Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2003 Feb;185(3):823–830. doi: 10.1128/JB.185.3.823-830.2003

β-Lactamase Genes of the Penicillin-Susceptible Bacillus anthracis Sterne Strain

Yahua Chen 1, Janice Succi 1, Fred C Tenover 2, Theresa M Koehler 1,*
PMCID: PMC142833  PMID: 12533457

Abstract

Susceptibility to penicillin and other β-lactam-containing compounds is a common trait of Bacillus anthracis. β-lactam agents, particularly penicillin, have been used worldwide to treat anthrax in humans. Nonetheless, surveys of clinical and soil-derived strains reveal penicillin G resistance in 2 to 16% of isolates tested. Bacterial resistance to β-lactam agents is often mediated by production of one or more types of β-lactamases that hydrolyze the β-lactam ring, inactivating the antimicrobial agent. Here, we report the presence of two β-lactamase (bla) genes in the penicillin-susceptible Sterne strain of B. anthracis. We identified bla1 by functional cloning with Escherichia coli. bla1 is a 927-nucleotide (nt) gene predicted to encode a protein with 93.8% identity to the type I β-lactamase gene of Bacillus cereus. A second gene, bla2, was identified by searching the unfinished B. anthracis chromosome sequence database of The Institute for Genome Research for open reading frames (ORFs) predicted to encode β-lactamases. We found a partial ORF predicted to encode a protein with significant similarity to the carboxy-terminal end of the type II β-lactamase of B. cereus. DNA adjacent to the 5′ end of the partial ORF was cloned using inverse PCR. bla2 is a 768-nt gene predicted to encode a protein with 92% identity to the B. cereus type II enzyme. The bla1 and bla2 genes confer ampicillin resistance to E. coli and Bacillus subtilis when cloned individually in these species. The MICs of various antimicrobial agents for the E. coli clones indicate that the two β-lactamase genes confer different susceptibility profiles to E. coli; bla1 is a penicillinase, while bla2 appears to be a cephalosporinase. The β-galactosidase activities of B. cereus group species harboring bla promoter-lacZ transcriptional fusions indicate that bla1 is poorly transcribed in B. anthracis, B. cereus, and B. thuringiensis. The bla2 gene is strongly expressed in B. cereus and B. thuringiensis and weakly expressed in B. anthracis. Taken together, these data indicate that the bla1 and bla2 genes of the B. anthracis Sterne strain encode functional β-lactamases of different types, but gene expression is usually not sufficient to confer resistance to β-lactam agents.


Penicillin G, doxycycline, and ciprofloxacin have long been the drugs of choice for treatment of all forms of anthrax disease in humans (27). Combinations of these drugs were used to treat the recent U.S. cases (28, 13); yet, historically, penicillin has been the antimicrobial agent most commonly used for treating anthrax worldwide (29, 62). Susceptibility to penicillin and other β-lactam agents is often listed as a defining characteristic of B. anthracis (48, 62). However, antimicrobial susceptibility profiles of clinical and nonclinical isolates have revealed various prevalences of penicillin G-resistant strains. Tests of 50 historical Bacillus anthracis isolates and 15 isolates from the recent human anthrax cases in the United States indicate widespread susceptibility to β-lactam-containing compounds with one exception. Of the 65 strains tested, one strain, isolated from a human case of anthrax in 1974, was β-lactamase positive and penicillin resistant (47). In another survey, 7 of 44 isolates from carcasses and soil in an area of South Africa to which anthrax is endemic were resistant to penicillin G (51). A third survey of isolates recovered in France, including 1 isolate from a human, 28 from animal sources, and 67 from other environmental sources, revealed resistance to penicillin G and amoxicillin in 11.5% of the isolates (12).

The susceptibility of most B. anthracis strains to β-lactam agents is intriguing considering that closely related species are characteristically β-lactamase positive (10). B. anthracis is a member of the Bacillus cereus group species, which includes B. anthracis, B. cereus, Bacillus thuringiensis, and Bacillus mycoides. Numerous phylogenetic studies, including 16S rRNA gene comparisons, multienzyme electrophoresis, and amplified fragment length polymorphism analysis, indicate that B. anthracis is most closely related to B. cereus (6, 24, 61). The most obvious phenotypic differences between B. anthracis and B. cereus are related to pathogenicity. B. anthracis, the causative agent of anthrax, is a highly virulent mammalian pathogen (46), while B. cereus is better known as a causal agent of mild food poisoning (21). The virulence of B. anthracis has been attributed primarily to the presence of two plasmids that are not found in B. cereus. B. anthracis plasmid pXO1 carries the structural genes for the anthrax toxin proteins, while plasmid pXO2 harbors the biosynthetic genes for the antiphagocytic poly-d-glutamic acid capsule (42, 52).

Unlike those of B. anthracis, B. cereus strains commonly exhibit resistance to penicillin and other β-lactam agents. Three different β-lactamases, named β-lactamase I, II, and III, have been reported for various B. cereus strains. B. cereus strain 569/H is resistant to penicillins and cephalosporins and contains genes encoding all three enzymes. According to the classification scheme proposed by Bush (11), which groups β-lactamases on the basis of specific substrate and inhibitor profiles, B. cereus β-lactamase I and β-lactamase III are group 2A enzymes that prefer penicillin substrates and are inhibited by clavulanic acid (15, 16, 33, 50). B. cereus β-lactamase II is a group 3 enzyme, a heat-stable metallo-β-lactamase, that is not inhibited by clavulanic acid (8, 18, 25, 33, 34, 39). A β-lactamase I enzyme is also produced by the B. cereus group species B. thuringiensis (40, 65). Most B. mycoides strains are resistant to penicillin (J. Mahillon, personal communication), and a β-lactamase I gene has been cloned and sequenced (GenBank, accession no. X62244).

In work presented here, we report the presence of two β-lactamase genes in the Sterne strain of B. anthracis. The Sterne strain is a well-studied attenuated strain that serves as a live vaccine for animals (58). The Sterne strain does not produce capsule due to the absence of pXO2. With the exception of being cured of pXO2, this strain is considered to be a prototypical B. anthracis strain (59). It is sensitive to penicillin and does not exhibit β-lactamase activity. Our data indicate that the β-lactamase genes carried by this strain are not expressed in the Sterne strain but encode functional enzymes when cloned in other species.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

All bacterial strains and plasmids used in this study are listed in Table 1. Bacterial cultures were grown at 37°C in Luria-Bertani medium (LB) (7) containing antimicrobial agents at the following concentrations, when appropriate: for Escherichia coli, ampicillin, 100 μg/ml; chloramphenicol, 20 μg/ml; and kanamycin, 25 μg/ml; for Bacillus species, erythromycin, 5 μg/ml; and kanamycin, 100 μg/ml.

TABLE 1.

Plasmids and strains used in this study

Plasmid or strain Relevant characteristic(s)a Source or reference
Plasmids
    E. coli
        pACYC184 Cmr Tcr 14
        pGEM-T Easy Apr Promega
        pBC Cmr Stratagene
        pUC18::Ωkm-2 Apr Kmr 55
    Bifunctional
        pGC13 Apr in E. coli, Emr in bacilli 35
        pHT304-18Z Contains promoterless lacZ; Apr in E. coli, Emr in bacilli 3
        pUTE461 0.7-kb PCR product containing upstream region of bla1 (YC71-YC72) cloned into pHT304-18Z; bla1::lacZ; Apr Emr This work
        pUTE462 0.9-kb PCR product containing upstream region of bla2 (YC73-YC74) cloned into pHT304-18Z; bla2::lacZ; Apr Emr This work
        pUTE488 Contains a transcriptional terminator adjacent to multiple cloning site, Cmr in E. coli, Kmr in E. coli and Bacillus This work
        pUTE523 1.6-kb PCR product containing bla1 orf and upstream region (YC81-YC82) cloned downstream of transcriptional terminator in pUTE488; Kmr Cmr This work
        pUTE490 1.6-kb PCR product containing bla2 orf and upstream region (YC83-YC84) cloned downstream of transcriptional terminator in pUTE488; Kmr Cmr This work
Strains
    B. anthracis
        UM44b Sterne strain derivative, Aps 60
    B. cereus
        569 Apr 9
    B. thuringiensis
        AW43 Apr 63
    B. subtilis
        168 Aps BGSCc
    E. coli
        TG1 Cloning host, Aps 56
        GM2163 dam dcm 54
a

Abbreviations: Apr, ampicillin resistant; Aps, ampicillin sensitive; Cmr, chloramphenicol resistant; Emr, erythromycin resistant; Kmr, kanamycin resistant; Tcr, tetracycline resistant.

b

Weybridge (Sterne) strain derivative.

c

BGSC: Bacillus Genetic Stock Center, Columbus, Ohio.

DNA isolation and manipulation.

Standard techniques for plasmid and chromosomal DNA preparation and cloning were those described by Ausubel et al. (7). Plasmid DNA was introduced into B. anthracis, B. cereus, B. thuringiensis, and B. subtilis strains using electroporation as described previously (31). DNA for electroporation was obtained from the dam dcm E. coli strain GM2163 (54).

PCRs were performed using a PE Applied Biosystems (Norwalk, Conn.) PCR system 9700. A typical PCR mixture (50 μl) included 1× PCR buffer, primer (2 μM each), MgCl2 (1.5 mM), deoxynucleoside triphosphates (0.2 mM), DNA template (0.1 μg), and Taq DNA polymerase (2.5 U). The reactions were run for 30 cycles of 30 s at 94°C, 30 s at 55°C, and 2 min at 72°C. Primers are listed in Table 2. For inverse PCR, B. anthracis DNA was digested with a variety of restriction enzymes. Following ligation with T4 DNA ligase, the DNA was used as a template in PCRs with primers reading outward from known sequences. PCR products were cloned into the pGEM-T Easy vector (Promega, Madison, Wis.) for sequencing and further constructions.

TABLE 2.

Primers used in this study

Primer Sequence (5′-3′),a location PCR amplification Restriction site
YC71 AAGCTTCGGATTGATATGAAGACAGAA, from −624 to −604 nt upstream of bla1 start codon Forward primer for bla1 upstream region HindIII
YC72 GGATCCTTGCAATGCACCTCCTGTA, from 105 to 87 nt downstream of bla1 start codon Reverse primer for bla1 upstream region BamHI
YC73 AAGCTTCATTCCGGATCAAATAAGTGC, from −790 to −770 nt upstream of bla2 start codon Forward primer for bla2 upstream region HindIII
YC74 GGATCCTGCTCTACCTTTCGTTCTGC, from 104 to 85 nt downstream of bla2 start codon Reverse primer for bla2 upstream region BamHI
YC75 GGTACCTGCAGTCGACGAATTCCCGGGGATCCGGTG Forward primer for kanamycin-resistant gene and transcriptional terminator KpnI
YC76 GGTACCAGACATCTAAATCTAGGTAC Reverse primer for kanamycin-resistant gene and transcriptional terminator KpnI
YC81 GGATCCCGGATTGATATGAAGACAGAA, from −624 to −604 nt upstream of bla1 start codon Forward primer for bla1 gene BamHI
YC82 AAGAATCGCTTTCCAAGTTCA, from 55 to 38 nt downstream of bla1 stop codon Reverse primer for bla1 gene
YC83 GGATCCCATTCCGGATCAAATAAGTGC, from −790 to −770 nt upstream of bla2 start codon Forward primer for bla2 gene BamHI
YC84 GTAAAGTATGCATAGCTTCGC, from 72 to 52 nt downstream of bla2 stop codon Reverse primer for bla2 gene
BLA1-5 CATTGCAAGTTGAAGCGAAA, from 98 to 117 nt downstream of bla1 start codon Forward primer for RT-PCR of bla1 transcript
BLA1-6 TGTCCCGTAACTTCCAGCTC, from −142 to −161 nt upstream of bla1 stop codon Reverse primer for RT-PCR of bla1 transcript
BLA2-5 TTGTCGATTCTTCTTGGGATG, from 248 to 268 nt downstream of bla2 start codon Forward primer for RT-PCR of bla2 transcript
BLA2-6 CCCCTACTTCTCCATGACCA, from −39 to −58 nt upstream of bla2 stop codon Reverse primer for RT-PCR of bla2 transcript
a

Restriction enzyme recognition sites are underlined.

Restriction enzymes, T4 DNA ligase, and Taq polymerase were purchases from Promega or Gibco BRL (Rockville, Md.). DNA oligonucleotides were purchased from Sigma Genosys (The Woodlands, Tex.) or IDT (Coralville, Iowa).

Plasmid constructions.

In order to make plasmid constructions for antimicrobial susceptibility testing, a bifunctional vector was constructed. The 4-kb EcoRI fragment containing an erythromycin resistance gene and the B. thuringiensis plasmid replicon from pGC13 (35) were cloned into pBC (Stratagene, La Jolla, Calif.). Subsequently, the erythromycin resistance gene of the plasmid was replaced with a kanamycin resistance gene by replacing a KpnI fragment with a PCR product amplified from pUC18::Ωkm-2 using primers YC75 and YC76 (Table 2). The resulting plasmid, pUTE488 (see Fig. 2C), contained a T4 transcriptional terminator next to the multiple cloning sites, a chloramphenicol resistance gene for selection in E. coli, and a kanamycin resistance gene for selection in Bacillus. To construct plasmids for antimicrobial resistance tests and MIC assays, DNA sequences containing the bla1 and bla2 open reading frames (ORFs) including the upstream regions indicated above were amplified using the PCR with primers YC81 and YC82 (bla1) and YC83 and YC84 (bla2) (see Fig. 2 and Table 2). The PCR products were first cloned into the pGEM-T Easy vector and then subcloned into the BamHI and EcoRI sites of pUTE488 to generate pUTE523 and pUTE490.

FIG. 2.

FIG. 2.

Structural organization of the B. anthracis bla loci and cloning vector. (A) bla1 locus; (B) bla2 locus. Putative functions of proteins encoded by flanking ORFs are shown. Vertical lines represent potential stem-loop structures with ΔG values of −19.4 kcal/mol (upstream from bla1), −19.2 kcal/mol (downstream from bla1), −15.0 kcal/mol (upstream from bla2), and −21.8 kcal/mol (downstream from bla2). Cloned DNA regions are indicated. (C) Schematic representation of vector pUTE488. oriG+ and oriG− indicate origins functioning in gram-positive and gram-negative species, respectively.

To construct plasmids harboring promoter-lacZ transcriptional fusions, DNA fragments containing the 5′ ends and upstream sequences of bla1 and bla2 were amplified using the primers YC71 and YC73 (bla1) and YC73 and YC74 (bla2) (see Fig. 2 and Table 2). The 729-nucleotide (nt) PCR product for the bla1-lacZ construct included 624 nt upstream of the translational start codon for bla1. The PCR product for the bla2-lacZ construct included 790 nt upstream of bla2. PCR products were first cloned into the pGEM-T Easy vector and ultimately cloned into pHT304-18Z in the correct orientation to generate pUTE461 and pUTE462.

Selection of clones and antimicrobial susceptibility testing.

E. coli and B. subtilis isolates were grown overnight at 28°C with shaking at 200 rpm in LB containing appropriate antibiotics: chloramphenicol (20 μg/ml) for E. coli and kanamycin (100 μg/ml) for B. subtilis. One-hundred-microliter samples of cultures were spread on LB plates containing 100, 200, 400, or 800 μg of ampicillin per ml. Growth was assessed following 24 h at 37°C.

The MICs of various antimicrobial agents for E. coli isolates harboring the cloned bla genes were assessed by the NCCLS broth microdilution method using Mueller-Hinton broth (BD BioSciences, Sparks, Md.) as described previously (47).

RT-PCR.

All reagents for reverse transcription-PCR (RT-PCR) were purchased from Ambion (Austin, Tex.). Total RNA was isolated from mid-exponential-phase cultures (optical density of 1.0 at 600 nm) grown in LB medium at 37°C with shaking at 200 rpm. Cells were collected on GP Express membranes (Millipore, Bedford, Mass.) (pore size, 0.22 μm). RNAWIZ was used to isolate total RNA according to the manufacturer's instructions. Purified RNA was treated with the DNA-free kit. The treated RNA (1.0 μg) was subjected to RT using a RETROscript kit. The RT mixtures (1 to 5 μl) were used as templates for PCRs. Positive controls were genomic DNA from B. anthracis UM44. Negative controls included a no-RT sample and a no-template sample assembled for each reaction set. Internal primers were BLA1-5/-6 for bla1 and BLA2-5/-6 for bla2.

β-galactosidase assays.

Strains were grown at 37°C with shaking in LB containing erythromycin. Overnight cultures were diluted 1:100 in fresh medium and incubated as before. Samples were collected at various time points, and enzyme assays were performed as described previously (45), using toluene to permeabilize the cells. At least three independent cultures were assayed for enzyme activity. Figures show data from representative experiments.

Nucleotide sequence accession numbers.

DNA sequences of the bla1 and bla2 genes have been deposited in GenBank (AF367983 and AF367984).

RESULTS

The penicillin-susceptible Sterne strain of B. anthracis encodes two β-lactamase genes.

We used two different approaches to find β-lactamase (bla) genes in B. anthracis. First, we selected for functional bla genes by cloning random fragments of chromosomal DNA from B. anthracis UM44 (an auxotrophic mutant of the Sterne strain) into E. coli and selecting for ampicillin-resistant clones. B. anthracis DNA was digested with a variety of restriction enzymes and ligated into plasmid pACYC184, an E. coli cloning vector that does not carry a bla gene (14). The ligation mixtures were transformed into E. coli TG1, and clones were selected on agar containing ampicillin. One ampicillin-resistant transformant was obtained. This clone carried a 5.5-kb EcoRI fragment from B. anthracis. Sequence analysis revealed that the cloned DNA contained a 927-nt ORF predicted to encode a protein that is 87 to 93% identical to the β-lactamase I enzymes of B. cereus, B. thuringiensis, and B. mycoides. This ORF was designated bla1.

A second apparent bla gene was discovered by searching the unfinished B. anthracis genome database of The Institute for Genome Research (TIGR) (http://tigrblast.tigr.org/ufmg/) for ORFs predicted to encode β-lactamases. In addition to finding sequences representing bla1, we found a partial ORF predicted to encode a protein with strong sequence similarity to the carboxy-terminal end of the B. cereus β-lactamase II enzyme. DNA adjacent to the 5′ end of this B. anthracis ORF was cloned from UM44 using inverse PCR. DNA sequence analysis revealed a 768-nt ORF predicted to encode a protein that is 92% identical to B. cereus β-lactamase II. We designated this ORF bla2. The relatedness of the predicted B. anthracis β-lactamases to the enzymes from B. cereus, B. mycoides, and B. thuringiensis strains is depicted in Fig. 1.

FIG. 1.

FIG. 1.

Relatedness of β-lactamases from B. cereus group species. The dendrogram is based on the alignment of the predicted amino acid sequences. The GCG software of the Genetic Computing Group (Madison, Wis.) was used to generate the phylogenetic tree. Bla1 = type I; Bla2 = type II; Bla3 = type III. Bc, B. cereus; Bm, B. mycoides; Bt, B. thuringiensis; Ba, B. anthracis.

The structural organization of the bla1 and bla2 genes from B. anthracis is shown in Fig. 2. The bla genes are located at distinct loci on the B. anthracis chromosome. The orientations of flanking ORFs and the potential for stem-loop structures followed by U tracks indicate that expression of bla1 and bla2 would result in monocistronic transcripts. An ORF predicted to encode a 529-amino acid protein with 69% similarity to PbpA, a 716-amino-acid penicillin-binding protein of B. subtilis (49), is located upstream of bla1. An ORF predicted to encode a 198-amino acid protein with 58% similarity to B. subtilis YwoA, a 193-amino-acid protein similar to bacteriocin transport permease (32), is downstream of bla1 and in the opposite orientation. The bla2 gene is downstream of an ORF predicted to encode a 229-amino-acid protein with 41% similarity to the Brucella melitensis lysozyme M1 (17). An ORF predicted to encode a 353-amino-acid protein of unknown function is located downstream of bla2 and in the opposite direction.

The B. anthracis bla genes confer ampicillin resistance to E. coli and B. subtilis.

To further test whether the bla1 and bla2 genes encode functional β-lactamases, we subcloned bla1 and bla2, including upstream sequences (as indicated in Fig. 2), individually into the bifunctional vector pUTE488. This vector has a transcription termination sequence immediately upstream from the cloning site, so transcription of cloned genes is dependent upon native promoters. E. coli TG1 and B. subtilis 168 harboring pUTE488 (vector), pUTE523 (bla1), and pUTE490 (bla2) were tested for the ability to grow on LB agar containing different concentrations of ampicillin. E. coli clones harboring either bla1 or bla2 grew on agar medium containing up to 800 μg of ampicillin per ml. B. subtilis clones carrying bla1 or bla2 grew on medium containing up to 200 μg of ampicillin per ml. In contrast, B. anthracis UM44 isolates harboring the constructs were unable to grow on medium containing 100 μg of ampicillin per ml. These results indicate that the B. anthracis Sterne bla1 and bla2 genes encode functional proteins and have endogenous promoters that are active in E. coli and B. subtilis.

The B. anthracis bla genes are transcribed in other B. cereus group species.

We could not assess B. anthracis bla gene function in the closely related species B. cereus and B. thuringiensis by testing for ampicillin resistance because these species harbor their own bla genes (see Fig. 1) and are already resistant to β-lactam antibiotics. Therefore, we compared bla promoter activity in B. anthracis and other Bacillus cereus group species by measuring β-galactosidase activity produced by isolates harboring plasmid-borne bla1- and bla2-lacZ transcriptional fusions. The reporter fusions were constructed by cloning upstream regions of the genes (as indicated in Fig. 2) adjacent to a promoterless lacZ gene in pHT304-18Z (2). This vector has an estimated copy number of three to five in B. thuringiensis (5). The vector and reporter plasmids, pUTE461 (bla1) and pUTE462 (bla2), were electroporated into B. anthracis UM44, B. cereus 569, and B. thuringiensis AW43.

As expected, relatively little β-galactosidase activity was produced by B. anthracis UM44 isolates harboring the vector alone or the vector-borne bla-lacZ fusions. In multiple experiments, less than one Miller unit of enzyme activity was detected throughout growth in batch culture. These results were consistent with the inability to detect bla gene transcripts in RNA preparations from B. anthracis UM44 using RT-PCR (data not shown). Higher levels of enzyme activity were observed in cultures of the other species. For each isolate tested, enzyme activity was highest at late-exponential phase. A representative comparison of β-galactosidase activities at late-exponential phase for different strains harboring the bla-lacZ fusion plasmids is shown in Fig. 3. No significant bla1 expression was observed with B. cereus and B. thuringiensis isolates carrying the bla1-lacZ fusion. The low levels of β-galactosidase activity (1.2 to 1.6 Miller units) produced by isolates harboring the bla1-lacZ fusion were comparable to those for the same isolates harboring the vector alone. In contrast to bla1 expression, the β-galactosidase activities of B. cereus and B. thuringiensis isolates harboring bla2-lacZ fusions were significantly higher than those for isolates containing the vector. In multiple experiments, the β-galactosidase activities of the B. cereus strain carrying the bla2-lacZ fusion was 4.5- to 8.1-fold higher than the background activity. The enzyme activity of the B. thuringiensis strain carrying the bla2-lacZ fusion was 6.9- to 8.9-fold higher than the background level. These data indicate that while the B. anthracis bla genes are poorly transcribed in the parent strain, they are highly expressed in other Bacillus species.

FIG. 3.

FIG. 3.

bla1 and bla2 transcription in B. cereus group species. Isolates harbored pHT304-18Z (vector), pUTE461 (bla1::lacZ), or pUTE462 (bla2::lacZ) as indicated. Ba, B. anthracis; Bc, B. cereus; Bt, B. thuringiensis. β-galactosidase activity was determined following 7 h of incubation at 37°C with shaking at 200 rpm, when the cultures were in late log phase. Data shown are representative of at least three experiments.

The antimicrobial susceptibility profiles of E. coli clones harboring B. anthracis bla1 and bla2 differ.

E. coli clones harboring plasmid-encoded bla1 and bla2 were tested for the ability to grow in the presence of a number of β-lactam agents. Results are shown in Table 3. The MICs of ceftazidime, cefpodoxime, cefotaxime, and ceftriaxone were significantly higher for E. coli carrying bla2 than for E. coli harboring bla1. In addition, the MIC of ampicillin for the bla1 clone was higher than that for the bla2 clone. These data indicate that the enzymes encoded by bla1 and bla2 have different substrate specificities.

TABLE 3.

Minimal inhibitory concentrationsa of antibiotics for E. coli TG1 harboring cloned B. anthracis bla1 or bla2 genes

Antibiotic/inhibitor (concn) MIC of drug for bacteria with:
Vector (pUTE488) bla1 (pUTE523) bla2 (pUTE490)
Ampicillin 2 >64 8
Amoxicillin/clavulanate 4 32 32
Cefazolin 1 1 2
Cefepime ≤0.03 ≤0.03 ≤0.03
Cefoxitin 2 2 4
Cefotetan <1 <1 <1
Ceftazidime 0.12 0.12 0.5
Cefpodoxime 0.5 0.5 4
Cefpodoxime/clavulanate (4 μg/ml) 0.25 0.25 4
Cefotaxime ≤0.03 ≤0.03 1.0
Ceftriaxone ≤0.06 ≤0.06 0.25
Imipenem ≤0.12 ≤0.12 ≤0.12
Meropenem ≤0.25 ≤0.25 ≤0.25
Piperacillin ≤2 8 ≤2
Piperacillin/tazobactam (4 μg/ml) ≤1 ≤1 ≤1
Chloramphenicol >32 >32 >32
a

Given in micrograms/milliliter.

DISCUSSION

Our studies indicate that the penicillin-susceptible Sterne strain of B. anthracis harbors two genes, bla1 and bla2, that encode functional β-lactamases when cloned in other species. An E. coli clone harboring bla1 shows enhanced activity only against ampicillin, suggesting that this enzyme is a penicillinase. This is consistent with the activity reported for the Class A β-lactamase, bla1, of B. cereus (33). An E. coli clone harboring bla2, however, shows increased resistance to several cephalosporins, including cefpodoxime, cefotaxime, and ceftriaxone. The bla2-associated activity is not inhibited by clavulanic acid, which is consistent with the presence of a class B or class C cephalosporinase (11). Interestingly, the MICs of the cephamycins, cefotetan and cefoxitin, for the bla2 clone are unchanged, which is unusual for cephalosporinases. Taken together, our data indicate that the activities of the bla1 and bla2 β-lactamases differ, and the bla2 product may have novel features.

The bla genes are most likely a common feature of the B. anthracis genome and not simply an anomaly of the Sterne strain chosen for this study. Keim et al. have reported an exceedingly low degree of strain diversity for B. anthracis strains from numerous geographic locations (30). A comprehensive search for the presence of the bla genes in B. anthracis isolates has not been performed. However, we have found the bla1 and bla2 genes in the penicillin-susceptible Pasteur strain of B. anthracis using PCR amplification (data not shown). Also, current sequences in the unfinished B. anthracis genomic sequence database of TIGR (http://tigrblast.tigr.org/ufmg) indicate the presence of bla1 and bla2 sequences in the genomic sequence of the penicillin-susceptible Ames strain. The sequence of both bla genes of Ames is identical to those from Sterne. The annotated genome of B. anthracis Ames also shows that there are more than 10 proteins with similarity to metallo-β-lactamases. However, none of them are predicted to be secreted proteins.

Why are the bla genes of B. anthracis Sterne not expressed? Induction of bla gene expression in the β-lactamase-positive B. cereus 569 has long been recognized. However, the genetic basis has not been investigated. Imsande suggested a universal mechanism for regulation of β-lactamase synthesis in gram-positive bacteria (26). Recently, studies of regulation systems for β-lactamase synthesis in Bacillus licheniformis and staphylococci have yielded substantial breakthroughs (19, 64). For these organisms, three genes (blaI, blaR1, and blaR2) are involved in the regulation of the β-lactamase structural gene. With the exception of blaR2, whose presence rests only on genetic evidence, these genes are at a common chromosomal locus, forming a divergeon. Production of β-lactamase is regulated by the sensor-transducer, BlaR1, and the repressor, BlaI, which blocks transcription of the β-lactamase gene. When a β-lactam agent binds to the extracellular sensor domain of BlaR1, the cytoplasmic transducer domain is proteolytically cleaved. The transducer is then free to cleave and inactivate the BlaI repressor, and the transcription of the β-lactamase gene ensues (37, 64). A blaI homolog and a truncated blaR1 gene are present in B. anthracis genome; however, they are not linked to either bla gene. The potential relationship of these genes to bla gene control for B. anthracis will be addressed in future investigations.

The presence of silent β-lactamase genes in B. anthracis is intriguing in the context of the B. anthracis genome as a whole. Preliminary analysis of the B. anthracis genomic sequence database of TIGR and several published reports indicate the presence of numerous ORFs in B. anthracis that have the potential to encode proteins associated with distinct phenotypes of other B. cereus group species (T. D. Read et al., submitted for publication). However, these ORFs appear to be nontranscribed in B. anthracis. For example, flagellar genes are located in the B. anthracis genome, yet unlike B. cereus and B. thuringiensis, B. anthracis is nonmotile. ORFs predicted to encode proteins with significant similarity to certain B. cereus virulence factors, such as enterotoxins (4, 23), can be found in the B. anthracis genome, but there are no reports indicating synthesis of these proteins by natural isolates of B. anthracis. For some B. anthracis genes, lack of expression has been attributed to the presence of a nonfunctional transcriptional activator, PlcR. For B. cereus and B. thuringiensis, PlcR controls numerous genes with known or predicted roles in virulence (1, 36, 41, 53). The plcR gene of B. anthracis contains a frameshift mutation that results in synthesis of a truncated protein (1). Mignot et al. (44) reported that expression of a functional plcR gene in B. anthracis results in transcriptional activation of genes weakly expressed in the absence of the regulator. Nevertheless, the absence of functional plcR in B. anthracis is most likely not the reason for low-level expression of the B. anthracis bla genes. DNA sequences upstream of bla1 and bla2 do not appear to contain PlcR binding sites.

The genetic basis for β-lactamase activity in uncommon penicillin-resistant B. anthracis isolates is not known. For some penicillin-resistant strains, synthesis of β-lactamase appears to be constitutive. However, there are reports of induction of β-lactamase activity in vitro in certain strains. Lightfoot and colleagues (38) reported β-lactamase activity for three penicillin-susceptible strains following growth in subinhibitory concentrations of flucloxacillin. It is not clear to what extent, if any, strains can be induced to produce β-lactamase activity in vivo. Notably, treatment of anthrax with penicillin is not always successful (22, 43), and the use of penicillin for prophylaxis and treatment of anthrax in experimental animals has had various outcomes (20, 57). Further investigations of bla gene expression in B. anthracis will likely impact future revisions in treatment guidelines for anthrax. Moreover, studies of bla gene expression with B. anthracis and the other B. cereus group species will provide insight into the different gene expression patterns of these closely related bacteria.

Acknowledgments

This work was supported by Public Health Service Grant AI33537 from the National Institutes of Health to T.K.

We thank Patti Raney and Jasmine Mohammed for technical assistance. We are grateful to Tim Read of The Institute for Genomic Research for making sequence data available prior to publication. Sequencing of the B. anthracis Ames chromosome was accomplished with support from Office of Naval Research, the Department of Energy, and the National Institute of Allergy and Infectious Diseases. We thank Timothy Palzkill and Edward Nikonowicz for critical reading of the manuscript.

REFERENCES

  • 1.Agaisse, H., M. Gominet, O. A. Okstad, A. B. Kolsto, and D. Lereclus. 1999. PlcR is a pleiotropic regulator of extracellular virulence factor gene expression in Bacillus thuringiensis. Mol. Microbiol 32:1043-1053. [DOI] [PubMed] [Google Scholar]
  • 2.Agaisse, H., and D. Lereclus. 1996. STAB-SD: a Shine-Dalgarno sequence in the 5′ untranslated region is a determinant of mRNA stability. Mol. Microbiol. 20:633-643. [DOI] [PubMed] [Google Scholar]
  • 3.Agaisse, H., and D. Lereclus. 1994. Structural and functional analysis of the promoter region involved in full expression of the cryIIIA toxin gene of Bacillus thuringiensis. Mol. Microbiol 13:97-107. [DOI] [PubMed] [Google Scholar]
  • 4.Agata, N., M. Ohta, Y. Arakawa, and M. Mori. 1995. The bceT gene of Bacillus cereus encodes an enterotoxic protein. Microbiology 141:983-988. [DOI] [PubMed] [Google Scholar]
  • 5.Arantes, O., and D. Lereclus. 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108:115-119. [DOI] [PubMed] [Google Scholar]
  • 6.Ash, C., J. A. Farrow, M. Dorsch, E. Stackebrandt, and M. D. Collins. 1991. Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol. 41:343-346. [DOI] [PubMed] [Google Scholar]
  • 7.Ausubel, F. M. (ed.). 1993. Current protocols in molecular biology. Wiley Interscience, New York, N.Y.
  • 8.Baldwin, G. S., G. F. Edwards, P. A. Kiener, M. J. Tully, S. G. Waley, and E. P. Abraham. 1980. Production of a variant of β-lactamase II with selectively decreased cephalosporinase activity by a mutant of Bacillus cereus 569/H/9. Biochem. J. 191:111-116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Battisti, L., B. D. Green, and C. B. Thorne. 1985. Mating system for transfer of plasmids among Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis. J. Bacteriol. 162:543-550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bernhard, K., H. Schrempf, and W. Goebel. 1978. Bacteriocin and antibiotic resistance plasmids in Bacillus cereus and Bacillus subtilis. J. Bacteriol. 133:897-903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cavallo, J. D., F. Ramisse, M. Girardet, J. Vaissaire, M. Mock, and E. Hernandez. 2002. Antibiotic susceptibilities of 96 isolates of Bacillus anthracis isolated in France between 1994 and 2000. Antimicrob. Agents Chemother. 46:2307-2309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Centers for Disease Control and Prevention. 2001. Update: investigation of bioterrorism-reported anthrax and interim guidelines for exposure management and antimicrobial therapy, October 2001. Morbid. Mortal. Wkly. Rep. 50:909-919. [PubMed] [Google Scholar]
  • 14.Chang, A. C., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:1141-1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Citri, N., A. Samuni, and N. Zyk. 1976. Acquisition of substrate-specific parameters during the catalytic reaction of penicillinase. Proc. Natl. Acad. Sci. USA 73:1048-1052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Connolly, A. K., and S. G. Waley. 1983. Characterization of the membrane β-lactamase in Bacillus cereus 569/H/9. Biochemistry 22:4647-4651. [DOI] [PubMed] [Google Scholar]
  • 17.DelVecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. Ivanova, I. Anderson, A. Bhattacharyya, A. Lykidis, G. Reznik, L. Jablonski, N. Larsen, M. D'Souza, A. Bernal, M. Mazur, E. Goltsman, E. Selkov, P. H. Elzer, S. Hagius, D. O'Callaghan, J. J. Letesson, R. Haselkorn, N. Kyrpides, and R. Overbeek. 2002. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. USA 99:443-448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Felici, A., G. Amicosante, A. Oratore, R. Strom, P. Ledent, B. Joris, L. Fanuel, and J. M. Frere. 1993. An overview of the kinetic parameters of class B β-lactamases. Biochem. J. 291:151-155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Filee, P., K. Benlafya, M. Delmarcelle, G. Moutzourelis, J. M. Frere, A. Brans, and B. Joris. 2002. The fate of the BlaI repressor during the induction of the Bacillus licheniformis BlaP β-lactamase. Mol. Microbiol. 44:685-694. [DOI] [PubMed] [Google Scholar]
  • 20.Friedlander, A. M., S. L. Welkos, M. L. Pitt, J. W. Ezzell, P. L. Worsham, K. J. Rose, B. E. Ivins, J. R. Lowe, G. B. Howe, P. Mikesell, et al. 1993. Postexposure prophylaxis against experimental inhalation anthrax. J. Infect. Dis. 167:1239-1243. [DOI] [PubMed] [Google Scholar]
  • 21.Gaur, A. H., and J. L. Shenep. 2001. The expanding spectrum of disease caused by Bacillus cereus. Pediatr. Infect. Dis. J. 20:533-534. [DOI] [PubMed] [Google Scholar]
  • 22.Gold, H. 1967. Treatment of anthrax. Fed. Proc. 26:1563-1568. [PubMed] [Google Scholar]
  • 23.Granum, P. E., and T. Lund. 1997. Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Lett. 157:223-228. [DOI] [PubMed] [Google Scholar]
  • 24.Helgason, E., O. A. Okstad, D. A. Caugant, H. A. Johansen, A. Fouet, M. Mock, I. Hegna, and A.-B. Kolsto. 2000. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis—one species on the basis of genetic evidence. Appl. Environ. Microbiol. 66:2627-2630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hussain, M., A. Carlino, M. J. Madonna, and J. O. Lampen. 1985. Cloning and sequencing of the metallothioprotein β-lactamase II gene of Bacillus cereus 569/H in Escherichia coli. J. Bacteriol. 164:223-229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Imsande, J. 1970. Regulation of penicillinase synthesis: evidence for a unified model. J. Bacteriol. 101:173-180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Inglesby, T. V., T. O'Toole, D. A. Henderson, J. G. Bartlett, M. S. Ascher, E. Eitzen, A. M. Friedlander, J. Gerberding, J. Hauer, J. Hughes, J. McDade, M. T. Osterholm, G. Parker, T. M. Perl, P. K. Russell, and K. Tonat. 2002. Anthrax as a biological weapon, 2002: updated recommendations for management. JAMA 287:2236-2252. [DOI] [PubMed] [Google Scholar]
  • 28.Jernigan, J. A., D. S. Stephens, D. A. Ashford, C. Omenaca, M. S. Topiel, M. Galbraith, M. Tapper, T. L. Fisk, S. Zaki, T. Popovic, R. F. Meyer, C. P. Quinn, S. A. Harper, S. K. Fridkin, J. L. Sejvar, C. W. Shepard, M. McConnell, J. Guarner, W.-J. Shieh, J. M. Malecki, J. L. Gerberding, J. M. Hughes, and B. A. Perkins. 2001. Bioterrorism-related inhalational anthrax: the first 10 cases reported in the United States. Emerg. Infect. Dis. 7:933-944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jones, M. N., R. J. Beedham, P. C. B. Turnbull, and R. J. Manchee. 1995. Antibiotic prophylaxis for inhalation anthrax, vol. 87. Salisbury Medical Society, Winchester, England.
  • 30.Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J. Bacteriol. 182:2928-2936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Koehler, T. M., Z. Dai, and M. Kaufman-Yarbray. 1994. Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription from one of two promoters. J. Bacteriol. 176:586-595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256. [DOI] [PubMed] [Google Scholar]
  • 33.Kuwabara, S., and E. P. Abraham. 1967. Some properties of two extracellular β-lactamases from Bacillus cereus 569/H. Biochem. J. 103:27C-30C. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kuwabara, S., and P. H. Lloyd. 1971. Protein and carbohydrate moieties of a preparation of β-lactamase II. Biochem. J. 124:215-220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Leonard, C., O. Zekri, and J. Mahillon. 1998. Integrated physical and genetic mapping of Bacillus cereus and other gram-positive bacteria based on IS231A transposition vectors. Infect. Immun. 66:2163-2169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lereclus, D., H. Agaisse, M. Gominet, S. Salamitou, and V. Sanchis. 1996. Identification of a Bacillus thuringiensis gene that positively regulates transcription of the phosphatidylinositol-specific phospholipase C gene at the onset of the stationary phase. J. Bacteriol. 178:2749-2756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lewis, R. A., S. P. Curnock, and K. G. Dyke. 1999. Proteolytic cleavage of the repressor (BlaI) of β-lactamase synthesis in Staphylococcus aureus. FEMS Microbiol. Lett. 178:271-275. [DOI] [PubMed] [Google Scholar]
  • 38.Lightfoot, N. F., R. J. D. Scott, and P. C. B. Turnbull. 1990. Antimicrobial susceptibility of Bacillus anthracis: proceedings of the International Workshop on Anthrax. Salisbury Med. Bull. 68:95-98. [Google Scholar]
  • 39.Lim, H. M., J. J. Pene, and R. W. Shaw. 1988. Cloning, nucleotide sequence, and expression of the Bacillus cereus 5/B/6 β-lactamase II structural gene. J. Bacteriol. 170:2873-2878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lovgren, A., C. R. Carlson, K. Eskils, and A. B. Kolsto. 1998. Localization of putative virulence genes on a physical map of the Bacillus thuringiensis subsp. gelechiae chromosome. Curr. Microbiol. 37:245-250. [DOI] [PubMed] [Google Scholar]
  • 41.Lund, T., M. L. De Buyser, and P. E. Granum. 2000. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol. Microbiol. 38:254-261. [DOI] [PubMed] [Google Scholar]
  • 42.Makino, S.-I., I. Uchida, N. Terakado, C. Sasakawa, and M. Yoshikawa. 1989. Molecular characterization and protein analysis of the cap region, which is essential for encapsulation in Bacillus anthracis. J. Bacteriol. 171:722-730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.McSwiggan, D. A., K. K. Hussain, and I. O. Taylor. 1974. A fatal case of cutaneous anthrax. J. Hyg. (London) 73:151-156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Mignot, T., M. Mock, D. Robichon, A. Landier, D. Lereclus, and A. Fouet. 2001. The incompatibility between the PlcR- and AtxA-controlled regulons may have selected a nonsense mutation in Bacillus anthracis. Mol. Microbiol. 42:1189-1198. [DOI] [PubMed] [Google Scholar]
  • 45.Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 46.Mock, M., and A. Fouet. 2001. Anthrax. Annu. Rev. Microbiol. 55:647-671. [DOI] [PubMed] [Google Scholar]
  • 47.Mohammed, M. J., C. K. Marston, T. Popovic, R. S. Weyant, and F. C. Tenover. 2002. Antimicrobial susceptibility testing of Bacillus anthracis: comparison of results obtained by using the National Committee for Clinical Laboratory Standards broth microdilution reference and Etest agar gradient diffusion methods. J. Clin. Microbiol. 40:1902-1907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Murray, P. R., K. S. Rosenthal, G. S. Kobayashi, and M. A. Pfaller (ed.). 1998. Medical Microbiology, 3rd ed. Mosby, Inc., St. Louis, Mo.
  • 49.Murray, T., D. L. Popham, C. B. Pearson, A. R. Hand, and P. Setlow. 1998. Analysis of outgrowth of Bacillus subtilis spores lacking penicillin-binding protein 2a. J. Bacteriol. 180:6493-6502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Nielsen, J. B., and J. O. Lampen. 1983. β-Lactamase III of Bacillus cereus 569: membrane lipoprotein and secreted protein. Biochemistry 22:4652-4656. [DOI] [PubMed] [Google Scholar]
  • 51.Odendaal, M. W., P. M. Pieterson, V. de Vos, and A. D. Botha. 1991. The antibiotic sensitivity patterns of Bacillus anthracis isolated from the Kruger National Park. Onderstepoort J. Vet. Res. 58:17-19. [PubMed] [Google Scholar]
  • 52.Okinaka, R. T., K. Cloud, O. Hampton, A. Hoffmaster, K. K. Hill, P. Keim, T. M. Koehler, G. Lamke, S. Kumano, J. Mahillon, D. Manter, Y. Martinez, D. Ricke, R. Svensson, and P. J. Jackson. 1999. The sequence and organization of pXO1, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J. Bacteriol. 181:6509-6515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Okstad, O. A., M. Gominet, B. Purnelle, M. Rose, D. Lereclus, and A. B. Kolsto. 1999. Sequence analysis of three Bacillus cereus loci carrying PlcR-regulated genes encoding degradative enzymes and enterotoxin. Microbiology 145:3129-3138. [DOI] [PubMed] [Google Scholar]
  • 54.Palmer, B. R., and M. G. Marinus. 1994. The dam and dcm strains of Escherichia coli—a review. Gene 143:1-12. [DOI] [PubMed] [Google Scholar]
  • 55.Perez-Casal, J., M. G. Caparon, and J. R. Scott. 1991. Mry, a trans-acting positive regulator of the M protein gene of Streptococcus pyogenes with similarity to the receptor proteins of two-component regulatory systems. J. Bacteriol. 173:2617-2624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 57.Shafazand, S., R. Doyle, S. Ruoss, A. Weinacker, and T. A. Raffin. 1999. Inhalational anthrax: epidemiology, diagnosis, and management. Chest 116:1369-1376. [DOI] [PubMed] [Google Scholar]
  • 58.Sterne, M. 1939. The use of anthrax vaccines prepared from avirulent (uncapsulated) variants of Bacillus anthracis. Onderstepoort J. Vet. Sci. Anim. Ind. 13:307-312. [Google Scholar]
  • 59.Thorne, C. B. 1993. Bacillus anthracis, p. 113-124. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.
  • 60.Thorne, C. B. 1985. Genetics of Bacillus anthracis, p. 56-62. In L. Leive (ed.), Microbiology. American Society for Microbiology, Washington, D.C.
  • 61.Ticknor, L. O., A. B. Kolsto, K. K. Hill, P. Keim, M. T. Laker, M. Tonks, and P. J. Jackson. 2001. Flourescent amplified fragment length polymorphism analysis of Norwegian Bacillus cereus and Bacillus thuringiensis soil isolates. Appl. Environ. Microbiol. 67:4863-4873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Turnbull, P. C. B. 1996. Bacillus, p. 233-246. In S. Baron (ed.), Medical microbiology, 4th ed. The University of Texas Medical Branch at Galveston, Galveston. [PubMed]
  • 63.Wilcks, A., N. Jayaswal, D. Lereclus, and L. Andrup. 1998. Characterization of plasmid pAW63, a second self-transmissible plasmid in Bacillus thuringiensis subsp. kurstaki HD73. Microbiology 144:1263-1270. [DOI] [PubMed] [Google Scholar]
  • 64.Zhang, H. Z., C. J. Hackbarth, K. M. Chansky, and H. F. Chambers. 2001. A proteolytic transmembrane signaling pathway and resistance to β-lactams in Staphylococci. Science 291:1962-1965. [DOI] [PubMed] [Google Scholar]
  • 65.Zhang, M. Y., and A. Lovgren. 1995. Cloning and sequencing of a β-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis. Gene 158:83-86. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES