Abstract
MgrA has been shown to affect multiple Staphylococcus aureus genes involved in virulence and antibiotic resistance. To comprehensively identify the target genes regulated by mgrA, we employed a microarray method to analyze the transcription profiles of S. aureus Newman, its isogeneic mgrA mutant, and an MgrA-overproducing derivative. We compared genes that were differentially expressed at exponential or early stationary growth phases. Our results showed that MgrA affected an impressive number of genes, 175 of which were positively regulated and 180 of which were negatively regulated in an mgrA-specific manner. The target genes included all functional categories. The microarray results were validated by real-time reverse transcription-PCR quantitation of a set of selected genes from different functional categories. Our data also indicate that mgrA regulates virulence factors in a fashion analogous to that of the accessory gene regulatory locus (agr). Accordingly, exoproteins are upregulated and surface proteins are downregulated by the regulator, suggesting that mgrA may function in concert with agr. The fact that a large number of genes are regulated by mgrA implies that MgrA is a major global regulator in S. aureus.
Staphylococcus aureus can cause a diverse range of diseases, from superficial skin infections to serious infections such as osteomyelitis, septic arthritis, pneumonia, infected implant failure, and toxic shock syndrome (23). This bacterium is the prominent cause of nosocomial infections. A large number of virulence factors including secreted proteins, cell wall-tethered proteins, and cytoplasmic and integrated membrane proteins are believed to be involved in the infection processes. These virulence factors are coordinately regulated by a network of regulatory genes, which can be grouped into two major classes, two-component systems (TCSs) and small transcription regulators. The sensors of the 16 TCSs found in the S. aureus genome are likely to be responsible for sensing various environmental cues and transmitting the information to the responders, which either alone or in conjunction with other small transcription regulators regulate “downstream” genes (1, 7, 31).
Among the TCSs, the accessory gene regulator (agr) system is the best-characterized system. agr is a quorum-sensing system that is activated by responding to the accumulation of an autoinducing peptide during cell growth (reviewed in reference 31). The autoinducing peptide is processed from AgrD by AgrB (40), which is also believed to export the peptide. The signal is then sensed by AgrC and transmitted to responder AgrA, which binds to the agr promoters (18). Activation results in the upregulation of the agrDCBA operon and RNAIII, a small RNA effector molecule of the agr system. RNAIII activates the production of many exoproteins and represses several cell surface proteins at the transcriptional level. Interestingly, RNAIII has also been shown to regulate alpha-toxin and protein A production by an antisense mechanism at the translational level (14, 30).
The Staphylococcus accessory gene regulator, sarA, is the best-characterized small cytoplasmic transcriptional regulator. SarA regulates its target genes either directly or through the agr system by binding to the agr promoters. Several SarA homologs have been identified, and some have been molecularly characterized (7).
Recently, we and others have identified a novel global regulator, MgrA (15, 24, 39). Mutation or overexpression of mgrA affects the production of several virulence factors including capsules, protein A, and alpha-toxin (24). In addition, MgrA has been shown to affect antibiotic resistance and autolysis (15, 39). MgrA, which contains a DNA-binding helix-turn-helix motif, is a small transcriptional regulator related to the SarA family of regulators. MgrA regulates certain target genes by directly binding their promoter region (15, 16, 39). Previously, we showed by gel electrophoresis that MgrA profoundly affects the expression of extracellular proteins (24). However, the number of genes or the biological processes that are regulated by MgrA are not known. Here, we employ microarray methodology to determine the range of genes regulated by MgrA. Our data suggest that in addition to the already-known virulence factors, MgrA can act as a repressor or activator of a large number of genes, including genes involved in metabolic functions.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
S. aureus Newman and its derivatives were used for the sources of RNA. Bacteria were cultivated in Trypticase soy broth (Difco Laboratories, Detroit, Mich.) with shaking. Chromosomal transduction using phage 52A was carried out as previously described (21). The mgrA deletion mutant strain CYL1050 was constructed by transduction of ΔmgrA::cat from CYL1040 (24) to the Newman strain. The MgrA-overproducing strain CYL907 was constructed by cotransduction of Tn917 and the mgrA5614 allele (a promoter-up mutation linked by Tn917 insertion) from CYL183 (24) to the Newman strain. Mutant strain CYL1050 and the overproducing strain CYL907 were grown in media supplemented with chloramphenicol at 5 μg/ml and erythromycin at 10 μg/ml, respectively.
RNA isolation.
Cultures of S. aureus grown overnight were diluted 1:100 into fresh Trypticase soy broth medium with appropriate antibiotics and grown at 37°C for 2 to 5 h (optical densities at 660 nm of 0.43 to 0.46 and 3.90 to 4.13, respectively), at which time samples were collected for RNA isolation. The culture samples were centrifuged at 10,000 × g at 4°C for 5 min and washed once with Tris-EDTA (TE) buffer (10 mM Tris, 1 mM EDTA, pH 7.6). The cell pellets were resuspended in TE buffer and kept frozen at −80°C after the addition of an equal volume of a 1:1 ice-cold alcohol-acetone mixture. After centrifugation at 10,000 × g at 4°C for 5 min, cell pellets were air dried and resuspended on ice in 500 μl TE buffer. The cell suspensions were transferred to lysing matrix B tubes and processed twice in an FP120 FastPrep cell disruptor (MP Biomedicals, Irvine, Calif.) for 40 s at setting 6.0 each time. The tubes were centrifuged at maximum speed in a tabletop centrifuge for 15 min at 4°C, and the upper-phase samples were transferred to a 1.5-ml microtube. The RNA samples were further purified and treated with DNase I using the RNeasy kit from QIAGEN, Inc. (Valencia, Calif.), according to the instructions of the manufacturer. The RNA was quantified spectrophotometrically, and the absence of DNA was verified by PCR using primers listed in Table 1.
TABLE 1.
Primers used in real-time RT-PCR with SYBR green probes
| Primer | N315 ORFa | Sequence |
|---|---|---|
| SG16S1 | SArRNA01 | CGTGCTACAATGGACAATACAAA |
| SG16S2 | SArRNA01 | ATCTACGATTACTAGCGATTCCA |
| SGhu1 | SA1305 | GCTGGGATATCAATTTCTTTACC |
| SGhu2 | SA1305 | ATCCAAAACTCACTTGCTAAAGG |
| SGsarA1 | SA0573 | CTGTATTGACATACATCAGCGAA |
| SGsarA2 | SA0573 | GTTCTTTCATCATGCTCATTACG |
| arcA3 | SA2428 | ATGTCAGGGGTACGTAAGGAA |
| arcA4 | SA2428 | GAGGCTTGTGGATCTCTAGTA |
| betB3 | SA2406 | ATCGCGAAGCGTTAGCACGA |
| betB4 | SA2406 | CGTCTTTATCTGCTAATCCAGC |
| lacA5 | SA1997 | TCAGATGAAGCTGGCAAACGA |
| lacA6 | SA1997 | GCTACAGCCAAAGTTGCATCA |
| marR3 | SA0904 | GAAGATTTGGACAACGCACGG |
| marR4 | SA0904 | GTTCCCTGCTAATCTTCATCG |
| lukD3 | SA1637 | ACTTAAGGCAGCCGGAAACAT |
| lukD4 | SA1637 | CATTTGATTCTGAACTAACCGAA |
| lytN3 | SA1090 | TGAAGGTGCTGTTAAAACATCG |
| lytN4 | SA1090 | CTTGGCTTGAGTTTTTCGGAGT |
| splA3 | SA1631 | CATTTGTGGGTGGTACTGGTG |
| splA4 | Sa1631 | CTCGAATGATGTGCTGATACTC |
| tcaR3 | SA2147 | GTAAATAAGGCCGCAGTAAGC |
| tcaR4 | SA2147 | GCTCTACCTTTGTCAGTTAAGG |
| wcaG3 | SA0123 | TGTATTTGGGCCAAGACAGGA |
| wcaG4 | SA0123 | CTAGTTTGCAGTCCGTCACC |
ORF, open reading frame.
Microarray profiling.
RNA was converted to cDNA, and microarray analysis was performed according to the manufacturer's instructions (Affymetrix Expression Analysis Technical Manual; Affymetrix, Inc., Santa Clara, Calif.) for antisense prokaryotic arrays essentially as described previously by Beenken et al. (2). To ensure reproducibility, two RNA samples from each strain were prepared at each growth phase from two separate experiments. Each RNA sample was hybridized to two separate GeneChips. Genes with at least a twofold difference (t test; P ≤ 0.05) in RNA titer between the wild-type strain and the mgrA deletion mutant or between the wild-type strain and the MgrA-overproducing strain were considered differentially expressed in an mgrA-dependent manner.
Real-time RT-PCR.
To confirm the microarray data, we selected genes from different functional categories to assay their relative expression levels by real-time reverse transcription (RT)-PCR. Briefly, one-step quantitative RT-PCR was performed by incubating DNase I-treated RNA with SuperScript III platinum SYBR Green One-Step qRT-PCR master mix (Invitrogen Corporation, Carlsbad, Calif.) using the ABI Prism 7300 detection system (Applied Biosystems, Foster City, Calif.). The cDNA was subjected to real-time PCR using the primer pairs listed in Table 1. Cycling conditions were 48°C for 30 min and 95°C for 15 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min and a dissociation step at 95°C for 15 s, 60°C for 30 s, and 95°C for 15 s. Relative expression levels were determined by the comparative threshold cycle (ΔΔCt) method (Applied Biosystems User Bulletin no. 2).
RESULTS AND DISCUSSION
Identification of mgrA-regulated genes by microarray.
MgrA has been shown to regulate several virulence factors in S. aureus (15, 24, 39). In an effort to further characterize the role of MgrA in virulence gene regulation, DNA microarray studies were performed with the RNA isolated from strain Newman and its isogenic mgrA deletion mutant (CYL1050). We also included an MgrA-overproducing strain (CYL907) in our studies, since we previously found that MgrA overexpression affected the expression of many genes (24). However, strain CYL907 contains a Tn917 insertion (at the hypothetical gene SA0636 of N315) that is not present in strain Newman and CYL1050. To ensure that this insertion does not affect mgrA expression, we compared the mgrA promoter activity of strain CYL908, which contains Tn917 at the same insertion site as CYL907 but possesses a wild-type allele of mgrA, to that of strain Newman. No difference in promoter activity was observed between the two strains (results not shown) by using a plasmid-based promoter-xylE reporter gene fusion method, indicating that the insertion does not affect mgrA expression. To take into account the possibility of growth phase-dependent regulation, we isolated the RNA at exponential (2 h) and early stationary (5 h) growth phases. The levels of gene expression between the wild type and the mgrA mutant and between the wild type and the overproducing strain were compared. A change of at least twofold was considered significant. Genes with decreased expression in the mgrA deletion mutant compared to the wild type and genes with decreased expression in the wild type compared to the Mgr-overproducing strain were grouped as mgrA-upregulated genes. Genes that were oppositely affected were grouped as downregulated by mgrA. A total of 350 genes were found to be regulated by mgrA at either 2 h or 5 h or at both sampling times. More specifically, 175 genes were found to be upregulated by mgrA (Table 2), and 180 genes were found to be downregulated by mgrA (Table 3). These genes were found in various functional groups and were grouped according to the classification described previously by Kunst et al. (19). The number of genes affected by mgrA was much greater at 2 h than at 5 h (about 2.5-fold), suggesting that mgrA is an early-growth-phase regulator. There were only 52 genes (14.8% of the total affected) that exhibited MgrA effects at both the log phase and stationary phase, suggesting that most of the genes respond to a limited range of MgrA concentrations. It should be noted here that we found that the mgrA transcript in the overproducing strain was 3.2-fold and 1.8-fold higher than that of the wild-type strain at 2 h and 5 h, respectively.
TABLE 2.
Genes upregulated by mgr
| ORF | Fold changea
|
Gene | Descriptionb | |||
|---|---|---|---|---|---|---|
| wt vs mgrΔ
|
mgr++ vs wt
|
|||||
| 2 h | 5 h | 2 h | 5 h | |||
| Cell envelope and cellular processes | ||||||
| N315-SA1269 | 2.1 | norB | Blt-like protein, efflux pump | |||
| COL-SA0002 | 24.8 | tetK | Tetracycline resistance protein | |||
| N315-SA2261 | 2.8 | HP, similar to efflux pump | ||||
| N315-SA2233 | 2.0 | HP, similar to integral membrane efflux protein | ||||
| N315-SA2302 | 4.2 | stpC | HP, similar to ABC transporter | |||
| N315-SA1655 | 2.1 | ABC transporter ecsA homolog | ||||
| N315-SA1674 | 5.2 | Glutamate ABC transporter ATP-binding protein | ||||
| N315-SA0682 | 2.1 | HP, similar to di-tripepride ABC transporter | ||||
| N315-SA0250 | 7.1 | lytS | Two-component sensor histidine kinase | |||
| N315-SA1987 | 2.5 | opuD | Glycine betaine transporter homolog | |||
| N315-SA0531 | 3.4 | 3.6 | prop | Proline/betaine transporter homolog | ||
| N315-SA2408 | 2.6 | cudT | Choline transporter | |||
| N315-SA1718 | 2.0 | putP | High-affinity proline permease | |||
| N315-SA1270 | 3.2 | HP, similar to amino acid permease | ||||
| N315-SA2239 | 2.0 | HP, similar to amino acid transporter | ||||
| N315-SA0541 | 2.3 | HP, similar to cationic amino acid transporter | ||||
| N315-SA1675 | 7.3 | HP, similar to glutamine-binding periplasmic protein | ||||
| N315-SA0871 | 2.1 | HP, similar to Na+/H+-dependent alanine carrier protein | ||||
| N315-SA0368 | 3.4 | HP, similar to proton/sodium-glutamate symport protein | ||||
| N315-SA0810 | 2.2 | mnhD | Na+/H+ antiporter subunit | |||
| N315-SA0809 | 2.4 | mnhE | Na+/H+ antiporter subunit | |||
| N315-SA0808 | 2.4 | mnhF | Na+/H+ antiporter subunit | |||
| N315-SA0807 | 2.5 | mnhG | Na+/H+ antiporter subunit | |||
| N315-SA0374 | 4.5 | pbuX | Xanthine permease | |||
| N315-SA1042 | 19.0 | pyrP | Uracil permease | |||
| N315-SA2167 | 3.1 | scrA | PTS system, sucrose-specific IIBC component | |||
| N315-SA2316 | 2.1 | srtA | Sortase | |||
| N315-SA2303 | 5.3 | smpC | Similar to membrane-spanning protein | |||
| N315-SA0211 | 2.0 | HP, similar to NADH-dependent dehydrogenase | ||||
| N315-SA0522 | 2.8 | HP, similar to poly(glycerol phosphate) α-glucosyltransferase | ||||
| N315-SA1182 | 2.8 | mscL | Large-conductance mechanosensitive channel | |||
| N315-SA0201 | 3.2 | rlp | RGD-containing lipoprotein | |||
| Intermediary metabolism | ||||||
| N315-SA1272 | 3.3 | ald | Alanine dehydrogenase | |||
| N315-SA0342 | 2.5 | atoB | Acetyl-CoA C-acetyltransferase homolog | |||
| N315-SA1510 | 2.1 | gapB | Glyceraldehyde-3-phosphate dehydrogenase 2 | |||
| N315-SA1959 | 4.6 | glmS | Glucosamine-fructose-6-phosphate aminotransferase | |||
| N315-SA0376 | 3.9 | guaA | GMP synthase | |||
| N315-SA0375 | 2.9 | guaB | Inositol-monophosphate dehydrogenase | |||
| N315-SA0202 | 2.6 | ggt | HP, similar to gamma-glutamyltranspeptidase precursor | |||
| N315-SA0430 | 2.7 | gltB | Glutamate synthase large subunit | |||
| N315-SA2334 | 2.1 | mvaS | 3-Hydroxy-3-methylglutaryl-CoA synthase | |||
| N315-SA0686 | 2.3 | nrdE | Ribonuceloside diphosphate reductase major subunit | |||
| N315-SA0687 | 3.0 | nrdF | Ribonucleoside diphosphate reductase minor subunit | |||
| N315-SA2409 | 2.2 | nrdG | Anaerobic ribonucleotide reductase activator protein | |||
| N315-SA1724 | 2.2 | purB | Adenylosuccinate lyase | |||
| N315-SA1929 | 3.2 | pyrG | CTP synthase | |||
| N315-SA1460 | 2.0 | relA | GTP pyrophosphokinase | |||
| N315-SA1921 | 2.1 | tdk | Thymidine kinase | |||
| N315-SA0373 | 3.2 | xprT | Xanthine phosphoribosyltransferase | |||
| N315-SA2397 | 5.0 | HP, similar to pyridoxal phosphate-dependent aminotransferase | ||||
| N315-SA0642 | 3.3 | 5.3 | HP, similar to cobalamin synthesis-related protein | |||
| N315-SA0643 | 2.3 | HP, similar to aryl alcohol dehydrogenase | ||||
| COL-SA2141 | 2.6 | Site-specific recombinase family protein, degenerate | ||||
| N315-SA0119 | 2.3 | HP, similar to diaminopimelate decarboxylase | ||||
| Information pathways | ||||||
| N315-SA1678 | 2.0 | furB | Transcription regulator Fur family homolog | |||
| N315-SA1041 | 9.7 | pyrR | Pyrimidine operon repressor chain A | |||
| N315-SA1870 | 2.1 | rsbW | anti-σB factor | |||
| N315-SA1869 | 2.1 | sigB | σB factor | |||
| N315-SA0573 | 2.4 | sarA | Staphylococcal accessory regulator A | |||
| N315-SA2147 | 5.2 | tcaR | TcaR transcription regulator | |||
| N315-SA2379 | 2.1 | HP, similar to transcriptional regulator tetR family | ||||
| N315-SA2495 | 5.8 | HP, putative transcriptional regulator | ||||
| N315-SA1956 | 2.9 | Lytic regulatory protein truncated with Tn554 | ||||
| N315-SA0461 | 2.1 | mfd | Transcription-repair-coupling factor | |||
| N315-SA0014 | 2.1 | rplI | 50S ribosomal protein L9 | |||
| N315-SA0577 | 2.3 | HP, similar to FimE recombinase | ||||
| Other functions | ||||||
| N315-SA0144 | 3.1 | 9.7 | 6.2 | cap5A | Capsular polysaccharide synthesis enzyme | |
| N315-SA0145 | 2.9 | 9.1 | 5.6 | cap5B | Capsular polysaccharide synthesis enzyme | |
| N315-SA0146 | 3.1 | 10 | 5.5 | cap5C | Capsular polysaccharide synthesis enzyme | |
| N315-SA0147 | 3.6 | 8.6 | 5.3 | cap5D | Capsular polysaccharide synthesis enzyme | |
| N315-SA0148 | 8.2 | 5.0 | cap5E | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0149 | 6.6 | 5.3 | cap5F | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0150 | 6.5 | 5.3 | cap5G | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0151 | 6.1 | 5.3 | cap5H | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0152 | 5.8 | 5.9 | cap5I | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0153 | 5 | 5.3 | cap5J | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0154 | 4.7 | cap5K | Capsular polysaccharide synthesis enzyme | |||
| N315-SA0155 | 4.1 | 4.7 | cap5L | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0156 | 4.1 | 4.5 | cap5M | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0157 | 3.7 | cap5N | Capsular polysaccharide synthesis enzyme | |||
| N315-SA0158 | 3.3 | 4.3 | cap5O | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0159 | 3.0 | 3.8 | cap5P | Capsular polysaccharide synthesis enzyme | ||
| N315-SA0252 | 14.0 | lrgA | Antiholin-like protein LrgA | |||
| N315-SA2406 | 4.2 | gbsA | Glycine betaine aldehyde dehydrogenase GbsA | |||
| N315-SA2207 | 5.8 | hlgA | Gamma-hemolysin chain II precursor | |||
| N315-SA1637 | 15.0 | 4.8 | lukD | Leukotoxin, LukD | ||
| N315-SA1638 | 13.1 | 4.2 | lukS | Synergohymenotropic toxin LukS | ||
| N315-SA1813 | 4.0 | lukF | Synergohymenotropic toxin precursor | |||
| N315-SA1812 | 5.9 | lukM | Leukocidin chain LukM | |||
| N315-SA0388 | 2.8 | set12 | Exotoxin 12 | |||
| N315-SA0390 | 3.2 | set14 | Exotoxin 14 | |||
| COL-SA0472 | 2.2 | Exotoxin 2 | ||||
| N315-SA2463 | 3.1 | lip | Triacylglycerol lipase precursor | |||
| N315-SA0746 | 13.7 | 4.4 | nuc | Staphylococcal nuclease | ||
| N315-SA1758 | 2.4 | sak | Staphylokinase precursor | |||
| N315-SA0128 | 2.1 | sodd | Superoxide dismutase | |||
| N315-SA1631 | 11.2 | splA | Serine protease SplA | |||
| N315-SA1630 | 13.5 | 2.0 | splB | Serine protease SplB | ||
| N315-SA1629 | 9.8 | splC | Serine protease SplC | |||
| N315-SA1628 | 6.1 | splD | Serine protease SplD | |||
| COL-SA1865 | 8.1 | 2.7 | splE | Serine protease SplE | ||
| N315-SA1549 | 2.2 | htrA | Serine proteinase htrA | |||
| N315-SA0744 | 11.1 | ssp | Extracellular ECM and plasma binding protein | |||
| N315-SA0462 | 2.1 | HP, similar to low-temperature-requirement B protein | ||||
| N315-SA0754 | 2.3 | HP, similar to lactococcal prophage ps3 protein 05 | ||||
| COL-SA0321 | 2.2 | Bacteriophage L54a, repressor protein | ||||
| N315-SA0102 | 2.3 | 67-kDa myosin-cross-reactive streptococcal antigen homolog | ||||
| N315-SA0521 | 2.9 | sdrE | SD-rich fibrinogen-binding, bone sialoprotein-binding protein | |||
| Similar to unknown proteins | ||||||
| N315-SA2210 | 2.6 | bioX | HP, similar to BioX protein | |||
| N315-SA2158 | 2.4 | HP, similar to TpgX protein | ||||
| N315-SA1900 | 3.4 | ywpF | Conserved HP | |||
| N315-SA2133 | 2.4 | Conserved HP | ||||
| N315-SA1327 | 2.3 | Conserved HP | ||||
| N315-SA2298 | 2.4 | Conserved HP | ||||
| N315-SA0701 | 2.7 | Conserved HP | ||||
| N315-SA0863 | 2.7 | Conserved HP | ||||
| N315-SA0943 | 3.1 | Conserved HP | ||||
| N315-SA0961 | 2.0 | Conserved HP | ||||
| N315-SA1976 | 3.8 | Conserved HP | ||||
| COL-SA0645 | 2.8 | Conserved HP | ||||
| COL-SA0651 | 2.5 | Conserved HP | ||||
| COL-SA0650 | 2.4 | Conserved HP | ||||
| COL-SA0647 | 2.3 | Conserved HP | ||||
| N315-SA1849 | 2.2 | Conserved HP | ||||
| COL-SA2631 | 2.1 | Conserved HP | ||||
| N315-SA0463 | 2.1 | Conserved HP | ||||
| COL-SA0654 | 2.1 | Conserved HP | ||||
| N315-SA0753 | 2.0 | Conserved HP | ||||
| N315-SA0648 | 2.0 | Conserved HP | ||||
| N315-SA0464 | 2.0 | Conserved HP | ||||
| N315-SA0212 | 2.0 | Conserved HP | ||||
| N315-SA0427 | 2.0 | Conserved HP | ||||
| N315-SA1459 | 2.0 | Conserved HP | ||||
| No similarity | ||||||
| COL-SA2420 | 4.8 | HP | ||||
| N315-SA0292 | 2.3 | HP | ||||
| N315-SA0633 | 2.2 | HP | ||||
| N315-SA0644 | 2.1 | HP | ||||
| N315-SA1001 | 10.2 | HP | ||||
| N315-SAS084 | 2.0 | HP | ||||
| N315-SA2343 | 5.3 | HP | ||||
| N315-SA2224 | 2.0 | HP | ||||
| N315-SA1477 | 2.1 | HP | ||||
| N315-SA1755 | 14.9 | HP (bacteriophage phiN315) | ||||
| N315-SAS014 | 2.0 | HP | ||||
| N315-SAS025 | 2.0 | HP | ||||
| N315-SA1168 | 2.1 | HP | ||||
| COL-SA0859 | 30.0 | HP | ||||
| COL-SA2480 | 4.4 | HP | ||||
| COL-SA1528 | 2.3 | HP | ||||
| COL-SA1529 | 2.2 | HP | ||||
| COL-SA1532 | 3.0 | 2.7 | HP | |||
| COL-SA2677 | 3.8 | HP | ||||
| N315-SA2280 | 2.8 | HP | ||||
| N315-SAS083 | 2.5 | HP | ||||
| N315-SA0120 | 2.3 | HP | ||||
| N315-SA2272 | 2.2 | HP | ||||
| N315-SA1321 | 2.2 | HP | ||||
| N315-SA0090 | 2.1 | HP | ||||
| N315-SA0279 | 2.1 | HP | ||||
| N315-SA0647 | 2.0 | HP | ||||
| N315-SA0291 | 2.0 | HP | ||||
| N315-SA2076 | 2.0 | HP | ||||
| COL-SA2629 | 4.1 | HP | ||||
| COL-SA2693 | 3.7 | HP | ||||
| COL-SA1533 | 2.5 | HP | ||||
| N315-SAS008 | 2.9 | HP | ||||
| 2.6 | 100% protein ID to PTS system sucrose-specific IIBC component ScrA, S. aureus MW2 | |||||
| 2.4 | 91.4% protein ID to HP SA1320, S. aureus N315 | |||||
| 2.6 | 8.1% protein ID to conserved HP SA0553, S. aureus N315 | |||||
| 3.4 | 85.7% protein ID to MW2624, S. aureus MW2 | |||||
| 3.5 | splF | 98.9% protein ID to serine Protease SplF, S. aureus MW2 | ||||
| 2.7 | 91.4% protein ID to SA1320 HP, S. aureus N315 | |||||
Values in boldface type indicate an undetected level in one strain such that the severalfold change could not be accurately calculated. “wt vs mgrΔ” indicates an increased expression level in the wild type compared to the mgrA deletion mutant. “mgr++ vs wt” indicates an increased expression level in the overproducing strain compared to the wild type.
Abbreviations: PTS, phosphotransferase; HP, hypothetical protein; ID, identity; CoA, coenzyme A; ECM, extracellular matrix.
TABLE 3.
Genes downregulated by mgrA
| ORF | Fold changea
|
Gene | Descriptionb | |||
|---|---|---|---|---|---|---|
|
mgrΔ vs wt
|
wt vs mgr++
|
|||||
| 2 h | 5 h | 2 h | 5 h | |||
| Cell envelope and cellular processes | ||||||
| N315-SA0650 | 2.9 | norA | Quinolone resistance protein | |||
| N315-SA0099 | 4.6 | sbtA | HP, similar to transmembrane efflux pump protein | |||
| N315-SA0599 | 3.0 | abcA | ATP-binding cassette transporter A | |||
| N315-SA2302 | 3.3 | stpC | HP, similar to ABC transporter | |||
| N315-SA2314 | 2.5 | HP, similar to ABC transporter (ATP-binding protein) | ||||
| N315-SA0297 | 2.4 | HP, similar to ABC transporter (ATP-binding protein) | ||||
| N315-SA0229 | 3.3 | HP, similar to nickel ABC transporter nickel-binding protein | ||||
| N315-SA1992 | 14.8 | lacE | PTS system, lactose-specific IIBC component | |||
| N315-SA1993 | 15.4 | lacF | PTS system, lactose-specific IIA component | |||
| N315-SA1960 | 2.6 | mtlF | PTS system, mannitol-specific IIBC component | |||
| N315-SA2167 | 5.5 | scrA | PTS system, sucrose-specific IIBC component | |||
| N315-SA0233 | 2.7 | 2.7 | PTS enzyme maltose- and glucose-specific factor II homolog | |||
| N315-SA0214 | 2.2 | uhpT | Hexose phosphate transport protein | |||
| N315-SA1090 | 30.7 | 31.6 | lytN | Cell wall hydrolase | ||
| N315-SA1025 | 2.3 | mraY | Phospho-N-muramic acid-pentapeptide translocase | |||
| N315-SA1091 | 22.6 | 19.7 | eprH | Endopeptidase resistance gene | ||
| N315-SA1987 | 2.9 | opuD | Glycine betaine transporter | |||
| N315-SA0304 | 2.0 | nanA | N-Acetylneuraminate lyase subunit | |||
| N315-SA1042 | 2.7 | pyrP | Uracil permease | |||
| N315-SA2446 | 4.3 | secY | HP, similar to preprotein translocase | |||
| N315-SA0443 | 2.0 | HP, similar to signal peptidase II homolog | ||||
| N315-SA0849 | 2.5 | HP, similar to peptide binding protein OppA | ||||
| N315-SA2081 | 4.6 | HP, similar to urea transporter | ||||
| N315-SA2239 | 3.5 | HP, similar to amino acid transporter | ||||
| N315-SA2489 | 2.7 | HP, similar to high-affinity nickel transport protein | ||||
| N315-SA2073 | 2.2 | modB | Probable molybdenum transport permease | |||
| N315-SA1374 | 3.0 | gspE | HP, similar to late competence protein ComGA | |||
| N315-SA1373 | 2.4 | HP, similar to DNA transport machinery protein ComGB | ||||
| N315-SA0578 | 4.0 | HP, similar to NADH dehydrogenase | ||||
| N315-SA2311 | 4.3 | 7.1 | HP, similar to NAD(P)H-flavin oxidoreductase | |||
| N315-SA0581 | 3.7 | MnhD homolog, similar to Na+/H+ antiporter subunit | ||||
| N315-SA0579 | 3.9 | HP, similar to Na+/H+ antiporter | ||||
| N315-SA0580 | 4.0 | HP, similar to Na+/H+ antiporter | ||||
| N315-SA2227 | 5.8 | Truncated HP, similar to d-serine/d-alanine/glycine transporter | ||||
| Intermediary metabolism | ||||||
| N315-SA2428 | 17.6 | arcA | Arginine deiminase | |||
| N315-SA2427 | 16.4 | arcB | Ornithine transcarbamoylase | |||
| N315-SA2008 | 6.8 | budB | Alpha-acetolactate synthase | |||
| N315-SA1045 | 2.5 | carA | Carbamoyl-phosphate synthase small chain | |||
| N315-SA1046 | 2.3 | carB | Carbamoyl-phosphate synthase large chain | |||
| N315-SA2312 | 27.8 | 6.4 | 2.6 | ddh | d-Specific d-2-hydroxyacid dehydrogenase | |
| N315-SA1493 | 2.4 | hemD | Uroporphyrinogen III synthase | |||
| N315-SA2465 | 3.2 | hisF | Cyclase-like protein | |||
| N315-SA2464 | 3.1 | hisI | Histidine biosynthesis bifunctional protein | |||
| N315-SA1997 | 10.8 | lacA | Galactose-6-phosphate isomerase LacA subunit | |||
| N315-SA1996 | 15.7 | lacB | Galactose-6-phosphate isomerase LacB subunit | |||
| N315-SA1995 | 17.8 | lacC | Tagatose-6-phosphate kinase | |||
| N315-SA1994 | 2.0 | 15.1 | lacD | Tagatose-1,6-diphosphate aldolase | ||
| N315-SA1991 | 13.9 | lacG | 6-Phospho-beta-galactosidase | |||
| N315-SA0344 | 2.4 | metE | 5-Methyltetrahydropteroyl-triglutamate-homocysteine methyltransferase | |||
| N315-SA2063 | 2.3 | moaA | Molybdenum cofactor biosynthesis protein A | |||
| N315-SA2068 | 2.4 | moeA | Molybdopterin biosynthesis protein | |||
| N315-SA1963 | 2.9 | mtlD | Mannitol-1-phosphate-5-dehydrogenase | |||
| N315-SA0016 | 4.2 | purA | Adenylosuccinate synthase | |||
| N315-SA1043 | 2.4 | pyrB | Aspartate transcarbamoylase chain A | |||
| N315-SA1044 | 2.5 | pyrC | Dihydroorotase | |||
| N315-SA1048 | 2.5 | pyrE | Orotate phosphoribosyltransferase | |||
| N315-SA1047 | 2.4 | pyrF | Orotidine-5-phosphate decarboxylase | |||
| N315-SA1929 | 2.3 | pyrG | CTP synthase | |||
| N315-SA2318 | 3.2 | sdhA | HP, similar to l-serine dehydratase | |||
| N315-SA2319 | 3.1 | sdhB | HP, similar to beta subunit of l-serine dehydratase | |||
| N315-SA2082 | 14.9 | 11.2 | ureA | Urease gamma subunit | ||
| N315-SA2083 | 26.7 | 13.1 | ureB | Urease beta subunit | ||
| N315-SA2084 | 14.9 | ureC | Urease alpha subunit | |||
| N315-SA2088 | 11.9 | ureD | Urease accessory protein | |||
| N315-SA2085 | 16.4 | ureE | Urease accessory protein | |||
| N315-SA2086 | 15.8 | ureF | Urease accessory protein | |||
| N315-SA2087 | 10.2 | ureG | Urease accessory protein | |||
| N315-SA1814 | 3.0 | HP, similar to succinyl-diaminopimelate desuccinylase | ||||
| N315-SA0234 | 3.0 | HP, similar to inosine-uridine-preferring nucleoside hydrolase | ||||
| N315-SA0098 | 5.2 | HP, similar to aminoacylase | ||||
| N315-SA2007 | 7.5 | HP, similar to alpha-acetolactate decarboxylase | ||||
| Information pathways | ||||||
| N315-SA0108 | 2.1 | sarS | Staphylococcal accessory regulator A homolog | |||
| N315-SA2092 | 2.6 | HP, similar to transcription regulator | ||||
| N315-SA0904 | 12.2 | 19.6 | HP, probable ATL autolysin transcription regulator | |||
| N315-SA1961 | 3.3 | HP, similar to transcription antiterminator BglG family | ||||
| N315-SA2320 | 2.6 | HP, similar to regulatory protein PfoR | ||||
| N315-SA0627 | 2.2 | HP, similar to LysR family transcriptional regulator | ||||
| N315-SA1485 | 2.4 | radC | DNA repair protein RadC homolog (Tn554 inserted) | |||
| N315-SA0897 | 2.2 | HP, similar to prolyl aminopeptidase | ||||
| N315-SA0565 | 2.5 | HP, similar to endonuclease III | ||||
| N315-SA1092 | 4.5 | HP, similar to DNA-processing Smf protein | ||||
| Other functions | ||||||
| N315-SA2456 | 3.4 | capB | Capsular polysaccharide biosynthesis | |||
| N315-SA2455 | >4.6 | capC | Capsular polysaccharide biosynthesis | |||
| N315-SA0123 | 10.1 | 33.5 | HP, similar to UDP-glucose-4-epimerase (galE-1) | |||
| N315-SA0124 | 11.0 | 14.3 | HP, similar to glycosyltransferase TuaA | |||
| N315-SA0125 | 7.4 | 6.1 | HP, similar to EpsG (exopolysaccharide G) | |||
| N315-SA0126 | 10.5 | 5.6 | HP, similar to capsular polysaccharide synthesis protein 14H | |||
| N315-SA0127 | 8.9 | 2.0 | HP, similar to capsular polysaccharide synthesis protein 14L | |||
| N315-SA2329 | 2.5 | 3.0 | cidA | Conserved HP | ||
| COL-SA0095 | 16.4 | 3.8 | 6.9 | spa | Immunoglobulin G binding protein A precursor | |
| COL-SA2676 | 8.8 | LPXTG motif cell wall anchor domain protein | ||||
| COL-SA1806 | 4.7 | 2.8 | mrp | LPXTG motif cell wall anchor domain protein | ||
| COL-SA2150 | 28.7 | 10.7 | fmtB | FmtB (Mrp) protein | ||
| N315-SA1004 | 2.1 | fib | HP, similar to fibrinogen-binding protein | |||
| N315-SA2431 | 3.6 | isaB | Immunodominant antigen B | |||
| N315-SA2447 | 9.2 | HP, similar to streptococcal hemagglutinin protein | ||||
| COL-SA1472 | 72.6 | ebh | Pathogenicity protein, putative | |||
| N315-SA1267 | 64.1 | ebhA | HP, similar to streptococcal adhesin emb | |||
| N315-SA2285 | 4.7 | HP, similar to accumulation-associated protein | ||||
| N315-SA2284 | 4.0 | HP, similar to accumulation-associated protein | ||||
| COL-SA0479 | 2.3 | Surface protein, putative | ||||
| N315-SA2414 | 11.7 | gpxA | HP, similar to glutathione peroxidase | |||
| N315-SA1147 | 2.9 | hflX | HP, similar to GTP-binding protein proteinase modulator homolog ynbA | |||
| COL-SA0478 | 3.1 | Exotoxin 3 | ||||
| N315-SA0777 | 2.1 | HP, similar to nitrogen fixation protein NifU | ||||
| N315-SA0102 | 2.9 | 67-kDa myosin-cross-reactive streptococcal antigen homolog | ||||
| COL-SA1186 | 2.8 | Antibacterial protein | ||||
| COL-SA1187 | 3.1 | Antibacterial protein | ||||
| N315-SA1617 | 3.7 | HP, similar to latent nuclear antigen (Kaposi's sarcoma-associated herpesvirus) | ||||
| Similar to unknown proteins | ||||||
| N315-SA1618 | 2.2 | Conserved HP | ||||
| N315-SA0335 | 2.5 | Conserved HP | ||||
| N315-SA2448 | 2.1 | Conserved HP | ||||
| N315-SA2315 | 2.7 | Conserved HP | ||||
| N315-SA2378 | 3.2 | 6.0 | Conserved HP | |||
| N315-SA0296 | 2.6 | Conserved HP | ||||
| N315-SA0332 | 2.5 | Conserved HP | ||||
| N315-SA0333 | 2.8 | Conserved HP | ||||
| N315-SA1154 | 3.8 | Conserved HP | ||||
| N315-SA0447 | 2.1 | Conserved HP | ||||
| N315-SA1432 | 5.3 | Conserved HP | ||||
| N315-SA1433 | 5.9 | Conserved HP | ||||
| N315-SA0710 | 2.9 | Conserved HP | ||||
| N315-SA0778 | 2.2 | Conserved HP | ||||
| N315-SA1451 | 4.8 | Conserved HP | ||||
| N315-SA2371 | 6.2 | Conserved HP | ||||
| N315-SA1618 | 3.7 | Conserved HP | ||||
| N315-SA0625 | 6.1 | 6.1 | Conserved HP | |||
| N315-SA0635 | 11.9 | 18.4 | Conserved HP | |||
| N315-SA0624 | 2.8 | Conserved HP | ||||
| No similarity | ||||||
| N315-SA2091 | 2.9 | HP | ||||
| COL-SA1473 | 13.8 | HP | ||||
| COL-SA1474 | 14.3 | 5.1 | HP | |||
| COL-SA2433 | 8.6 | 7.9 | HP | |||
| COL-SA2027 | 3.3 | HP | ||||
| N315-SA2443 | 8.0 | HP | ||||
| N315-SA2444 | 6.8 | HP | ||||
| N315-SA2445 | 7.0 | HP | ||||
| N315-SA2473 | 4.7 | HP | ||||
| N315-SA1001 | 3.1 | HP | ||||
| COL-SA1372 | 2.3 | HP | ||||
| N315-SA1514 | 2.2 | HP | ||||
| COL-SA2069 | 2.7 | HP | ||||
| N315-SA0748 | 3.5 | HP | ||||
| N315-SA0749 | 3.2 | HP | ||||
| N315-SA1008 | 2.6 | 2.4 | HP | |||
| COL-SA1345 | 2.2 | HP | ||||
| COL-SA1346 | 2.2 | HP | ||||
| COL-SA2187 | 10.0 | HP | ||||
| N315-SA2372 | 4.6 | HP | ||||
| N315-SA2373 | 4.9 | HP | ||||
| N315-SA2218 | 3.3 | HP | ||||
| COL-SA2510 | 2.0 | HP | ||||
| COL-SA2420 | 2.1 | HP | ||||
| N315-SA0221 | 2.2 | HP | ||||
| COL-SA0859 | 2.4 | HP | ||||
| N315-SAS028 | 2.4 | HP | ||||
| COL-SA1042 | 2.4 | HP | ||||
| N315-SA1015 | 2.7 | HP | ||||
| N315-SA1619 | 2.9 | HP | ||||
| N315-SAS014 | 2.9 | HP | ||||
| COL-SA1174 | 3.3 | HP | ||||
| COL-SA2559 | 3.8 | HP | ||||
| COL-SA0492 | 4.1 | HP | ||||
| COL-SA2558 | 4.1 | HP | ||||
| N315-SA0644 | 2.3 | HP | ||||
| N315-SA1017 | 2.3 | HP | ||||
| N315-SA1620 | 3.2 | HP | ||||
| 24.3 | 20.3 | 100% protein ID to truncated FmtB, S. aureus MW2 | ||||
| 4.8 | 30.1% protein ID to fibrinogen-binding protein A ClfA | |||||
| 3.1 | 100% protein ID to hemagglutinin, S. aureus MW2575 | |||||
| 135.2 | 83.5% protein ID to Ebh, S. aureus MW2 | |||||
| 21.0 | 77.5% protein ID EbhA, S. aureus N315 | |||||
| 3.7 | 27.8% protein ID to S. aureus surface protein Pls | |||||
| 99.4 | 65.8% protein ID to Ebh, S. aureus MW2 | |||||
| 7.1 | 63.2% protein ID to Ebh, S. aureus MW2 | |||||
| 19.0 | 98.1% protein ID to NasE assimilatory nitrite reductase, S. aureus N315 | |||||
| 4.1 | 34.1% protein ID to Fb1 receptin precursor, Staphylococcus lugdunensis strain 2342 | |||||
| 2.6 | 94.5% protein ID to SA1003, S. aureus N315 | |||||
| 2.3 | 89.5% protein ID to SA2243, S. aureus N315 | |||||
| 3.5 | 100% protein ID to PTS system sucrose-specific IIBC component ScrA, S. aureus MW2 | |||||
Values in boldface type indicate an undetected level in one strain such that the severalfold change could not be accurately calculated. “mgrΔ vs wt” indicates an increased expression level in the mgrA deletion mutant compared to the wild type. “wt vs mgr++” indicates an increased expression level in the wild type compared to the overproducing strain.
Abbreviations: PTS, phosphotransferase; HP, hypothetical protein; ID, identity; ATL, autolysin.
Our microarray results confirm previous reports that mgrA is a pleiotropic regulator that can act either as an activator or as a repressor (15, 24, 39). Unexpectedly, we found that five genes (opuD, pyrG, pyrP, scrA, and stpC) were positively regulated by mgrA at one time point but negatively regulated at the other. For example, scrA was found to be upregulated 3.1-fold at 2 h when the wild-type strain and the deletion mutant were compared but was downregulated 5.5-fold at 5 h when the wild-type strain and the overproducing strain were compared. The simplest explanation for these seemingly conflicting results is that such target genes are regulated by mgrA through more than one pathway (such as through other regulators) in which the target genes are regulated oppositely in different pathways depending on the level of MgrA and, perhaps, the growth conditions.
Confirmation of microarray results by real-time RT-PCR.
To confirm the results obtained by microarray, we employed real-time RT-PCR to estimate the amount of transcripts after 5 h of incubation for eight selected mgrA target genes in different functional categories. The expression of either 16S rRNA or hu (N315-SA1305) was used as the control for estimating the severalfold changes. The expression of the hu gene was not affected by mgrA (data not shown). The results shown in Table 4 were comparable with what was observed by DNA microarray results except that the severalfold changes were much more profound in real-time RT-PCR, indicating that real-time RT-PCR is more sensitive than GeneChips, as previously suggested (2). Our data were also validated by the findings that mgrA transcript was not found in mutant CYL1050 and that the transposon Tn917-associated genes were only found in overproducing strain CYL907 containing Tn917.
TABLE 4.
Relative quantification of gene expression regulated by MgrA by real-time RT-PCRa
| ORF | Gene | Fold change ± SE
|
|
|---|---|---|---|
| CYL907 | CYL1050 | ||
| N315-SA2428 | arcA | −1.1 ± 0.1 | −27.9 ± 9.1 |
| N315-SA1637 | lukD | −21.1 ± 2.9 | +83.9 ± 9.9 |
| N315-SA1090 | lytN | +2.1 ± 0.3 | −2,190.0 ± 152.1 |
| N315-SA0904 | +1.5 ± 0.03 | −564.4 ± 19.8 | |
| N315-SA0573 | sarA | −3.4 ± 0.5 | −1.4 ± 0.2 |
| N315-SA1631 | splA | +1.6 ± 0.1 | +22.8 ± 2.7 |
| N315-SA2147 | tcaR | −3.4 ± 0.8 | +6.5 ± 0.7 |
| N315-SA0123 | −1.8 ± 0.4 | −1,923.5 ± 398.1 | |
The severalfold changes are expressed in comparison to wild-type S. aureus Newman; − indicates reduction, and + indicates increase. Standard errors were calculated based on at least two independent experiments.
mgrA regulation of genes involved in polysaccharide synthesis.
We have previously shown that mgrA activates the expression of capsular polysaccharide genes encoded in the cap5(8) operon (24). Our profiling results showed that all 16 genes in this locus were upregulated by mgrA at 2 h and that all but two genes (cap5K and cap5N) were upregulated at 5 h when the overproducer was compared to the wild type (Table 2). When the deletion mutant was compared to the wild-type strain, only cap5ABCD was found to be upregulated at 5 h. These results are in good agreement with our previous Northern blotting results, promoter fusion assay, and capsule measurement. Our profiling results also showed that mgrA regulated other putative polysaccharide synthesis genes. We found that five genes with high similarity to polysaccharide synthesis genes encoded in the SA0123-SA0127 (N315) locus were affected by mgrA. However, contrary to the cap5(8) genes, these genes were downregulated by mgrA (Table 3). Like the cap5(8) genes, these genes were strongly regulated at both 2 h and 5 h, indicating that MgrA is a major regulator for these genes. This is in contrast to the majority of the genes identified in this study, which showed regulation at only one time point but not both. To confirm that these genes are repressed by mgrA, we compared the transcript of the first gene of this cluster of the wild-type strain to those of the mutant strains. As shown in Table 4, MgrA strongly repressed the SA0123 gene (nearly 2,000-fold repression). These results are in agreement with the microarray data. Our microarray study also found that two genes (N315-SA2455 and N315-SA2456) with high similarity to cap5(8)BC were downregulated in an mgrA-specific manner. These genes are clustered with the third gene, SA2457, with high similarity to cap5(8)A. However, mutations within this locus did not affect the type 5 or type 8 capsule (unpublished data). The cluster is adjacent to the ica locus, which encodes genes required for poly-N-acetylglucosamine synthesis involved in biofilm formation. However, these capABC-like genes have not been implicated in poly-N-acetylglucosamine synthesis (9). None of the ica genes were regulated by mgrA in our microarray study. Taken together, our results showed that mgrA not only regulated all the polysaccharide genes encoded by the cap5(8) locus but also controlled two other putative polysaccharide loci, suggesting that MgrA is a major regulator involved in polysaccharide production in S. aureus.
MgrA is a major autolytic regulator.
In S. aureus, autolysis is a very complex process. Three major autolysin genes, atl, lytM, and lytN, have been identified (32, 34, 36). In addition, the cidAB operon, which encodes a holin-like protein, has been shown to promote autolysis by functioning to facilitate either the transport of murein hydrolases or their activity (34). The lrgAB operon, which encodes an antiholin component, has been shown to counteract cidAB and thus inhibits extracellular murein hydrolase activity (13). The expression of lrgAB is in turn positively regulated by lytSR, a two-component regulatory system (5). Recently, ArlRS, another two-component regulatory system, has been shown to negatively regulate autolysis (11, 12). Ingavale et al. (15) showed that mgrA was a major regulator of autolysis, affecting the expression of lytSR, lrgAB, arlRS, lytM, and lytN. Indeed, we found that mgrA upregulated lytS and lrgA and downregulated lytN and cidA. Our results are therefore generally in agreement with the results reported previously by Ingavale et al. (15). In addition, our data also showed that N315-SA1956, a putative lytic regulator (which is truncated by Tn554 in N315), was upregulated by mgrA and that SA0904, a putative regulator of autolysin Atl, was downregulated. Taken together, our results indicate that mgrA is a major controlling factor for autolysis, negatively regulating autolytic genes but positively regulating antiautolytic factors.
Our microarray studies also revealed that mgrA regulated several genes involved in cell wall synthesis and the osmotic stress response. These genes include mraY (N315-SA1025, encoding muramic acid pentapetide translocase), eprH (N315-SA1091, an endopeptidase resistance gene), opuD (N315-SA1987, encoding the glycine betaine transporter), proP (N315-SA0531, encoding a proline/betaine transport homolog), gbsA (SA2406, encoding glycine betaine aldehyde dehydrogenase), cudT (N315-SA2408, encoding the choline transporter), and putP (N315-SA1718, encoding high-affinity proline permease). Perturbation of genes involved in cell wall synthesis is likely to weaken the cell wall, whereas an alteration of the gene involved in osmoprotectant synthesis or transport may lead to cell lysis under osmotic stress. Thus, these genes are likely to be indirectly involved in autolysis. These data suggest that mgrA also regulates autolysis at a different level, further supporting the notion that mgrA is a major autolytic regulator.
Among the genes related to autolysis, lytN, eprH, and N315-SA0904 were most profoundly regulated by mgrA at both 2 h and 5 h with high degrees of severalfold changes. To confirm these results, the effect on the expression of lytN and SA0904 by mgrA was measured by quantitative RT-PCR. As shown in Table 4, both genes were highly expressed in the mgrA deletion mutant and slightly repressed in the MgrA-overproducing strain, suggesting that lytN and SA0904 are highly repressed by mgrA in the wild-type strain and that a further increase of MgrA in the overproducing strain therefore does not decrease the level of repression.
Regulation of transporters and transmembrane proteins by mgrA.
MgrA has been found to affect several efflux pumps including norA (N315-SA0650), norB (N315-SA1269), and tet38 (N315-SA0132) (38, 39). Efflux pumps are involved in antibiotic resistance by effectively extruding antimicrobial agents from bacterial cells. NorA and NorB are multidrug resistance pumps, whereas tet38 confers only tetracycline resistance. In this study, we found that mgrA affected the expression of norA and norB but not tet38. However, our results showed that mgrA downregulated norA and upregulated norB, which is the opposite of results previously reported (38, 39). Since these previous studies used strain ISP794, a derivative of 8325-4 known to contain a mutation affecting sigB expression, it is likely that the discrepancy can be due to a sigB difference between strains ISP794 and Newman. Furthermore, we also found that mgrA affected sigB expression in the studies reported here (see below). However, our results on norA regulation by mgrA are consistent with those reported in a recent study by Kaatz et al. (17), who showed that mgrA downregulated norA in three different strains, ISP794, SH1000 (a sigB-positive 8325-4 strain), and Newman. It should be noted here that methodological differences between laboratories exist, and thus, one cannot exclude the possibility that the discrepancy between our results and those reported previously (38, 39) is due to strain differences.
In addition to norA and norB, the tetK efflux gene (COL SA0002) was found to be upregulated at 2 h. Furthermore, we found that two additional putative efflux pump genes (N315-SA2233 and SA2261) were upregulated and one (N315-SA0099) was downregulated by mgrA. Besides the efflux pump proteins, mgrA appears to regulate a plethora of transporter proteins and transmembrane proteins. These include sortase A (SrtA), preprotein transporter SecY, Na+/H+ antiporters, ABC transporters, amino acid transporters, ion transporters, a pyrimidine transporter, and sugar transporters. A total of about 50 genes in this group were either upregulated or downregulated by mgrA, suggesting that mgrA plays an important role in controlling various transport systems.
Secreted and cell wall-associated proteins are oppositely regulated by mgrA.
Mutation of mgrA has a profound effect on extracellular protein production (15, 24). In the current work, we found that mgrA positively affected 19 genes encoding secreted toxins, enzymes, and proteases (Table 2). Most noticeable among this group are genes in three loci encoding leukocidal toxins, which are bicomponent toxins composed of two components designated class S and class F. At least six S proteins and five F proteins have been identified in S. aureus (reviewed in reference 27). Four leukotoxin operons have been characterized to date: γ-hemolysin (hlgABC), pvl (lukSF-PV), lukED, and lukMF-PV. The genes are encoded in the chromosome. The pvl (Panton-Valentine leukocidin [PVL]) operon is carried by lysogenic phages and is associated with 2 to 3% of clinical isolates, whereas other genes are more frequently present (27). However, PVL has been linked to severe necrotizing infections such as pneumonia and necrotizing faciitis (reference 28 and references therein). Strain N315 contains hlg, lukFM, and lukDE in its chromosome in which lukDE is located within the pathogenicity island SaPIn3 (20). The lukFM and hlgA (separately transcribed with hlgBC) genes are upregulated by mgrA at 2 h, whereas the lukDE genes are profoundly upregulated at 5 h. In addition, lukDE is upregulated by the MgrA-overproducing strain at 2 h. Thus, MgrA can be considered to be a major regulator for leukotoxins. It would be of interest to know whether mgrA also regulates pvl in PVL-positive strains. Another notable cluster of secreted genes that is upregulated by mgrA is the spl operon encoding serine proteases SplABCDEF. Like the lukDE genes, spl genes are substantially upregulated at 5 h. Interestingly, both lukDE and splABCDF are located closely within SaPIn3 (20). To confirm the microarray results, we performed real-time RT-PCR to compare the transcription of lukD and splA genes in the wild-type strain, the mgrA mutant strain, and the MgrA-overproducing strain. Our results showed that splA and lukD were expressed about 54-fold and 30-fold less, respectively, in the mgrA deletion mutant than in the wild type (Table 4).
Our results showed that a total of 13 cell wall-anchored or cell surface-associated proteins were regulated by mgrA. These include protein A (Spa) and several putative cell wall proteins containing an LPXTG anchoring domain. In particular, Spa was highly regulated by mgrA at both 2 h and 5 h, a finding consistent with previous reports (15, 24). The cell wall proteins with an LPXTG domain are anchored to the cell wall by sortase A protein (encoded by srtA) (25). However, srtA was upregulated by mgrA (Table 2). Interestingly, our results also revealed that these cell wall-associated or cell surface-associated proteins, except SdrE, were repressed by mgrA (Table 3). Such regulation of cell surface proteins is in contrast to the mgrA regulation of secreted proteins in which all but one (exotoxin 3) was repressed by mgrA (see above). This mode of regulation is similar to that of agr regulation of these two groups of genes in which secreted exoproteins are activated and cell surface proteins are repressed by agr (31). The mechanism by which the agr locus transcriptionally regulates target genes is unknown. Based on the parallel between agr and mgrA, it is tempting to speculate that mgrA may interact with agr to regulate exoproteins and cell surface proteins. Indeed, it has been shown that mgrA mutations significantly reduced RNAIII, the effector of agr, and that mutations of agr slightly decreased mgrA expression (15, 16). However, these studies were conducted using derivatives of strain 8325-4, and therefore, whether the results can be extrapolated to strain Newman requires further studies.
Control of metabolic proteins by mgrA.
A number of proteins involved in metabolism are regulated by mgrA: 31 genes are upregulated, while 21 are downregulated. Several clusters within this group are highly repressed by mgrA, including the lac operon involved in the utilization of lactose, the urease genes encoded in the ure operon (contains eight genes, ureABCEFGD, and the putative urease transporter SA2081), and the arc genes (Table 3). Utilization of urea by urease produces ammonia, thereby enhancing bacterial acid resistance (29). The arc genes are involved in arginine degradation leading to energy generation as well as ammonia production that could render bacteria acid tolerant under anaerobic conditions (6). Although only the arcAB genes are listed in Table 3, the other three arc genes (arcDCR) in the same cluster were also repressed dramatically, but they did not meet the statistical cutoff used in this study. Both the ure and arc gene clusters have been shown to be induced in biofilms in which the bacteria are likely to be in an acidic environment (2, 33). Thus, in this context, it would be of interest to test whether mgrA affects biofilm formation. The expression of arcA was confirmed by quantitative RT-PCR (Table 4). MgrA also highly repressed the ddh gene encoding NAD+-dependent d-lactate dehydrogenase, which may be involved in low-level vancomycin resistance (4), suggesting that mgrA may affect vancomycin resistance. Other genes involved in biological processes that were regulated to a lesser extent by mgrA include genes involved in nucleotide synthesis: pyr genes (pyrRBC, pyrEF, and pyrG) required for pyrimidine synthesis, carAB for carbamoyl phosphate synthesis, purAB for purine synthesis, and guaAB for GMP synthesis. Interestingly, purB and guaAB are upregulated by mgrA, whereas all others genes involved in nucleotide metabolism are repressed by mgrA. It is noteworthy that the pyr gene cluster and the carAB genes were also induced in biofilm in the study by Beenken et al. (2) but not in the study by Resch et al. (33).
Regulators affected by mgrA.
One means by which mgrA achieves its global regulatory role is through the controlling of other regulators. We found that mgrA marginally upregulated sarA transcription (2.4-fold) when MgrA was overproduced after 5 h of incubation. SarA has been shown to control more than 100 genes (10). To verify these results, we performed real-time RT-PCR and confirmed that sarA transcription was elevated 3.4-fold in overproducing strain CYL907 but was not affected by mutation of mgrA (Table 4), consistent with the microarray results. Ingavale et al. (16) reported recently that sarA was not affected by mgrA deletion; however, no MgrA-overproducing strain was used in that study. SigB is an alternative sigma factor affecting well over 250 genes (3). We found that sigB and the antisigma factor (rsbW) were activated by mgrA to about the same extent when MgrA was overexpressed at 2 h but not at 5 h. Since both sarA and sigB are broad-spectrum regulators, some of the effects of mgrA on target genes could be indirect, via effects on these regulators. Two other sarA homologs, sarS and tcaR, with narrow target ranges were also regulated by mgrA. The sarS gene is an activator of spa, whereas the tcaR gene positively controls sarS (and thus spa) and sasF, a cell wall-anchored protein (8, 26, 37). Ingavale et al. have shown that MgrA binds to the sarS promoter and proposed that mgrA represses spa by repressing sarS (16). This is in agreement with our microarray data showing that mgrA repressed sarS at 2 h under conditions of MgrA overexpression (Table 3). However, our data also showed that tcaR was activated by mgrA at 5 h in the mgrA-deleted mutant compared to the wild type (Table 2). Since mgrA strongly downregulated spa at both 2 h and 5 h (Table 3), activation of tcaR by mgrA as shown by our microarray results is contradictory, suggesting that the regulation of spa by mgrA is more complicated than the model proposed previously by Ingavale et al. (16). Besides the regulators discussed above, mgrA also potentially regulated 10 additional putative transcriptional regulators (Tables 2 and 3). Thus, many of the genes found in this study could be mediated through these regulators and could therefore be indirectly regulated by mgrA. The expression of the tcaR gene was also verified by the real-time RT-PCR method (Table 4).
Conclusions.
The multigene regulator MgrA has previously been shown to influence the expression of a diverse set of target genes (15, 24, 39). In this report, we employed microarray technology to identify the genes and better characterize the biological processes that are modulated by mgrA. We found that, as expected, mgrA regulated a wide range of genes including metabolic genes that have not previously been determined to be regulated in an mgrA-dependent manner. In addition, we found 134 genes of unknown function that were regulated by mgrA. The total number of genes regulated by MgrA was remarkably large, making it the regulator with widest target gene spectrum among all staphylococcal global regulators characterized to date. Most of the mgrA target genes reported previously were confirmed in this study; however, some were not detected. Most notably, the hla gene encoding α-hemolysin was not detected. The discrepancy could be explained by strain differences. Indeed, we have shown that hla in strain Newman was slightly upregulated by mgrA but was repressed in strain Becker (16, 24). Previously, Ingavale et al. showed that hla was activated in the strain RN6390 background (16).
Gene profiling of several staphylococcal global regulators has been reported. These include agr, sarA, rot, sigB, and arl (3, 10, 22, 35). We now provide the profiling results of one more global regulatory gene, mgrA. A comparison of these profiling results is likely to provide insights into the regulatory network governing virulence gene regulation at the genomic level. Already, a pattern has emerged, namely, that agr and mgrA have similar effects on virulence gene regulation, whereas rot and sigB have the opposite effects. These analyses will undoubtedly lead to a greater understanding of the pathogenesis of this major human pathogen.
Acknowledgments
This work was supported by grant AI54607 from the National Institute of Allergy and Infectious Diseases.
REFERENCES
- 1.Arvidson, S., and K. Tegmark. 2001. Regulation of virulence determinants in Staphylococcus aureus. Int. J. Med. Microbiol. 291:159-170. [DOI] [PubMed] [Google Scholar]
- 2.Beenken, K. E., P. M. Dunman, F. McAleese, D. Macapagal, E. Murphy, S. J. Projan, J. S. Blevins, and M. S. Smeltzer. 2004. Global gene expression in Staphylococcus aureus biofilms. J. Bacteriol. 186:4665-4684. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bischoff, M., P. Dunman, J. Kormanec, D. Macapagal, E. Murphy, W. Mounts, B. Berger-Bächi, and S. Projan. 2004. Microarray-based analysis of the Staphylococcus aureus σB regulon. J. Bacteriol. 186:4085-4099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Boyle-Vavra, S., B. L. de Jonge, C. C. Ebert, and R. S. Daum. 1997. Cloning of the Staphylococcus aureus ddh gene encoding NAD+-dependent d-lactate dehydrogenase and insertional inactivation in a glycopeptide-resistant isolate. J. Bacteriol. 179:6756-6763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Brunskill, E. W., and K. W. Bayles. 1996. Identification and characterization of a putative regulatory locus that affects autolysis in Staphylococcus aureus. J. Bacteriol. 178:611-618. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Casiano-Colon, A., and R. E. Marquis. 1988. Role of the arginine deiminase system in protecting oral bacteria and an enzymatic basis for acid tolerance. Appl. Environ. Microbiol. 54:1318-1324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cheung, A. L., A. S. Bayer, G. Zhang, H. Gresham, and Y.-Q. Xiong. 2004. Regulation of virulence determinants in vitro and in vivo in Staphylococcus aureus. FEMS Immunol. Med. Microbiol. 40:1-9. [DOI] [PubMed] [Google Scholar]
- 8.Cheung, A. L., K. Schmidt, B. Bateman, and A. C. Manna. 2001. SarS, a SarA homolog repressible by agr, is an activator of protein A synthesis in Staphylococcus aureus. Infect. Immun. 69:2448-2455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Cramton, S. E., C. Gerke, N. F. Schnell, W. W. Nichols, and F. Götz. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun. 67:5427-5433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Dunman, P. M., E. Murphy, S. Haney, D. Palacios, G. Tucker-Kellogg, S. Wu, E. L. Brown, R. J. Zagursky, D. Shlaes, and S. J. Projan. 2001. Transcriptional profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci. J. Bacteriol. 183:7341-7353. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fournier, B., and D. C. Hooper. 2000. A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus. J. Bacteriol. 182:3955-3964. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Fournier, B., A. Klier, and G. Rapoport. 2001. The two-component system ArlS-ArlR is a regulator of virulence gene expression in Staphylococcus aureus. Mol. Microbiol. 41:247-261. [DOI] [PubMed] [Google Scholar]
- 13.Groicher, K. H., B. A. Firek, D. F. Fujimoto, and K. W. Bayles. 2000. The Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and penicillin tolerance. J. Bacteriol. 182:1794-1801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Huntzinger, E., S. Boisset, C. Saveanu, Y. Benito, T. Geissmann, A. Namane, G. Lina, J. Etienne, B. Ehresmann, C. Ehresmann, A. Jacquier, F. Vandenesch, and P. Romby. 2005. Staphylococcus aureus RNAIII and the endoribonuclease III coordinately regulate spa gene expression. EMBO J. 24:824-835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ingavale, S., W. van Wamel, and A. L. Cheung. 2003. Characterization of RAT, an autolysis regulator in Staphylococcus aureus. Mol. Microbiol. 48:1451-1466. [DOI] [PubMed] [Google Scholar]
- 16.Ingavale, S., W. van Wamel, T. T. Luong, C. Y. Lee, and A. L. Cheung. 2005. Rat/MgrA, a regulator of autolysis, is a regulator of virulence genes in Staphylococcus aureus. Infect. Immun. 73:1423-1431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kaatz, G. W., R. V. Thyagarajan, and S. M. Seo. 2005. Effect of promoter region mutations and mgrA overexpression on transcription of norA, which encodes a Staphylococcus aureus multidrug efflux transporter. Antimicrob. Agents Chemother. 49:161-169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Koenig, R. L., J. L. Ray, S. J. Maleki, M. S. Smeltzer, and B. K. Hurlburt. 2004. Staphylococcus aureus AgrA binding to the RNAIII-agr regulatory region. J. Bacteriol. 186:7549-7555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256. [DOI] [PubMed] [Google Scholar]
- 20.Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, et al. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225-1240. [DOI] [PubMed] [Google Scholar]
- 21.Lee, C. Y. 1992. Cloning of genes affecting capsule expression in Staphylococcus aureus strain M. Mol. Microbiol. 6:1515-1522. [DOI] [PubMed] [Google Scholar]
- 22.Liang, X., L. Zheng, C. Landwehr, D. Lunsford, D. Holmes, and Y. Ji. 2005. Global regulation of gene expression by ArlRS, a two-component signal transduction regulatory system of Staphylococcus aureus. J. Bacteriol. 187:5486-5492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520-532. [DOI] [PubMed] [Google Scholar]
- 24.Luong, T. T., S. W. Newell, and C. Y. Lee. 2003. mgr, a novel global regulator in Staphylococcus aureus. J. Bacteriol. 185:3703-3710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mazmanian, S. K., G. Liu, H. Ton-That, and O. Schneewind. 1999. Staphylococcus aureus sortase, an enzyme that anchors surface proteins to the cell wall. Science 285:760-763. [DOI] [PubMed] [Google Scholar]
- 26.McCallum, N., M. Bischoff, H. Maki, A. Wada, and B. Berger-Bächi. 2004. TcaR, a putative MarR-like regulator of sarS expression. J. Bacteriol. 186:2966-2972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Menestrina, G., M. Dalla Serra, M. Comai, M. Coraiola, G. Viero, S. Werner, D. Colin, H. Monteil, and G. Prévost. 2003. Ion channels and bacterial infection: the case of beta-barrel pore-forming protein toxins of Staphylococcus aureus. FEBS Lett. 552:54-60. [DOI] [PubMed] [Google Scholar]
- 28.Miller, L. G., F. Perdreau-Remington, G. Reig, S. Mehdi, J. Perlroth, A. S. Bayer, A. W. Tang, T. O. Phung, and B. Spellberg. 2005. Fourteen patients with necrotizing fasciitis caused by community-associated methicillin-resistant Staphylococcus aureus in Los Angeles. N. Engl. J. Med. 352:1445-1453. [DOI] [PubMed] [Google Scholar]
- 29.Mobley, H. L., M. D. Island, and R. P. Hausinger. 1995. Molecular biology of microbial ureases. Microbiol. Rev. 59:451-480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Morfeldt, E., D. Taylor, A. von Gabain, and S. Arvidson. 1995. Activation of alpha-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. EMBO J. 14:4569-4577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Novick, R. P. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol. Microbiol. 48:1429-1449. [DOI] [PubMed] [Google Scholar]
- 32.Oshida, T., M. Sugai, H. Komatsuzawa, Y. M. Hong, H. Suginaka, and A. Tomasz. 1995. A Staphylococcus aureus autolysin that has an N-acetylmuramoyl-L-alanine amidase domain and an endo-beta-N-acetylglucosaminidase domain: cloning, sequence analysis, and characterization. Proc. Natl. Acad. Sci. USA 92:285-289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Resch, A., R. Rosenstein, C. Nerz, and F. Gotz. 2005. Differential gene expression profiling of Staphylococcus aureus cultivated under biofilm and planktonic conditions. Appl. Environ. Microbiol. 71:2663-2676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Rice, K. C., B. A. Firek, J. B. Nelson, S.-J. Yang, T. G. Patton, and K. W. Bayles. 2003. The Staphylococcus aureus cidAB operon: evaluation of its role in the regulation of murein hydrolase activity and penicillin tolerance. J. Bacteriol. 185:2635-2643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Saïd-Salim, B., P. M. Dunman, F. M. McAleese, D. Macapagal, E. Murphy, P. J. McNamara, S. Arvidson, T. J. Foster, S. J. Projan, and B. N. Kreiswirth. 2003. Global regulation of Staphylococcus aureus genes by Rot. J. Bacteriol. 185:610-619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Sugai, M., T. Fujiwara, H. Komatsuzawa, and H. Suginaka. 1998. Identification and molecular characterization of a gene homologous to epr (endopeptidase resistance gene) in Staphylococcus aureus. Gene 224:67-75. [DOI] [PubMed] [Google Scholar]
- 37.Tegmark, K., A. Karlsson, and S. Arvidson. 2000. Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus. Mol. Microbiol. 37:398-409. [DOI] [PubMed] [Google Scholar]
- 38.Truong-Bolduc, Q. C., P. M. Dunman, J. Strahilevitz, S. J. Projan, and D. C. Hooper. 2005. MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J. Bacteriol. 187:2395-2405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Truong-Bolduc, Q. C., X. M. Zhang, and D. C. Hooper. 2003. Characterization of NorR protein, a multifunctional regulator of norA expression in Staphylococcus aureus. J. Bacteriol. 185:3127-3138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zhang, L., and G. Ji. 2004. Identification of a staphylococcal AgrB segment(s) responsible for group-specific processing of AgrD by gene swapping. J. Bacteriol. 186:6706-6713. [DOI] [PMC free article] [PubMed] [Google Scholar]