. Virol. 79:1001-1004. [DOI] [PubMed] [Google Scholar]
  • 24.Luo, M., C. He, K. S. Toth, C. X. Zhang, and H. L. Lipton. 1992. Three-dimensional structure of Theiler's murine encephalomyelitis virus (BeAn strain). Proc. Natl. Acad. Sci. USA 89:2409-2413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Luo, M., K. S. Toth, L. Zhou, A. Pritchard, and H. L. Lipton. 1995. The structure of a highly virulent Theiler's murine encephalomyelitis virus (GDVII) and implications for determinants of viral persistence. Virology 220:246-250. [DOI] [PubMed] [Google Scholar]
  • 26.Luo, M., G. Vriend, G. Kamer, I. Minor, E. Arnold, M. G. Rossmann, U. Boege, D. G. Scraba, G. M. Duke, and A. C. Palmenberg. 1987. The atomic structure of Mengo virus at 3.0 Å resolution. Science 235:182-191. [DOI] [PubMed] [Google Scholar]
  • 27.Mann, L. M., K. Anderson, M. Luo, and C. W. Bond. 1992. Molecular and structural basis of hemagglutination in Mengovirus. Virology 190:337-345. [DOI] [PubMed] [Google Scholar]
  • 28.McAllister, A., F. Tangy, C. Aubert, and M. Brahic. 1990. Genetic mapping of the ability of Theiler's virus to persist and demyelinate. J. Virol. 64:4252-4257. (Erratum, 67:2427.) [DOI] [PMC free article] [PubMed]
  • 29.Pevear, D. C., J. Borkowski, M. Calenoff, C. K. Oh, B. Ostrowski, and H. L. Lipton. 1988. Insights into Theiler's virus neurovirulence based on a genomic comparison of the neurovirulent GDVII and less virulent BeAn strains. Virology 165:1-12. [DOI] [PubMed] [Google Scholar]
  • 30.Pevear, D. C., M. Calenoff, E. Rozhon, and H. L. Lipton. 1987. Analysis of the complete nucleotide sequence of the picornavirus Theiler's murine encephalomyelitis virus indicates that it is closely related to cardioviruses. J. Virol. 61:1507-1516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Pilipenko, E. V., E. G. Viktorova, E. V. Khitrina, S. V. Maslova, N. Jarousse, M. Brahic, and V. I. Agol. 1999. Distinct attenuation phenotypes caused by mutations in the translational starting window of Theiler's murine encephalomyelitis virus. J. Virol. 73:3190-3196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Reddi, H. V., and H. L. Lipton. 2002. Heparan sulfate mediates infection of high-neurovirulence Theiler's viruses. J. Virol. 76:8400-8408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Roos, R. P., W.-P. Kong, and B. L. Semler. 1989. Polyprotein processing of Theiler's murine encephalomyelitis virus. J. Virol. 63:5344-5353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rossmann, M. G., E. Arnold, J. W. Erickson, E. A. Frankenberger, J. P. Griffith, H.-J. Hecht, J. E. Johnson, G. Kamer, M. Luo, A. G. Mosser, R. R. Rueckert, B. Sherry, and G. Vriend. 1985. Structure of a human common cold virus and functional relationship to other picornaviruses. Nature 317:145-153. [DOI] [PubMed] [Google Scholar]
  • 35.Shah, A. H., and H. L. Lipton. 2002.. Low-neurovirulence Theiler's viruses use sialic acid moieties on N-linked oligosaccharide structures for attachment. Virology 304:443-450. [DOI] [PubMed]
  • 36.Trottier, M., B. P. Schlitt, and H. L. Lipton. 2002. Enhanced detection of Theiler's virus RNA copy equivalents in the mouse central nervous system by real-time RT-PCR. J. Virol. Methods 103:89-99. [DOI] [PubMed] [Google Scholar]
  • 37.Zhou, L., X. Lin, T. J. Green, H. L. Lipton, and M. Luo. 1997. Role of sialyloligosaccharide binding in Theiler's virus persistence. J. Virol. 71:9701-9712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zhou, L., Y. Luo, Y. Wu, J. Tsao, and M. Luo. 2000. Sialylation of the host receptor may modulate entry of demyelinating persistent Theiler's virus. J. Virol. 74:1477-1485. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES