Abstract
Recent transposon mutagenesis studies with two enterohemorrhagic Escherichia coli (EHEC) strains, a sero- type O26:H- strain and a serotype O157:H7 strain, led to identification of a putative fimbrial operon that promotes colonization of young calves (1 to 2 weeks old). The distribution of the gene encoding the major fimbrial subunit present in O-island 61 of EHEC O157:H7 in a characterized set of 78 diarrheagenic E. coli strains was determined, and this gene was found in 87.2% of the strains and is therefore not an EHEC-specific region. The cluster was amplified by long-range PCR and cloned into the inducible expression vector pBAD18. Induced expression in E. coli K-12 led to production of fimbriae, as demonstrated by transmission electron microscopy and sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis. The fimbriae were purified, and sera to the purified major subunit were raised and used to demonstrate expression from wild-type E. coli O157:H7 strains. Induced expression of the fimbriae, designated F9 fimbriae, was used to characterize binding to bovine epithelial cells, bovine gastrointestinal tissue explants, and extracellular matrix components. The fimbriae promoted increases in the levels of E. coli K-12 binding only to bovine epithelial cells. In contrast, induced expression of F9 fimbriae in E. coli O157:H7 significantly reduced adherence of the bacteria to bovine gastrointestinal explant tissue. This may have been due to physical hindrance of type III secretion-dependent attachment. The main F9 subunit gene was deleted in E. coli O157:H7, and the resulting mutant was compared with the wild-type strain for colonization in weaned cattle. While the shedding levels of the mutant were reduced, the animals were still colonized at the terminal rectum, indicating that the adhesin is not responsible for the rectal tropism observed but may contribute to colonization at other sites, as demonstrated previously with very young animals.
Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 causes gastrointestinal disease in humans that can be life threatening as a consequence of Shiga toxin activity on kidney and brain vasculature. Ruminants, particularly cattle, are the primary reservoir hosts for this organism (1, 3). Cattle are colonized without any overt symptoms and can shed EHEC O157:H7 in their feces for several weeks at levels up to 106 cells per g. Recent work has demonstrated that the predominant colonization site in cattle for E. coli O157:H7 is the final few centimeters of the terminal rectum, a site having a high density of lymphoid follicles and lymphoid-associated mucosa (19, 21, 30). A key aim of our research is to identify bacterial factors that drive this tropism for the terminal rectum.
Considerable attention has been focused on type III secretion that leads to intimate attachment, and this has been shown to be important for ruminant colonization in a number of studies (5, 7, 8, 22, 44). For example, in a recent signature-tagged mutagenesis (STM) screening for genes that promote E. coli O157:H7 colonization in young calves, the workers obtained multiple transposon inserts in the locus of enterocyte effacement, which contains the majority of the type III secretion apparatus genes, as well as the genes encoding the translocated intimin receptor and intimin, which are required for intimate attachment (11). Type III secretion is therefore central to ruminant colonization. However, bacterial tissue affinity is often a result of fimbrial adhesins that promote initial attachment, and examples of such adhesins in E. coli are P, S, F4 (K88), F5 (K99), 987P, and type 1 fimbriae. In the STM study mentioned above (11) the workers obtained an insert in Z2203 that exhibits homology with the usher gene in fimbrial operons, such as the operon encoding type 1 fimbriae. This gene is in a cluster that contains genes with homology to genes encoding the classic chaperone/usher class fimbrial adhesins and does not appear to contain pseudogenes, so it should encode functional fimbriae. Deletion of the putative main subunit gene produced a strain that was less competitive for colonization of very young calves (11), although such animals do not exhibit the terminal rectal tropism apparent in older weaned animals. The same putative fimbrial operon was also identified as a relevant operon for colonization in an STM screening of enterohemorrhagic E. coli O26:H- in cattle (43). Interestingly, the same study established that failure to down-regulate type 1 fimbria expression in E. coli O26 is also a disadvantage for colonization.
Based on an analysis of the previously published sequences (14, 25), E. coli O157:H7 contains at least 16 putative fimbrial operons, and expression screening of these operons showed that the operon containing Z2203 in EHEC O157:H7 O-island 61 (OI61) is one of only four operons that show some expression under in vitro conditions (19a). Furthermore, O-island 61 is one of five regions in the chromosome of EHEC O157:H7 strain EDL933 encoding putative fimbrial proteins that were described as EHEC-specific fimbria loci (25). A modified version of the cluster is also present in the sequenced uropathogenic E. coli isolate CFT073 (45), and a truncated version is present in E. coli K-12 strain MG1655 (11). Very little is known about the other putative fimbrial clusters in E. coli O157:H7, with the exception of the clusters encoding long polar fimbriae (LPF1 and LPF2), type 1 fimbriae, and curli (4, 10, 18, 28, 38, 39, 42). Type 1 fimbriae cannot be expressed by E. coli O157:H7 because of a deletion in the fim regulatory region (28). Even if these fimbriae are expressed, the sequenced isolates contain a mutation in FimH that eliminates mannose binding (16). The LPF1 and LPF2 clusters have mutations in the usher and chaperone genes, respectively, although at least the LPF1 cluster still appears to be able to produce fimbriae and may contribute to colonization in vivo (38, 39). Curli expression is variable in EHEC O157:H7 isolates.
In addition to type III secretion-related adherence and fimbrial adhesins, E. coli O157:H7 has a number of other factors that promote adherence, at least adherence in vitro to cell lines. These factors include OmpA, Iha, Cah, ToxB, and a truncated version of Efa1 (Efa1′) (23, 35-37, 40, 41). ToxB and Efa1′ play no apparent role in colonization of young calves by E. coli O157:H7, and it is not clear whether they act as adhesins per se or influence in vitro adherence via effects on type III secretion (35, 37). The roles of other putative EHEC adhesins in colonization of cattle have not been determined.
The aims of the current study were to learn more about the distribution of O-island 61 and other O-island putative fimbrial gene clusters in E. coli, to determine whether the O-island 61 operon (Z2200 to Z2206) from E. coli O157:H7 can produce functional fimbriae, to investigate different potential binding substrates, and to establish whether expression of the cluster drives the EHEC O157:H7 tropism for the terminal rectum of cattle.
MATERIALS AND METHODS
Media and bacterial strains.
The three Shiga toxin-negative E. coli O157:H7 strains used in this research are E. coli EDL933 stx (= TUV933-0) (9), ZAP198 (= Walla 3) (24), and NCTC12900. The E. coli K-12 derivative AAEC185 (2) was used for the majority of the cloning work and to study induced expression of F9. AAEC185 is an E. coli K-12 ΔrecA Δfim strain that does not express fimbriae (2) and that has been used for expression of foreign fimbrial genes (12). The well-characterized reference collection of diarrheagenic E. coli (DEC) strains (46) was used as indicated below. Bacteria were cultured either in minimal essential medium with HEPES modification, in M9 minimal medium (with 0.4% glycerol as a carbon source), or in Luria-Bertani (LB) broth. Agar (4%) was added to make appropriate plates. Ampicillin at a concentration of 25 μg/ml was used for maintenance of the pBAD18 derivative plasmids, and chloramphenicol at a concentration of 25 μg/ml was used for maintenance of pACYC184 derivatives. For arabinose induction 0.2% (wt/vol) arabinose was added to M9 or LB media.
Detection of putative major fimbria subunit genes encoded on O islands.
The DEC strains (46) were screened for five genes, representing the major fimbrial subunits of five putative EHEC-specific O islands, by PCR and hybridization. The DEC strains were obtained from the STEC Center at Michigan State University (46) and were selected because they included strains representing common clones of enteropathogenic E. coli and EHEC in which the evolution of virulence and pathogenic mechanisms has been established previously (27). The genes encoding two of the major fimbrial subunits, lpfA1 and lpfA2, were analyzed previously by Torres et al. (39). Recombinant Taq polymerase and a PCR buffer from Gibco-BRL-Invitrogen were employed with 1 U of Taq polymerase, 2 mM MgCl2, and 1 μM oligonucleotide primer in each reaction mixture. All amplifications were performed for 30 cycles of 94°C for 45 s, 45°C for 1 min, and 72°C for 2 min. PCRs were performed with boiled bacterial colonies. To amplify the genes encoding the corresponding major fimbria subunits, the following primer pairs (forward and reverse primers, respectively) were used: for OI141 lpfA1, 5′-GGTCGTTTTTGCCTTAACCGC-3′ and 5′-AGGTTGAAATCGACCTGCGC-3′; for OI154 lpfA2, 5′-TTATGGCAGGTCACCTACAGGC-3′ and 5′-TCAACTGTAAACTGCGAGTCGG-3′; for OI47 Z1534, 5′-CAAAAAAGCAGCTCTGCTGGC-3′ and 5′-CGACAGCGGTAATTTTACCGGC-3′; for OI61 Z2200, 5′-GATTGTCGTTTCTGTGTTGGCG-3′ and 5′-TGAAGGTCGCATCTGCGTTTG-3′; and for OI127 Z4498, 5′-ACAGCTATTGCGGGCTTACTTG-3′ and 5′-TTAACGACAGCGTCTGCTTCCC-3′. Colony hybridization with digoxigenin (DIG)-labeled probes was performed to validate the PCR results. Fragment probes that were generated by PCR using EHEC O157 strain EDL933 as the template and the primer pairs listed above were used to screen colony blots of all DEC isolates, using 82-mm nylon membranes (Roche Applied Science, Indianapolis, IN). Membranes were denatured in 0.5 M NaOH-1.5 M NaCl, neutralized in 1.5 M NaCl-0.5 M Tris-HCl-1 mM EDTA, dried, and fixed by UV exposure. All probes were purified by gel extraction and DIG labeled by using a commercially available DIG DNA labeling and detection kit (Roche Applied Science) and the manufacturer's instructions. Following 2 h of prehybridization at 42°C, the membranes were hybridized with a denatured probe at 42°C with continuous, gentle agitation in a hybridization solution containing 50% formamide, 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5% blocking reagent, 0.1% N-lauryl sarcosine, and 0.02% sodium dodecyl sulfate (SDS). The membranes were washed three times in 2× SSC-0.1% SDS and then three times in 0.1× SSC-0.1% SDS at 65°C (high stringency) or 55°C (low stringency). Signals were detected by using a DIG nucleic acid detection kit (Roche) in accordance with the manufacturer's instructions.
Cloning of F9 fimbrial operon.
To determine if the O-island 61 cluster was able to express fimbriae, the cluster was amplified by long-range PCR (Roche) in two sections, and the sections were then cloned and combined in pBAD18 (13), an arabinose-inducible vector, to create pASL04. The first section was amplified using primers 5′CCGAGCTCCTTAATTGTTAACTCTCTTTATTCAGC (SacI restriction site underlined) and 5′CTGTTCCACCCGGGCCTTTTACTATTG (XmaI restriction site underlined) and cloned using the SacI and XmaI restriction sites. The second section was amplified using primers 5′CAATAGTAAAAGGCCCGGGTGGAACAG (XmaI restriction site underlined) and 5′GCTAGTCTAGAGATTTTCTTACAAGTGTAGGATAATAG (XbaI restriction site underlined) and cloned using the XmaI and XbaI restriction sites.
Construction and measurement of an F9 translational fusion to eGFP.
The putative promoter region of Z2200 was amplified by PCR from E. coli O157:H7 strain Walla 3 using primers 5′CGAGGATCCGCCATATAAACCATTAGTAGCC (BamHI restriction site underlined) and 5′GCCGGTACCATGTTTGAGTTTCATAATTCTCC (KpnI restriction site underlined) and cloned into pAJR70 (29), which contains the enhanced green fluorescent protein (eGFP) gene, using the BamHI and KpnI restriction sites. This created a translational fusion to the start of the Z2200 open reading frame. This plasmid was transformed into E. coli O157:H7 strain Walla 3, and fluorescence levels were measured by analyzing 100-μl aliquots of cultures using a fluorescent plate reader (Fluorostar Optima; BMG) during growth of the bacteria in LB medium at 28, 34, and 37°C.
Electron microscopy.
To visualize fimbrial structures on the bacterial cell surface, E. coli K-12 containing either pBAD18 or pASL04 was induced for 2 h with 0.2% (wt/vol) arabinose in M9 medium with glycerol. A drop of bacterial suspension was placed onto a carbon-Formvar-coated electron microscope grid and left for 2 min. The suspension was removed with filter paper, and 20 μl of gluteraldehyde fixative (4%) was placed on the slide and left for 2 min. The fixative was then removed, and the slide was allowed to air dry before negative staining was carried out. The bacteria adsorbed to carbon-Formvar-coated electron microscope grids were negatively stained with either 2% aqueous phosphotungstic acid (pH 6.8) or 2% aqueous ammonium molybdate. The grids were transferred to a Philips CM120 Biotwin microscope for examination and subsequent photography. Kodak SO163 TEM film was used and processed according to the manufacturer's recommendations. The negatives were scanned with an Epson Perfection 4870 scanner.
Method for preparation of F9 fimbriae.
The method used for purification of fimbriae was adapted from the method of Korhonen et al. (17). Briefly, bacteria (strain AAEC185 containing pASL04) were grown in LB broth (180 rpm, 37°C) under inducing conditions (0.2% [wt/vol] arabinose). The cells were harvested by centrifugation (6,000 × g, 4°C, 15 min) and suspended in cold Tris buffer (10 mM Tris-HCl, pH 7.5). The fimbriae were detached from the cells by heating the suspension at 60°C with magnetic stirring for 1 h. After centrifugation (4,000 × g, 4°C, 15 min) crystalline ammonium sulfate was added to the supernatant to 50% saturation, and the suspension was stirred overnight at 4°C. The precipitate was collected by centrifugation (10,000 × g, 4°C, 1 h), suspended in Tris buffer, and dialyzed (100,000-molecular-weight cutoff dialysis tubing [Medicell International Ltd., London, United Kingdom]) for 48 h against Tris buffer with several changes of the buffer. After dialysis, sodium deoxycholate was added to the suspension to a final concentration of 0.5% (wt/vol), and the suspension was dialyzed against DOC buffer (Tris buffer containing 0.5% sodium deoxycholate) for 48 h. The suspension was centrifuged (10,000 × g, 4°C, 10 min), and the supernatant was collected. The supernatant was designated DOC-soluble material, and the pellet was designated DOC-insoluble material. According to Korhonen et al. (17), no pilus protein should remain in DOC-insoluble material, whereas most of the outer membrane proteins remained in this fraction. The DOC-soluble material was dialyzed for 48 h against Tris buffer with several changes of buffer to remove the sodium deoxycholate from the fimbrial preparations. A control preparation obtained by starting with just induced pBAD18 in E. coli K-12 was processed in an identical manner using one-half the volumes.
Western blotting.
Wild-type strains and the F9 deletion mutant were cultured overnight in 1 liter of LB medium at the relevant temperature. The fimbriae were removed as described above, except that they were precipitated with trichloroacetic acid (TCA) added to a final volume of 10% (vol/vol). The TCA precipitates were incubated overnight at 4°C, and the precipitated material was collected by centrifugation at 15,000 × g at 4°C for 30 min. The pellets were suspended in 10 mM Tris-HCl buffer (pH 7.5), and the volume depended on the optical density of the original culture. Purified fimbriae (2.36 mg/ml) were prepared for SDS-polyacrylamide gel electrophoresis (PAGE) as described below. The fimbrial samples were acid treated by adding 2 μl of 1 M HCl and 2 μl of 10% SDS to 16 μl of each fimbrial sample and boiling the preparation for 3 min to break up the fimbriae into subunits. Gel loading buffer was then added to the sample, and the preparation was neutralized with NaOH (1 M) and then boiled for a further 3 min before it was loaded onto a 12% SDS-PAGE gel, which was run under standard conditions. The proteins were transferred to a nitrocellulose membrane for Western blotting using standard procedures. The blot was blocked with milk powder (10%) in phosphate-buffered saline (PBS). The primary antibody used to identify the F9 subunit proteins is described below and was used at a 1:100 dilution in PBS. The blot was then washed three times with PBS containing Tween 20 (0.05%). A horseradish peroxidase-conjugated secondary antibody (Dako) against rabbit immunoglobulins was used as the secondary antibody at a dilution of 1:500 in PBS.
Cloning, expression, and purification of the putative major F9 fimbrial subunit, Z2200.
The Z2200 open reading frame, including initiation and stop codons, was amplified by PCR using VENT proofreading DNA polymerase and primers MFSLic-for (5′ GACGACGACAAGATGAAACTCAAACATGTTGGT 3′) and MFSLic-rev (5′ GAGGAGAAGCCCGGTTATAGATATTGAACTTTG 3′). Following treatment with T4 DNA polymerase, the PCR product was cloned by ligation-independent cloning into the pET-30 Ek/LIC bacterial expression vector (Novagen, United Kingdom) according to the manufacturer's protocol. We selected recombinants which expressed a Z2200 fusion protein with N-terminal His and S tags for detection and purification. The resulting plasmid was transformed into E. coli BL21(DE3) cells (Novagen, United Kingdom), and the strain was cultured in 50 ml LB medium containing 2% (wt/vol) d-(+)-glucose to the mid-logarithmic phase at 37°C prior to induction with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) overnight at 37°C with shaking at 200 rpm. Cells were collected by centrifugation and resuspended in 10 ml Tris-buffered saline prior to disruption by sonication. The supernatant and pellet fractions were separated by low-speed centrifugation (ca. 3,000 × g), and the insoluble (pellet) fraction was resuspended in denaturing binding buffer (8 M urea, 0.1 M sodium phosphate buffer, 0.01 M Tris-Cl; pH 8.0) and mixed with Ni-nitrilotriacetic acid His · Bind resin (Novagen, United Kingdom). The fusion protein was allowed to bind to the resin at the ambient temperature overnight with gentle rotation, and the resin was recovered by centrifugation at ca. 1,500 × g for 5 min at the ambient temperature before repeated washing (0.1 M sodium phosphate buffer, 0.01 M Tris-Cl; pH 6.3) and elution of the protein (0.1 M sodium phosphate buffer, 0.01 M Tris-Cl; pH 4.5). The purity of the protein was assessed by 4 to 15% gradient SDS-PAGE.
Construction of Z2200 insertion and nonpolar deletion mutants of E. coli O157:H7.
Replacement of the Z2200 gene with a kanamycin resistance cassette was achieved by integration of linear DNA following transient expression of bacteriophage λ Red recombinase as described by Datsenko and Wanner (6). Briefly, a kanamycin resistance cassette was amplified from plasmid pKD4 using primers MFS1P1 (5′-AATTGTTAACTCTCTTTATTCAGCTACTTAAATATAAATTTTGGAGAATTGTGTAGGCTGGAGCTGCTTC-3′) and MFS2P2 (5′-CACACACCCTGTTTTAATTTCAGATGCCGTATAGCCACCTTAATATTGAACATATGAATATCCTCCTTAG-3′). The 5′ termini of these primers comprise 50 nucleotides identical to the sequences flanking the predicted start and stop codons of the Z2200 gene, and the 3′-terminal 20 nucleotides prime from pKD4. The amplified product was concentrated on QIAGEN spin columns, digested with DpnI for 1 h at 37°C, and then purified following agarose gel electrophoresis using a QIAGEN gel purification kit. A nalidixic acid-resistant variant of E. coli O157:H7 strain Walla 3 (21) was transformed with the temperature-sensitive λ Red-encoding plasmid pKD46 with selection for ampicillin resistance at 30°C. The Z2200::Kanr PCR product was used to transform electrocompetent Walla 3 Nalr(pKD46) following induction of expression of λ Red recombinase by growth in LB medium in the presence of 10 mM l-arabinose at 30°C as described previously (6). Mutants were selected on LB agar containing nalidixic acid and kanamycin and were confirmed to carry the insertion by PCR using the Z2200 flanking primers MFS-for (5′-CTCTCTTAATTCAGCTACTT-3′) and MFS-rev (5′-TTCAGATGCCGTATAGCCAC-3′). Plasmid pKD46 was cured from the mutant by overnight growth at 37°C, and the mutant was confirmed to be ampicillin sensitive. An E. coli O157:H7 strain EDL933 Nalr Z2200::Kanr mutant recently characterized in calves harbored a mutation identical to the mutation constructed here (11).
A Z2200 nonpolar deletion mutant was selected by transient expression of FLP recombinase in strain Walla 3 Nalr Z2200::Kanr, which excised the kanamycin resistance cassette via recombination between FLP recognition target sites flanking the Kanr gene, leaving an 84-nucleotide “scar.” This was accomplished by transformation of Walla 3 Nalr Z2200::Kanr with the temperature-sensitive plasmid pFT-A (26) and transient induction of FLP using 20 μg/ml heat-inactivated chlortetracycline during logarithmic growth at 30°C as described previously (26). Bacteria were plated onto LB medium and replica plated onto media with and without kanamycin to identify recombinants. Successful excision of the cassette was confirmed by PCR with the flanking primers MFS-for and MFS-rev (see above) and sequencing of the PCR product (Lark Technologies, United Kingdom) (data not shown). Plasmid pFT-A was cured by growth at 37°C in the absence of ampicillin.
We also wanted to compare the genetic structure of the mutant with that of the parent strain approximately 10 kb proximal and distal to the site of mutation. Chromosomal DNA was isolated from both wild-type strain Walla 3NalR and mutant Walla 3NalRΔz2200. A 20-kb sequence that included the Z2200 gene was retrieved from Colibase (http://colibase.bham.ac.uk), and primers were designed to amplify approximately 10-kb regions on either side of the Z2200 gene. The proximal region of the Z2200 gene was amplified from both wild-type and mutant strains with primers Prox 5 (5′-AGTACTACCTGATGGCGCTGGAT-3′) and Prox 3 (5′-CTTGATTGGTTGTTGCCCTGAGA-3′) to generate approximately 9.9-kb fragments, using Herculase Hotstart DNA polymerase (Stratagene). Similarly, the distal region was amplified from both wild-type and mutant strains with primers Dist 5 (5′-TTAAGGTGGCTATACGGCATCTG-3′) and Dist 3 (5′-CGTGGTTGACTACTCGTTAGCA-3′) to generate an approximately 10-kb fragment. Fragments that were similar sizes were generated for both strains (data not shown). To confirm that these fragments represented similar DNA sequences, both proximal and distal amplified fragments from wild-type and mutant strains were gel purified (QIAGEN) and digested with 10 U of EcoRI for 3 h. The digests were resolved on 0.7% agarose alongside undigested DNA, and the results revealed expected numbers and sizes of fragments following EcoRI digestion (data not shown).
Generation of rabbit polyclonal antiserum against purified Z2200 protein.
Approximately 25 μg highly purified Z2200 fusion protein was resolved on an SDS-PAGE gel and eluted from a gel slice by maceration in 1 ml phosphate-buffered saline. After centrifugation at 10,500 × g to remove gel fragments, 600 μl of the protein suspension was mixed with 600 μl TiterMax Gold adjuvant (CytRx Corp., Norcross GA), and an emulsion was prepared. A 10-week-old New Zealand White rabbit was immunized subcutaneously with 250 μl of this emulsion at four different sites (ca. 13 μg protein per immunization), and the immunization was repeated twice at 3-week intervals (for a total of three immunizations). Ten days after the final immunization the blood was collected by cardiac puncture under terminal anesthesia, and serum was collected. Seroconversion and the specificity of the antiserum for Z2200 were confirmed by Western blot analysis using lysates of the Z2200 expression strain and the control BL21(DE3) parent strain (data not shown).
Immunofluoresence microscopy.
Bacteria were fixed by mixing them with an equal volume of 4% paraformaldehyde. Aliquots of fixed bacteria were air dried onto slides and incubated with the primary anti-O157 serum (1:100; MAST Diagnostics) or anti-F9 serum (1:100) (this study) in PBS-0.1% bovine serum albumin (BSA) for 60 min at room temperature. After three washes with PBS-0.1% BSA, the samples were incubated with either fluorescein isothiocyanate-conjugated (1/500; Dako), tetramethyl rhodamine isocyanate-conjugated (1/500; Dako), or Alexi Fluor 594-conjugated (1/500; Molecular Probes) anti-rabbit immunoglobulin secondary antibody for 30 min, and the slide was washed three times with PBS-0.1% BSA or PBS—0.1% Tween 20. The slide was then examined by fluorescence microscopy using a Leica DMBL fluorescence microscope and appropriate filter sets. The images were captured using Leica or Improvision software.
Bacterial binding to purified substrates.
To identify a substrate for F9, a series of binding experiments were carried out using purified bovine substrates. Solutions (1 mg/ml) were prepared for the following substrates: BSA, fibrinogen, fibronectin, type 1 collagen, type III collagen, calf skin collagen, elastin, bovine skin gelatin, globulins, hyaluronic acid, bovine serum, and chondrotin sulfate A (all obtained from Sigma-Aldrich). Then 150 μl of each of these substrates was left on glass slides overnight at 4°C to coat the slides. The suspensions were then removed and washed once with PBS-Tween 20. Bacterial cultures in M9 medium with glycerol (with selective antibiotics) were diluted 1:50 into fresh M9 medium with glycerol (with selective antibiotics) and allowed to reach an optical density at 600 nm of 0.25 before induction with 0.2% arabinose for 2 h. The optical density at 600 nm of both cultures were adjusted to 0.5 before the assays were carried out, and 150 μl was added to the substrate-coated slides. The binding reaction was allowed to take place at 37°C for 1 h. The slides were then prepared for immunofluorescence microscopy as described above.
Epithelial cell binding assays.
Epithelial bovine lung (EBL) cells were seeded into eight-chamber microscope slides (Becton and Dickinson) at a density of 1 × 105 cells/chamber and were incubated at 37°C in 5% CO2 for 24 to 48 h prior to binding assays. For some assays the E. coli strains were also transformed with the rpsM::GFP+ fusion plasmid pAJR145 (29) to simplify quantification of adherent bacteria. In other assays the bacteria were imaged by anti-O157 lipopolysaccharide staining as described above for the substrate binding assays. Induced and control cultures were prepared as described above for the substrate binding assays. The culture growth medium (minimal essential medium) was removed from the EBL cells, and bacteria were added to the appropriate well of each multichamber slide (300 μl per chamber). The bacteria were centrifuged onto the cells at 2,000 rpm for 5 min. The cells were then incubated at 37°C in the presence of 5% CO2 for 2 h. The bacterial suspension was then removed, and the wells were gently washed three times with PBS before addition of 4% paraformaldehyde to fix the cells. The slides were then viewed with the microscope using the appropriate filter, and the numbers of bacteria attached to cells were recorded.
Binding assays were also carried out with primary cultures derived from bovine terminal rectal epithelium. The primary cultures were prepared as described by Mahajan et al. (20) and then treated and quantified as described above for the EBL cell assay.
Tissue explant binding assays.
The in vitro organ culture conditions were essentially those described previously (22). Prior to the experiment the conditions were optimized for use with bovine tissue explants. Briefly, prewarmed IVOC culture medium (45% [vol/vol] Dulbecco modified Eagle medium [Sigma Aldrich], 45% [vol/vol] NCTC-135 medium [Sigma Aldrich], 10% [vol/vol] newborn calf serum [Sigma Aldrich]) was added until the fluid surface was in contact with the tissue edge. The standard 50 μl of bacterial culture in the mid-logarithmic growth phase was added to each explant, and the samples were incubated at 37°C in an atmosphere containing 95% (vol/vol) O2 and 5% (vol/vol) CO2 for 8 h. The culture medium was changed every 2 to 3 h. At the end of the culture period the samples were washed once in fresh culture medium and fixed in 4% (wt/vol) paraformaldehyde in PBS. E. coli O157 was visualized by immunostaining as described above for substrate binding.
Animals and experimental challenge.
Experimental calf challenge with the F9 mutant strain of E. coli O157:H7 strain Walla 3 was performed at the Moredun Research Institute (MRI) in containment level 3 large animal housing facilities under Home Office license number 60/3179. Ethical approval was obtained from the MRI Animal Experiments Committee. Calves were reared conventionally on the farm of origin until at least 2 weeks after weaning and transported to MRI, where they were acclimatized for 1 week prior to challenge. Fecal samples obtained from each calf prior to challenge were confirmed to be negative for E. coli O157:H7 by immunomagnetic separation, performed according to the manufacturer's instructions (Dynal). At the time of challenge the age of each of the calves was 21 ± 2 weeks. The challenge bacterial strain was grown in LB broth (18 h at 37°C, with aeration) and diluted in sterile PBS to obtain an inoculum containing 109 CFU in 20 ml (total volume) for each animal. The inoculum was administered to the calves via a stomach tube and was washed down with 500 ml sterile PBS (21). For enumeration of bacteria in feces, samples were separated into surface and core components as described previously (21). Ten-gram portions of feces were suspended in 90 ml sterile PBS and serially diluted in 10-fold steps in PBS. The serial dilutions were cultured as 100-μl aliquots spread in triplicate onto sorbitol MacConkey agar plates containing 15 μg/ml nalidixic acid (Oxoid). All inoculated media were incubated overnight at 37°C. Non-sorbitol-fermenting colonies were counted, and a colony from each sample was tested for O157 lipopolysaccharide using a latex agglutination test kit (Oxoid). The most probable number of recovered bacteria was determined as described previously (21). Enrichment cultures of samples that were negative as determined by direct culturing were established from 1 ml of an undiluted fecal suspension added to 9 ml of LB medium containing 15 μg ml−1 nalidixic acid. Following incubation at 37°C for 24 h, 100-μl portions of the enrichment cultures were spread onto sorbitol MacConkey agar plates containing 15 μg/ml nalidixic acid and incubated overnight at 37°C. Strains were compared to E. coli O157:H7 parent strain Walla 3 by using data obtained from 19 different calves challenged and sampled in containment level 2 animal housing as described above.
To compare the numbers of surface CFU/g for calves orally inoculated with the F9 deletion mutant and the numbers of surface CFU/g for calves orally inoculated with the wild-type strain, a repeated-measures model was fitted in Genstat, 8th ed. The correlation between observations made with the same calf was modeled using a power metric. A log(x + 1) transformation was used in the analysis. For comparisons of the numbers of CFU/g in core and surface fecal samples (which provided an indication of terminal rectal colonization), differences were calculated on a log(x + 1) scale.
RESULTS
Screening for the EHEC O-island putative fimbrial clusters in a collection of DEC strains.
We determined the presence of the gene encoding the putative major fimbrial subunit found in F9, as well as the presence of the genes encoding four other major fimbrial subunits located in EHEC O157:H7 O islands (O islands are EHEC-specific regions, as described by Perna et al. [25]), in a collection of phylogenetically well-characterized DEC strains (46). The five O islands included OI141, containing genes for long polar fimbria 1 (38); OI154, containing genes for long polar fimbria 2 (39); OI47, containing genes for a putative fimbria exhibiting 30 to 44% identity to CupA1-5 of Pseudomonas aeruginosa and Yersinia pestis; OI61, containing genes for F9, whose protein products exhibit homology with the well-characterized E. coli type 1 fimbriae (see below); and OI127, containing genes for a putative fimbria with 85 to 99% identity to a putative fimbrial locus of E. coli K-12. Of the 78 DEC strains selected, 68 (87.2%) Z2200 (F9, OI61)-positive E. coli strains were identified by colony dot blot hybridization and were confirmed by PCR (Table 1). Similarly, Z4498 (OI127) was detected in 69 (88.5%) of the strains tested, and Z1534 (OI47) was detected in 65.4% of the strains tested. In contrast, lpfA1 (OI141) and lpfA2 (OI154) were found in 34.6% and 20.5% of the strains tested, respectively, and these values are similar to the values described previously (39). Interestingly, serotype-specific distribution patterns were observed (Table 1). Our data indicate that the O islands described above are not EHEC-specific regions and that their distribution in different DECs strains is associated with the genetic rearrangements associated with evolution and the appearance of different serotypes.
TABLE 1.
DEC no.b | Serotype | OI141 lpfA1c | OI154 lpfA2c | OI47 Z1534 | OI61 Z2200 | OI127 Z4498 | DEC no.b | Serotype | OI141 lpfA1c | OI154 lpfA2c | OI47 Z1534 | OI61 Z2200 | OI127 Z4498 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1A | O55:H6 | + | − | − | + | − | 8C | O111:NM | − | − | + | + | + | |
1B | O55:H6 | + | − | − | + | − | 8D | O111:H11 | − | − | + | + | + | |
1C | O55:H6 | + | − | − | + | − | 8E | O111:H8 | − | − | + | + | + | |
F563-55 | O55:H6 | + | − | − | − | − | 9A | O26:H11 | − | − | + | + | + | |
1E | O55:H6 | + | − | − | + | + | 9B | O26:N | − | − | + | + | + | |
2A | O55:H6 | + | − | − | + | + | C240-52 | O26:N | − | − | + | + | + | |
2B | O55:NM | + | − | − | + | + | 9D | O26:H11 | − | − | + | + | + | |
2C | O55:H6 | + | − | + | + | − | 45 | O26:H11 | − | − | + | + | + | |
2D | O55:H6 | + | − | − | + | − | H30 | O26:H11 | − | − | + | + | + | |
2E | O55:H6 | + | − | − | + | − | 10B | O26:H11 | − | − | + | + | + | |
3A | O157:H7 | + | + | + | + | + | 10C | O26:H11 | − | − | + | + | + | |
3B | O157:H7 | + | + | + | + | + | C12-52 | O26:H11 | − | − | + | + | + | |
3C | O157:H7 | + | − | + | + | + | 10E | O26:H11 | − | − | + | + | + | |
3D | O157:H7 | + | + | + | + | + | RDEC-1 | O15:NM | − | − | + | − | + | |
3E | O157:H7 | + | + | + | + | + | 11A | O128a:H2 | − | − | + | + | + | |
493/89 | O157:H− | + | + | + | + | + | 11B | O128a:H2 | − | − | + | + | + | |
4A | O157:H7 | + | + | + | + | + | 11C | O45:H2 | − | − | + | + | + | |
4B | O157:H7 | + | + | + | + | + | 11D | O128:H2 | − | − | + | + | + | |
4C | O157:H7 | + | + | + | + | + | 11E | O128:H2 | − | − | + | + | + | |
4D | O157:H7 | + | + | + | + | + | 12A | O111:H2 | − | − | + | + | + | |
4E | O157:H7 | + | + | + | + | + | 12B | O111:H2 | − | − | + | + | + | |
EDL933 | O157:H7 | + | + | + | + | + | 12C | O111:NM | − | − | + | + | + | |
5A | O55:H7 | + | + | + | + | + | 12D | O111:H2 | − | − | − | − | + | |
5B | O55:H7 | + | + | + | + | − | 12E | O111:N | − | − | − | − | + | |
5C | O55:H7 | + | + | + | + | + | 13A | O128:H7 | − | − | − | + | + | |
5D | O55:H7 | + | + | + | + | + | 13B | O128:H7 | − | − | − | + | + | |
5E | O55:H7 | + | + | + | − | + | 13C | O128:H7 | − | − | − | + | + | |
6A | O111:H21 | − | − | + | − | + | 13D | O128:H7 | − | − | − | + | + | |
C142-54 | O111:H12 | − | − | + | − | + | 13E | O128:H47 | − | − | − | + | + | |
6C | O111:H12 | − | − | − | − | − | 14A | O128:H21 | − | − | − | + | + | |
F436-51 | O111:H12 | − | − | + | − | + | 14B | O128:H21 | − | − | − | + | + | |
6E | O111:NM | − | − | + | − | + | 14C | O128a:H21 | − | − | − | + | + | |
7A | O157:H43 | − | − | + | + | + | 14D | O128:NM | − | − | − | + | + | |
7B | O149:NM | − | − | + | + | + | 14E | O128:H21 | − | − | − | + | + | |
7C | O157:H43 | − | − | + | + | + | 15A | O111:H21 | − | − | − | + | + | |
7D | O157:H43 | − | − | + | + | + | 15B | O111:H21 | − | − | − | + | + | |
7E | O157:NM | − | − | + | + | + | 15C | O111:H21 | − | − | − | + | + | |
8A | O111a:NM | − | − | + | + | + | 15D | O111:H21 | − | − | − | + | + | |
8B | O111:H8 | − | − | + | + | + | 15E | O111:H21 | − | − | − | + | + |
The presence of the major fimbrial subunit gene of each O island was confirmed by PCR and colony blot hybridization as described in Materials and Methods.
DEC classification data were derived from the study of Whittam et al. (46).
The distribution of the lpfA1 and lpfA2 genes is based on data from the study of Torres et al. (39), and the data indicate the distribution of these genes in individual strains.
F9 fimbrial cluster.
Figure 1 shows an alignment of the F9 cluster in E. coli O157:H7 with the F9 cluster in E. coli K-12 strain MG1655. It is clear from this alignment that the main fimbrial subunit gene, the chaperone, and one-half of the usher gene are deleted in E. coli K-12. Based on this sequence information, an E. coli K-12 Δfim strain is therefore a logical strain in which to express the cloned cluster from E. coli O157:H7. The F9 cluster is most closely related to the F1 (type 1) fimbria cluster of E. coli and other Enterobacteriaceae. The putative F9 proteins exhibit the following levels of amino acid identity and similarity with the type 1 fimbrial proteins of E. coli K-12 strain MG1655, as determined by the alignment analysis: for the main subunit, 64% identity and 76% similarity; for the chaperone, 56% identity and 70% similarity; for the usher, 56% identity and 69% similarity; and for the adhesin, 47% identity and 62% similarity. The most relevant variations are the variations in the main and adhesin subunits, as they determine binding specificity. For comparison, type 1 fimbriae and F1C fimbriae, which have similar structures but different target receptors, differ by 63% and 74%, respectively, in the main subunit and 31% and 46%, respectively, in the adhesin. Our work performed with the reagents described below demonstrated that F9 fimbriae do not cross-react with a type 1 fimbrial antibody (and visa versa) and that F9 fimbriae do not agglutinate yeast in a mannose-resistant or mannose-sensitive manner (data not shown). These data indicate that F9 fimbriae are immunologically and functionally distinct from type 1 fimbriae.
The structural genes for F9 fimbriae are very highly conserved in E. coli O157:H7 and the sequenced uropathogenic E. coli isolate CFT073 (44); the levels of identity range from 96.6% to 97.8% (at the nucleotide level). In contrast, the upstream sequences that are most likely to contain regulatory regions and regulators bear little resemblance in the two pathotypes. In the O157 F9 cluster, there are three open reading frames upstream of the main structural subunit gene. In the CFT073 F9 cluster there are two divergent open reading frames in the corresponding region, the first of which, oprR, encodes a putative LysR-like regulator. The level of identity for this complete region (3,000 bp) is only 45.6%, indicating that while the different pathotypes may share the capacity to express the F9 fimbriae, the regulation mechanisms are likely to be different.
Cloning of F9 and induced expression in E. coli K-12.
The complete cluster, including genes Z2200 to Z2206 (EC2107 to EC2113), was amplified in two parts by long-range PCR using the primers listed in Materials and Methods. The products were cloned into pBAD18 so that expression could be induced by addition of arabinose. The cloned operon was sequenced and was shown to be identical to that found in the genome sequence of E. coli O157:H7 strain EDL933 (25). Addition of 0.2% arabinose resulted in production of visible fimbriae on the surface of E. coli K-12 strain AAEC185 Δfim (Fig. 2A and C). The fimbriae extended from the cell for 1 to 2 μm and were able to form longer bundles that were clearly distinct from flagella (Fig. 2C). These fimbriae were absent in arabinose-induced control (pBAD18) samples (Fig. 2B). To simplify their description, we designated these fimbriae E. coli “F9” fimbriae. In order to purify the fimbriae, a modified method developed by Korhonen et al. (17) was used, which relies on heat treatment at 60°C. The fimbriae were then either precipitated by TCA or purified further by ammonium sulfate precipitation and dialysis (see Materials and Methods). The purified fimbriae were then denatured by heating in acid and separated by SDS-PAGE (Fig. 3A). An identical procedure was used for induction of the same strain containing just the pBAD18 plasmid. Expression from the induced cluster produced a clear, abundant protein band at 17 kDa, which corresponded to the expected size of the F9 main subunit. A very weak band that was a similar size was present in the control sample, although clearly at a much reduced level. As shown in Fig. 1, the first part of the F9 cluster was missing in the E. coli K-12 strain used. This strain (AAEC185) also lacked type 1 fimbriae. The band may indicate that there was some cross-reaction with yet another fimbrial subunit present in E. coli K-12. To confirm that the main 17-kDa protein probably originated from the cloned F9 cluster, serum was raised against the purified main subunit (see Materials and Methods), and antibody from this serum recognized the main fimbrial subunit protein band, as determined by Western blotting (Fig. 3B) and immunofluorescence microscopy (Fig. 3C and D). Without acid treatment of the samples, the levels of the 17-kDa protein detectable on the gel were reduced, indicating that the acid treatment was required to denature the organelle (data not shown). The cloned cluster therefore encodes a fimbria-like organelle that is predominately made up of 17-kDa protein subunits.
Expression of F9 by E. coli O157:H7.
Ongoing work has shown that a chromosomally integrated β-galactosidase translational fusion to the putative Z2200 promoter region (19a) results in higher levels of expression in rich media, in stationary-phase cultures, and at 28°C than at 37°C. Therefore, fimbrial preparations were made from E. coli O157:H7 strain EDL933 (= TUV-933-0) and E. coli O157:H7 strain Walla 3 (= ZAP198) cultured at at 28°C and 37°C in LB medium until the stationary phase. The fimbriae were prepared as described in Materials and Methods, denatured in acid, and separated by SDS-PAGE, and the fimbrial subunit was detected by Western blotting using the polyclonal rabbit serum raised against the main subunit (Fig. 3B). Preparations from the pBAD18 F9 clone (pASL04) and pBAD18 alone in strain AAEC185 were also included as positive and negative controls, respectively (Fig. 3B). A control preparation produced a weak cross-reacting band (Fig. 3B, lane 2). In order to confirm that the 17-kDa band was the F9 main subunit, a Z2200 (main subunit gene) deletion mutant was constructed using the lambda Red mutagenesis strategy (6). Western blotting of a fimbrial preparation from the E. coli O157:H7 deletion strain demonstrated that the 17-kDa subunit band was not present, although there was a cross-reaction with a slightly smaller protein (about 16 kDa) (Fig. 3B, lane). The temperature regulation was confirmed by a plasmid-based eGFP translational fusion (pACKloc8) to the Z2200 putative promoter region (Fig. 3E), which showed that there was a higher level of expression from the fusion in an E. coli O157:H7 background (ZAP198) when the organisms were cultured at 28°C than when they were cultured at 34°C or 37°C. This construct provided no evidence of heterogeneous or phase-variable expression of F9. E. coli O157:H7, therefore, expresses F9 fimbriae, although expression was optimized for lower temperatures in the medium tested. The Western blot data do indicate that there were low levels of expression from the wild-type strains even at 28°C, and this may account for our failure to detect F9 expression on the surface of E. coli O157:H7 (ZAP198) by immunofluoresence using the antibody raised against the main subunit. As there was no evidence for phase variation of F9, it may be that only a limited number of fimbriae per cell are present on the bacterial surface. The presence of multiple fimbriae on the bacterial surface was confirmed for E. coli O157 containing the induced F9 clone (pASL04) (Fig. 3C and D).
Adherence of E. coli expressing F9 to bovine epithelial cells and explant tissue.
In order to determine whether expression of F9 fimbriae increases the capacity of E. coli to bind to bovine epithelial cells, E. coli K-12 strain AAEC185 containing the inducible F9 operon (pASL04) was compared with the same strain containing the pBAD18 vector alone for adherence to EBL cells and to primary cells derived from the bovine terminal rectum. EBL cells and a bovine mammary gland line are the only two immortal bovine epithelial cell lines available for such studies. Following 2 h of arabinose induction of the F9 adhesin, a significant 3.5-fold increase (P < 0.001) in bacterial binding to EBL cells was observed after 2 h of incubation of the bacteria with the cells (Fig. 4A). A significant (P < 0.001) increase in binding was also observed for the expressed adhesin on the primary cells (Fig. 4B). A mutant with a mutation in the F9 main subunit was also analyzed to determine its capacity to bind to EBL cells and rectal primary cells compared to the capacity of the wild-type strain. No difference in adherence potential between these strains was observed in either assay (data not shown).
Another series of experiments was carried out, in which E. coli O157:H7 strain Walla 3 was transformed with the pASLO4 (F9+) clone and control plasmid pBAD18 and adherence to terminal rectal explant tissue was quantified following 2 h of incubation of the bacteria with the tissue (Fig. 4C). In this case it was clear that induction of the fimbriae had a significant (in both cases P < 0.05) negative impact on adherence and F9 expression actually limited binding of the E. coli O157:H7 strain.
Adherence of E. coli expressing F9 fimbriae to extracellular matrix components.
Bacterial adhesins that function in a mammalian host have a range of common targets to which they bind. In some cases these targets are specific sugar residues, but in other cases they are proteins such as fibrinogen, fibronectin, or collagen. E. coli O157:H7 strain Walla 3 (= ZAP198) was transformed with both pASL04 (F9+) and the pBAD18 control. The strains were assayed for adherence to a variety of bovine substrates, including fibrinogen, fibronectin, collagen, elastin, and hyaluronic acid, which were coated onto glass slides. Most of the substrates were negative for binding. The only exception was fibronectin. This substrate produced patches of high-density binding (Fig. 5A and B) compared to the control (Fig. 5C and D), indicating that F9 does have an affinity for bovine fibronectin.
Deletion of F9 and impact on colonization of the bovine terminal rectum.
Previous work has shown that deletion of the F9 main subunit in E. coli O157:H7 strain EDL933 reduces the ability to colonize 1- to 2-week old calves. The tropism of E. coli O157:H7 for the terminal rectum of cattle does not occur to the same degree in these very young animals, but it is apparent in postweaned calves (6 to 8 weeks) and in adult cattle presented for slaughter (19, 21). It is possible that there is more generalized colonization of the gastrointestinal tract in young calves that obscures any tropism for the terminal rectum and that this is mediated by F9. Alternatively, these animals may differ because the immune inductive sites of the gastrointestinal tract are immature. Thus, we wanted to determine if F9 played a role in the specificity for the terminal rectal site. The main F9 subunit gene, Z2200, was deleted by lambda Red mutagenesis in E. coli O157:H7 strain Walla 3 (Nalr), and the strain was orally inoculated into seven animals (age, 21 weeks) as described in Materials and Methods. The shedding profile of the mutant for these seven animals was compared with the shedding profile of the wild-type strain for 19 orally inoculated animals (Fig. 6A). There was no strong evidence that there was a difference in the mean levels of shedding between the groups or that there was a difference in the shedding patterns over time between the groups. However, the possibility that the F9 deletion reduced the levels of shedding should not be ruled out as the mean levels were consistently lower in this group, particularly toward the end of the experiment. For both sets of data there was a large amount of variability in the CFU/g values both between calves and for the same calf over time. In both groups there were some calves that did not appear to be colonized. A Fisher exact test of the proportion of calves that were not colonized provided no evidence of a difference between the groups (2/7 calves versus 3/19 calves).
To determine if F9 is responsible for the terminal rectal tropism, the levels of E. coli O157:H7 on the surface of the feces were determined and compared to the levels in the core of the feces (when possible). Terminal rectal colonization resulted in coating of the feces as the animal defecated, and this resulted in surface-to-core ratios that were at least 10-fold higher. As is shown in Fig. 6B, the ratio for the mutant started off around 1:1 as bacteria from the original oral dose were passaged through the gastrointestinal tract. Once colonization was established on day 3, the ratio increased, indicating that there was rectal localization. These data demonstrate that F9 is not essential for localization to the terminal rectal site but may still contribute to the initial colonization, potentially at anterior sites.
DISCUSSION
The majority of E. coli strains associated with human and animal disease express fimbrial adhesins that allow them to colonize epithelium. While sequencing of two enterohemorrhagic E. coli O157:H7 strains has revealed the presence of at least 16 putative fimbrial clusters, there have been only a very limited number of reports of fimbriae expressed by this serotype. A signature-tagged mutagenesis screening for E. coli O157:H7 genes that promote colonization of young calves was carried out, and an attenuating mutation was identified in a putative fimbrial cluster (Z2200 to Z2206) on O-island 61 (11, 25). A closely related cluster was also identified as relevant for calf colonization in a similar screening of E. coli serotype O26:H- (43). Moreover, an initial analysis of the levels of expression from 16 putative fimbrial clusters in E. coli O157:H7 identified the O-island 61 cluster as one of four clusters that are expressed in vitro and as a cluster that does contain a complete operon, including a minor FimH-like adhesin gene (submitted for publication). The aims of this study were to determine whether this operon expresses a fimbrial adhesin, to characterize the operon and fimbriae in more detail, and to determine whether the fimbriae are responsible for the tropism that E. coli O157:H7 exhibits for the terminal rectum of cattle (21). The fimbriae were designated E. coli “F9” fimbriae.
We established the distribution of putative fimbrial genes located in O islands, including the genes for F9 fimbriae present on OI61 of E. coli O157:H7. In the case of the OI141 lpfA1 and OI154 lpfA2 genes, our data support previous findings indicating that strains belonging to the EHEC O157:H7 serotype or closely related strains (particularly O55:H7 strains) may have acquired putative virulence factors as mobile elements via horizontal transfer and recombination and that these factors could represent EHEC-specific regions (39). In contrast, three of the O islands analyzed were not restricted to EHEC strains. In the case of OI61 Z2200 (F9), this gene was absent only from the E. coli strains belonging to the DEC6 group comprising serotypes O111:H21, O111:H12, and O111:NM (46). Similarly, OI47 Z1534 and OI127 Z4498 had a wider distribution, and a strict association with EHEC strains was not observed. Our results indicate that selective pressure favoring the maintenance of specific combinations of these fimbrial factors presumably enhances the ability of DEC strains to adhere and to colonize specific host niches (e.g., O157:H7 or O26:H- during colonization of calves).
Forced expression of the O-island 61 operon (Z2200 to Z2206) from a plasmid resulted in surface presentation of short fimbriae that were 1 to 2 μm long, although these fimbriae were capable of forming longer bundles (Fig. 2). The F9 fimbriae were removed by heating the bacteria at 60°C, and the main subunit was separated by using SDS-PAGE following denaturation of the fimbriae in acid. Polyclonal antiserum was raised against the purified main subunit, and this antiserum was used to confirm expression of F9 from the fimbrial clone and from two E. coli O157:H7 isolates, EDL933 and Walla 3 (9, 24). The fimbriae were detected at both 37°C and 28°C but were not detected by Western blotting in the F9 main subunit deletion strain. Higher levels of fimbriae were produced at the lower temperature in both strains, a finding that correlates with the fluorescence levels produced by a plasmid-based translational fusion of the F9 main subunit promoter region to eGFP in an E. coli O157:H7 background (Fig. 3E). Therefore, the operon does encode a fimbrial adhesin and is expressed by E. coli O157:H7 but at low levels under the in vitro conditions examined. The higher levels of expression at 28°C and the lack of detectable phase variation are arguments against an important role in vivo.
The expressed fimbriae in E. coli K-12 did result in a significant increase in bacterial adherence to cultured bovine epithelial cells. As E. coli O157:H7 colonizes the terminal rectum of cattle, cultures of primary cells from this site were prepared, and the adherence of E. coli K-12 with F9 and the adherence of E. coli K-12 without F9 to these primary cell cultures were compared. A small increase in the number of bacteria bound was observed in the presence of induced F9, but the increase was not significant. However, the increased levels of attachment in both assays did indicate that the fimbriae could confer a colonization advantage.
An interesting result was obtained when F9 fimbriae were expressed from the plasmid clone in an E. coli O157:H7 background rather than in E. coli K-12. In this background, the expression reduced adherence to explant tissue from the bovine gastrointestinal tract. A number of studies have demonstrated the importance of type III secretion in colonization of ruminant gastrointestinal epithelium, and one possible explanation for this result is that forced expression of a fimbrial adhesin can interfere with type III secretion-based adherence. This highlights the fact that the expressed fimbrial repertoire of EHEC O157:H7 may be quite restricted and means that any fimbrial expression needs to be coordinated with the type III secretion system and be mutually exclusive (15).
Fimbrial adhesins generally bind to either specific sugar residues or extracellular matrix components. E. coli K-12 expressing F9 was screened for attachment to a variety of substrates. Some affinity for fibronectin was observed, and it remains to be determined if this is the main substrate for F9 or a subsidiary substrate, as has been demonstrated for other fimbriae (32). The fact that the adhesin cluster has a wide distribution in E. coli serotypes implies that a generic adhesive function is not necessarily linked to the bovine host. This conclusion is supported by the finding that F9 fimbriae are expressed at higher levels at lower temperatures, although fimbrial expression and surface production do occur at 37°C. In recent work on E. coli genes up-regulated in urinary tract infections it was found that the F9 gene cluster is up-regulated in human urine (31). While we have focused on colonization of the bovine host and bovine substrates, it is possible that the F9 adhesin could be important in human infections for both E. coli O157:H7 and other serotypes. Further research should examine the expression and importance of this adhesin in non-O157 EHEC and possible cross talk with type III secretion.
While STM and deletion analysis do indicate that F9 has a role in colonization of very young calves (1 to 2 weeks old), the terminal rectal tropism observed in older calves and cattle (6 weeks to 2 years) is not as apparent in the young calves. In order to determine if F9 has a role in directing this tropism, the main F9 fimbrial subunit gene was deleted in E. coli O157:H7 strain Walla 3 by lambda Red mutagenesis, and the mutant was given orally to seven animals. Five of these animals were colonized by day 5 following the oral challenge. While the mean levels of colonization were slightly lower than the levels of colonization for the wild type, it is clear from the high surface-to-core distribution ratio for the mutant in the feces that colonization of the terminal rectum still occurred. Our previous studies and ongoing studies have shown that when E. coli O157:H7 colonizes the terminal rectum, it coats the fecal stool during defecation. On most occasions the surface and core of the feces can be separated, and the bacterial loads can be determined and plotted as a ratio. Following an oral dose, at the early times (days 1 to 3) the surface-to-core ratios are usually around 1. As the terminal rectum site is colonized, the ratio increases to 10 to 100. This increase in the ratio was observed with the F9 mutant. This adhesin is therefore not solely responsible for the terminal rectal tropism but may contribute to colonization at this site and higher sites, especially in young animals in which the immune inductive sites are still developing along with the gastrointestinal flora. Our ongoing work suggests that a lack of fimbrial expression may be an important part of the colonization strategy of E. coli O157:H7 in cattle. A lack of generic adhesin expression (particularly expression of type 1 fimbriae) may eliminate colonization of the majority of the gastrointestinal mucosa and therefore focus the bacteria to sites such as follicle-associated epithelium (FAE), which have a reduced mucin layer and therefore potentially fewer competing organisms. The bacteria can colonize these sites using type III secretion-based intimate adherence, perhaps in combination with other adhesins. The terminal rectal tropism may be a result of the factors described above in combination with appropriate regulation of the type III secretion system. It has been demonstrated that the type III secretion system in E. coli O157:H7 is regulated by quorum sensing (33, 34), and locus of enterocyte effacement expression is therefore up-regulated in the large intestine, where the bacterial load is highest. Potentially, the terminal rectal FAE is the only FAE site that the bacteria encounter when the system is up-regulated. Other environmental signals, such as the oxygen level, may also be relevant. In future research we will examine the regulatory interplay between surface organelle operons during E. coli colonization of epithelium.
Acknowledgments
D.L.G., A.S.L., and K.S. were supported by research grants from the UK Biotechnology and Biological Sciences Research Council. S.N. and J.C.L. were supported by SEERAD. We gratefully acknowledge the support of the Department for the Environment, Food and Rural Affairs (project OZ0707 to M.P.S and Timothy Wallis). A.G.T. was supported by institutional funds from the UTMB John Sealy Memorial Endowment Fund for Biomedical Research.
Editor: V. J. DiRita
REFERENCES
- 1.Besser, R. E., P. M. Griffin, and L. Slutsker. 1999. Escherichia coli O157:H7 gastroenteritis and the hemolytic uremic syndrome: an emerging infectious disease. Annu. Rev. Med. 50:355-367. [DOI] [PubMed] [Google Scholar]
- 2.Blomfield, I. C., M. S. McClain, and B. I. Eisenstein. 1991. Type 1 fimbriae mutants of Escherichia coli K12—characterization of recognized afimbriate strains and construction of new fim deletion mutants. Mol. Microbiol. 5:1439-1445. [DOI] [PubMed] [Google Scholar]
- 3.Borczyk, A. A., M. A. Karmali, H. Lior, and L. M. Duncan. 1987. Bovine reservoir for verotoxin-producing Escherichia coli O157:H7. Lancet i:98. [DOI] [PubMed] [Google Scholar]
- 4.Cookson, A. L., W. A. Cooley, and M. J. Woodward. 2002. The role of type 1 and curli fimbriae of Shiga toxin-producing Escherichia coli in adherence to abiotic surfaces. Int. J. Med. Microbiol. 292:195-205. [DOI] [PubMed] [Google Scholar]
- 5.Cornick, N. A., S. L. Booher, and H. W. Moon. 2002. Intimin facilitates colonization by Escherichia coli O157:H7 in adult ruminants. Infect. Immun. 70:2704-2707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dean-Nystrom, E. A., B. T. Bosworth, W. C. Cray, and H. W. Moon. 1997. Pathogenicity of Escherichia coli O157:H7 in the intestines of neonatal calves. Infect. Immun. 65:1842-1848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Dean-Nystrom, E. A., B. T. Bosworth, H. W. Moon, and A. D. O'Brien. 1998. Escherichia coli O157:H7 requires intimin for enteropathogenicity in calves. Infect. Immun. 66:4560-4563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Donohue-Rolfe, A., I. Kondova, S. Oswald, D. Hutto, and S. Tzipori. 2000. Escherichia coli O157:H7 strains that express Shiga toxin (Stx) 2 alone are more neurotropic for gnotobiotic piglets than are isotypes producing only Stx1 or both Stx1 and Stx2. J. Infect. Dis. 181:1825-1829. [DOI] [PubMed] [Google Scholar]
- 10.Doughty, S., J. Sloan, V. Bennett-Wood, M. Robertson, R. M. Robins-Browne, and E. L. Hartland. 2002. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect. Immun. 70:6761-6769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Dziva, F., P. M. van Diemen, M. P. Stevens, A. J. Smith, and T. S. Wallis. 2004. Identification of Escherichia coli O157:H7 genes influencing colonization of the bovine gastrointestinal tract using signature-tagged mutagenesis. Microbiology 150:3631-3645. [DOI] [PubMed] [Google Scholar]
- 12.Elliott, S. J., and J. B. Kaper. 1997. Role of type 1 fimbriae in EPEC infections. Microb. Pathog. 23:113-118. [DOI] [PubMed] [Google Scholar]
- 13.Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter. J. Bacteriol. 177:4121-4130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11-22. [DOI] [PubMed] [Google Scholar]
- 15.Holden, N. J., and D. L. Gally. 2004. Switches, cross-talk and memory in Escherichia coli adherence. J. Med. Microbiol. 53:585-593. [DOI] [PubMed] [Google Scholar]
- 16.Hung, C. S., J. Bouckaert, D. Hung, J. Pinkner, C. Widberg, A. DeFusco, C. G. Auguste, R. Strouse, S. Langermann, G. Waksman, and S. J. Hultgren. 2002. Structural basis of tropism of Escherichia coli to the bladder during urinary tract infection. Mol. Microbiol. 44:903-915. [DOI] [PubMed] [Google Scholar]
- 17.Korhonen, T. K., E. L. Nurmiaho, H. Ranta, and C. Svanborgeden. 1980. New method for isolation of immunologically pure pili from Escherichia coli. Infect. Immun. 27:569-575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Li, B. G., W. H. Koch, and T. A. Cebula. 1997. Detection and characterization of the fimA gene of Escherichia coli O157:H7. Mol. Cell. Probes 11:397-406. [DOI] [PubMed] [Google Scholar]
- 19.Low, J. C., I. J. McKendrick, C. McKechnie, D. Fenlon, S. W. Naylor, C. Currie, D. G. Smith, L. Allison, and D. L. Gally. 2005. Rectal carriage of enterohemorrhagic Escherichia coli O157 in slaughtered cattle. Appl. Environ. Microbiol. 71:93-97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19a.Low, A. S., N. Holden, T. Rosser, A. J. Roe, C. Constantinidou, J. L. Hobman, D. G. E. Smith, J. C. Low, and D. L. Gally. 2006. Analysis of fimbrial gene clusters and their expression in enterohaemorrhagic Escherichia coli O157:H7. Environ. Microbiol. [Online] doi: 10.111/j.1462-2920.2006.00995.x. [DOI] [PubMed]
- 20.Mahajan, A., S. Naylor, A. D. Mills, J. C. Low, A. MacKellar, D. E. E. Hoey, C. G. Currie, D. L. Gally, J. Huntley, and D. G. E. Smith. 2005. Phenotypic and functional characterisation of follicle-associated epithelium of rectal lymphoid tissue. Cell Tissue Res. 321:365-374. [DOI] [PubMed] [Google Scholar]
- 21.Naylor, S. W., J. C. Low, T. E. Besser, A. Mahajan, G. J. Gunn, M. C. Pearce, I. J. McKendrick, D. G. Smith, and D. L. Gally. 2003. Lymphoid follicle-dense mucosa at the terminal rectum is the principal site of colonization of enterohemorrhagic Escherichia coli O157:H7 in the bovine host. Infect. Immun. 71:1505-1512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Naylor, S. W., A. J. Roe, P. Nart, K. Spears, D. G. E. Smith, J. C. Low, and D. L. Gally. 2005. Escherichia coli O157:H7 forms attaching and effacing lesions at the terminal rectum of cattle and colonization requires the LEE4 operon. Microbiology 151:2773-2781. [DOI] [PubMed] [Google Scholar]
- 23.Nicholls, L., T. H. Grant, and R. M. Robins-Browne. 2000. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol. Microbiol. 35:275-288. [DOI] [PubMed] [Google Scholar]
- 24.Ostroff, S. M., P. M. Griffin, R. V. Tauxe, L. D. Shipman, K. D. Greene, J. G. Wells, J. H. Lewis, P. A. Blake, and J. M. Kobayashi. 1990. A statewide outbreak of Escherichia coli 0157:H7 infections in Washington State. Am. J. Epidemiol. 132:239-247. [DOI] [PubMed] [Google Scholar]
- 25.Perna, N. T., G. Plunkett, 3rd, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533. [DOI] [PubMed] [Google Scholar]
- 26.Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. R. Blattner. 1997. Versatile insertion plasmids for targeted genome manipulations in bacteria: isolation, deletion, and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7 genome. J. Bacteriol. 179:4426-4428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Reid, S. D., C. J. Herbelin, A. C. Bumbaugh, R. K. Selander, and T. S. Whittam. 2000. Parallel evolution of virulence in pathogenic Escherichia coli. Nature 406:64-67. [DOI] [PubMed] [Google Scholar]
- 28.Roe, A. J., C. Currie, D. G. Smith, and D. L. Gally. 2001. Analysis of type 1 fimbriae expression in verotoxigenic Escherichia coli: a comparison between serotypes O157 and O26. Microbiology 147:145-152. [DOI] [PubMed] [Google Scholar]
- 29.Roe, A. J., S. W. Naylor, K. J. Spears, H. M. Yull, T. A. Dransfield, M. Oxford, I. J. McKendrick, M. Porter, M. J. Woodward, D. G. Smith, and D. L. Gally. 2004. Co-ordinate single-cell expression of LEE4- and LEE5-encoded proteins of Escherichia coli O157:H7. Mol. Microbiol. 54:337-352. [DOI] [PubMed] [Google Scholar]
- 30.Sheng, H. Q., M. A. Davis, H. J. Knecht, and C. J. Hovde. 2004. Rectal administration of Escherichia coli O157:H7: novel model for colonization of ruminants. Appl. Environ. Microbiol. 70:4588-4595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Snyder, J. A., B. J. Haugen, E. L. Buckles, C. V. Lockatell, D. E. Johnson, M. S. Donnenberg, R. A. Welch, and H. L. Mobley. 2004. Transcriptome of uropathogenic Escherichia coli during urinary tract infection. Infect. Immun. 72:6373-6381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Sokurenko, E. V., H. S. Courtney, D. E. Ohman, P. Klemm, and D. L. Hasty. 1994. FimH family of type-1 fimbrial adhesins: functional heterogeneity due to minor sequence variations among fimH genes. J. Bacteriol. 176:748-755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sperandio, V., J. L. Mellies, W. Nguyen, S. Shin, and J. B. Kaper. 1999. Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 96:15196-15201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sperandio, V., A. G. Torres, J. A. Giron, and J. B. Kaper. 2001. Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7. J. Bacteriol. 183:5187-5197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Stevens, M. P., A. J. Roe, I. Vlisidou, P. M. van Diemen, R. M. La Ragione, A. Best, M. J. Woodward, D. L. Gally, and T. S. Wallis. 2004. Mutation of toxB and a truncated version of the efa-1 gene in Escherichia coli O157:H7 influences the expression and secretion of locus of enterocyte effacement-encoded proteins but not intestinal colonization in calves or sheep. Infect. Immun. 72:5402-5411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Tarr, P. I., S. S. Bilge, J. C. Vary, S. Jelacic, R. L. Habeeb, T. R. Ward, M. R. Baylor, and T. E. Besser. 2000. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect. Immun. 68:1400-1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Tatsuno, I., M. Horie, H. Abe, T. Miki, K. Makino, H. Shinagawa, H. Taguchi, S. Kamiya, T. Hayashi, and C. Sasakawa. 2001. toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect. Immun. 69:6660-6669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Torres, A. G., J. A. Giron, N. T. Perna, V. Burland, F. R. Blattner, F. Avelino-Flores, and J. B. Kaper. 2002. Identification and characterization of lpfABCC′DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 70:5416-5427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Torres, A. G., K. J. Kanack, C. B. Tutt, V. Popov, and J. B. Kaper. 2004. Characterization of the second long polar (LP) fimbriae of Escherichia coli O157:H7 and distribution of LP fimbriae in other pathogenic E. coli strains. FEMS Microbiol. Lett. 238:333-344. [DOI] [PubMed] [Google Scholar]
- 40.Torres, A. G., and J. B. Kaper. 2003. Multiple elements controlling adherence of enterohemorrhagic Escherichia coli O157:H7 to HeLa cells. Infect. Immun. 71:4985-4995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Torres, A. G., N. T. Perna, V. Burland, A. Ruknudin, F. R. Blattner, and J. B. Kaper. 2002. Characterization of Cah, a calcium-binding and heat-extractable autotransporter protein of enterohaemorrhagic Escherichia coli. Mol. Microbiol. 45:951-966. [DOI] [PubMed] [Google Scholar]
- 42.Uhlich, G. A., J. E. Keen, and R. O. Elder. 2001. Mutations in the csgD promoter associated with variations in curli expression in certain strains of Escherichia coli O157:H7. Appl. Environ. Microbiol. 67:2367-2370. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.van Diemen, P. A., F. Dziva, M. P. Stevens, and T. S. Wallis. 2005. Identification of enterohemorrhagic Escherichia coli O26:H- genes required for intestinal colonization in calves. Infect. Immun. 73:1735-1743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wales, A. D., G. R. Pearson, A. M. Skuse, J. M. Roe, C. M. Hayes, A. L. Cookson, and M. J. Woodward. 2001. Attaching and effacing lesions caused by Escherichia coli O157:H7 in experimentally inoculated neonatal lambs. J. Med. Microbiol. 50:752-758. [DOI] [PubMed] [Google Scholar]
- 45.Welch, R. A., V. Burland, G. Plunkett, P. Redford, P. Roesch, D. Rasko, E. L. Buckles, S. R. Liou, A. Boutin, J. Hackett, D. Stroud, G. F. Mayhew, D. J. Rose, S. Zhou, D. C. Schwartz, N. T. Perna, H. L. T. Mobley, M. S. Donnenberg, and F. R. Blattner. 2002. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 99:17020-17024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Whittam, T. S., M. L. Wolfe, I. K. Wachsmuth, F. Orskov, I. Orskov, and R. A. Wilson. 1993. Clonal relationships among Escherichia coli strains that cause hemorrhagic colitis and infantile diarrhea. Infect. Immun. 61:1619-1629. [DOI] [PMC free article] [PubMed] [Google Scholar]