Induction of Emetic Response to Staphylococcal Enterotoxins in the House Musk Shrew (Suncus murinus)

Abstract

The emetic responses induced by staphylococcal enterotoxin A (SEA), SEB, SEC2, SED, SEE, SEG, SEH, and SEI in the house musk shrew (Suncus murinus) were investigated. SEA, SEE, and SEI showed higher emetic activity in the house musk shrew than the other SEs. SEB, SEC2, SED, SEG, and SEH also induced emetic responses in this animal model but relatively high doses were required. The house musk shrew appears to be a valuable model for studying the mechanisms of emetic reactions caused by SEs.

Staphylococcal enterotoxins (SEs) are exotoxins produced by Staphylococcus aureus that cause staphylococcal food poisoning in humans (2, 4, 9). Five major serological types, SEA, SEB, SEC, SED, and SEE, have been characterized (2, 4, 25). Recently, many new SEs (SEG, SEH, SEI, SEJ, SEK, SEL, SEM, SEN, SEO, SEP, and SEQ) have been identified (12, 15, 17, 22, 24, 26, 29, 30). In addition, SEs are members of the pyrogenic toxin superantigens (9, 14). Over the past few decades, several studies have been conducted on the nature of SEs and the molecular basis of the superantigen activities of SEs has been extensively studied (9, 14). However, little is known about the mechanisms of the emetic activity of SEs. The lack of progress in studying the mechanisms of the emetic activity of SEs can be partially attributed to the lack of convenient and appropriate animal models. Monkeys have been considered to be the primary animal models (2, 3, 4). However, the use of monkeys in investigating SEs is severely restricted by the high cost, the availability of the animals, and ethical considerations. Other experimental animals like dogs, weanling pigs, and cats are less susceptible to SEs or their responses to SEs are not specific (3). The house musk shrew, Suncus murinus, has been described as a suitable small-animal model for research on the emetic response to various emetic drugs (7, 20). Previously, the emetic response of the house musk shrew to the peroral and intraperitoneal administration of SEA was examined and the suitability of this experimental animal was discussed (10, 11). In this study, we investigated the emetic response of the house musk shrew to several SEs, including SEA.

Expression, purification, and confirmation of superantigenic activity of recombinant SEs.

SEA, SEB, SEC2, SED, SEE, SEG, SEH, and SEI were expressed as recombinant SEs by the Escherichia coli expression system. The SEA, SEB, SEC2, SED, and SEE genes were amplified by PCR from the type strains of each SE and cloned to the glutathione S-transferase fusion expression vector pGEX-6P-1 (Pharmacia, Piscataway, N.J.). All S. aureus type strains used in this study are shown in Table 1. The PCR primers for construction of the expression plasmids are listed in Table 2. These primers were designed according to published nucleotide sequences (1, 5, 6, 8, 13). PCR and expression and purification of recombinant SEs were performed as described by Omoe et al. (21). The nucleotide sequences of the SEA, SEB, SEC2, SED, and SEE genes were determined and then compared with the published sequences. The expression constructs of SEG, SEH, and SEI, i.e., pKGX1, pKHX1, and pKIX1, were described elsewhere (21). All SEs revealed only one band located at ∼30 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis (data not shown). The superantigenic activities of purified SEs were assessed by determining the abilities of induction of gamma interferon (IFN-γ) and tumor necrosis factor alpha (TNF-α) on murine spleen cells (18, 19). Spleen cells isolated from specific-pathogen-free female C57BL/6 CrSIc mice (CLEA, Kanagawa, Japan) were stimulated with 0.1 μg of purified SEs per ml. The cells were incubated at 37°C for 72 h in a humidified 5% CO₂ atmosphere. Culture supernatants were harvested for assays of IFN-γ and TNF-α. The production of IFN-γ and TNF-α was determined by sandwich enzyme-linked immunosorbent assays (18, 19). All SEs induced IFN-γ production, although SED and SEH showed rather weak IFN-γ-inducing activity. TNF-α production was also induced in murine spleen cells by the stimulation of SEs. SEH showed rather weak TNF-α-inducing activity compared to that of other SEs (Fig. 1). Pettersson and Forsberg recently reported that SEH did not possess superantigen activity in murine T cells (23). Using C57BL mouse spleen cells, we observed weak superantigen activity of SEH. The reasons for this discrepancy are unknown at present. Petterson and Forsberg estimated the superantigen activity of SEH by using [³H]thymidine incorporation of murine spleen cells, while we estimated the superantigen activity of SEH by the induction of IFN-γ and TNF-α production. The difference in methodologies might cause such a phenomenon. Therefore, we thought that all recombinant SEs maintained superantigen activity, and were suitable for assessing emetic activity in the house musk shrew.

TABLE 1.

Bacterial strains and plasmids

Strain or plasmid	Relevant characteristic(s)	Source
S. aureus type strains
FRI722	Source of sea gene	M. S. Bergdoll
243	Source of seb gene	M. S. Bergdoll
FRI361	Source of sec2 gene	M. S. Bergdoll
1151-7NG	Source of sed gene	M. S. Bergdoll
FRI326	Source of see gene	M. S. Bergdoll
E. coli plasmids
pGEX-6P-1	Apr, GST fusion expression vector	Pharmacia
pKAX1	Apr, pGEX-6P-1 carrying sea	This work
pKBX1	Apr, pGEX-6P-1 carrying seb	This work
pKC2X1	Apr, pGEX-6P-1 carrying sec2	This work
pKDX1	Apr, pGEX-6P-1 carrying sed	This work
pKEX1	Apr, pGEX-6P-1 carrying see	This work
pKGX1	Apr, pGEX-6P-1 carrying seg	Omoe et al. (21)
pKHX1	Apr, pGEX-6P-1 carrying seh	Omoe et al. (21)
pKIX1	Apr, pGEX-6P-1 carrying sei	Omoe et al. (21)

TABLE 2.

Nucleotide sequences and predicted sizes of PCR products for the SE-specific oligonucleotide primers

Gene	Primer	Oligonucleotide sequence (5′-3′)	Size of PCR product (bp)
sea	SEA/GST+	CCCCGGATCCGAGAAAAGCGAAGAAATAAAT	748
	SEA/GST−	CCCCGAATTCTGAACATTACGTGTTCAAAACTAC
seb	SEB/GST+	CCCCGGATCCCAACCAGATCCTAAACCAGATGAGT	737
	SEB/GST−	CCCCGAATTCATTTCACTTTTTCTTTGTCGTAAGAT
sec2	SEC2/GST+	CCCCGGATCCGAGAGCCAACCAGACCCTACG	740
	SEC2/GST−	CCCCGAATTCTTATCCATTCTTTGTTGTAAGGTGG
sed	SED/GST+	CCCCGGATCCGAAAACATTGATTCAGTAAAAG	745
	SED/GST−	CACACCCGGGAATTCATGTTAAAGTATTTGAATTGACTA
see	SEE/GST+	CCCCGGATCCGAAGAAATAAATGAAAAAGA	715
	SEE/GST−	CACACCCGGGAATTCTCAAGTTGTGTATAAATACAAATC

FIG. 1.

Production of IFN-γ (A) and TNF-α (B) by murine spleen cells in response to stimulation with 0.1 μg of recombinant SEs per ml. Positive control cells were stimulated with 0.1 μg of native SEA (nSEA), which was purified from S. aureus culture supernatant. Negative control (NC) cells were stimulated with PBS rather than SEs.

Emetic activities of SEs in the house musk shrew.

The emetic assays were performed with healthy adult (2- to 10-month-old) house musk shrews (S. murinus; Nihon Clea, Tokyo, Japan) weighing 50 to 70 g (male) and 40 to 50 g (female). The shrews were kept in a room at 22 to 25°C. The room was kept lit for 12 h, from 7:00 a.m. to 7:00 p.m. Each animal was placed in a separate cage, fed on commercial S. murinus formula (Nihon Clea, Tokyo, Japan), and provided water ad libitum. Purified SEs were diluted in 0.01M phosphate-buffered saline (PBS; pH 7.2). Two-hundred-microliter volumes of SEs at an appropriate dilution were administered intraperitoneally to the house musk shrews. The animals were not starved beforehand. The animals were observed for emesis for 3 h after the intraperitoneal administration of SEs. The number and times of vomiting, the time to the first vomiting episode, and any behavioral changes were recorded. The 50% emetic dose (ED₅₀) was determined by the method of Reed and Müench as modified by Matsumoto (16). After intraperitoneal administration, all of the SEs caused vomiting responses in the house musk shrews (Table 3). Vomiting occurred within 14 to 130 min after intraperitoneal administration. Most animals vomited one or two times, although some vomited five to seven times. The animals recovered clinically within 3 h. Death and diarrhea were not seen in all the animals tested. Vomiting was not induced by PBS in any of the house musk shrews. All of the house musk shrews that were given doses of 1 μg of SEA per animal retched and vomited. Vomiting was not induced by 0.1 μg of SEA per animal. The emetic activity of SEA in house musk shrews was found to be dose dependent. The ED₅₀ of SEA (recombinant SEA) for house musk shrews was estimated to be 0.4 μg per animal, and the minimum emetic dose was 0.3 μg per animal. The ED₅₀ of recombinant SEA was slightly higher than that of native SEA (0.21 μg/animal) (10). From this result, we have assumed that recombinant SEs have almost the same biological activity as native SEs. With SEI, all house musk shrews vomited at a dose of 10 μg per animal. At a dose of 1 μg per animal, two out of six house musk shrews showed emetic responses. The ED₅₀ of SEI for house musk shrews was 1.5 μg per animal, and the minimum emetic dose was 1 μg per animal. The vomiting induced by SEE was observed at a dose of 10 μg per animal. No house musk shrew vomited at a dose of 1 or 0.1 μg per animal. However, SEB, SED, SEC2, SEG, and SEH needed to be administered at relatively higher doses than did SEA, SEE, and SEI to elicit an emetic reaction in the house musk shrew. The minimum emetic doses of SEB and SED were 10 and 40 μg per animal, respectively. The 100% emetic dose of SEB was 1,000 μg per animal; however, SED at a dose of 1,000 μg per animal, did not induce vomiting in all animals tested. The minimum emetic doses of SEC2, SEG, and SEH were 1,000, 200, and 1,000 μg per animal, respectively. Moreover, SEH showed a relatively shorter latency period than did the other SEs.

TABLE 3.

Emetic activities of SEs on house musk shrews after intraperitoneal administration

SE or control	Dose of rSEa (μg/animal)	No. of shrews		Latency period to first emesis (min)b	No. of vomiting episodesc
		Tested	Vomited
SEA	1.0	5	5	95.4 ± 27.1	2-7
	0.5	5	3	116 ± 22.2	1-5
	0.3	6	1	113	2
	0.1	6	0
SEI	10.0	5	5	113 ± 23.7	1-6
	1.0	6	2	80, 115	1, 2
	0.1	6	0
SEE	10.0	2	2	90, 99	1, 2
	1.0	2	0
	0.1	2	0
SEB	1,000	3	3	110, 90	1, 2
	200	5	2	45, 95	2, 2
	40	6	3	77.3 ± 34.4	1-2
	10	6	1	101	4
	1	6	0
SED	1,000	3	2	96, 75	2, 1
	200	2	1	48	1
	40	2	1	118	2
	10	3	0
SEC2	1,000	2	2	32, 104	1, 2
	200	3	0
	40	4	0
SEG	1,000	3	1	104	2
	200	5	1	132	1
	40	5	0
SEH	1,000	2	2	14, 17	1, 2
	200	2	0
	40	3	0
PBS		3	0

^arSE, recombinant SE.

^bValues for three or more vomiting shrews are means ± standard deviations, whereas individual values are given for one or two vomiting shrews.

^cValues for three or more vomiting shrews are given as ranges, whereas individual values are given for one or two vomiting shrews.

In this study, we employed intraperitoneal injection as the administration route of SEs. Oral or intragastric administration of SEs is most reliable methods to mimic human staphylococcal food poisoning. However, previous studies showed that in monkeys and other animals, SEs were more potent in eliciting emesis when administered intravenously or intraperitoneally than where administered by the oral or intragastric route (2, 3). It was previously shown that the ED₅₀ values of SEA for house musk shrews were 2.3 μg/animal by oral administration and 0.21 μg/animal by intraperitoneal administration (10). We have supposed that intraperitoneal administration of SEs would be more potent in eliciting emesis than oral administration in house musk shrews; therefore, further study of the effects of different administration routes of SEs in house musk shrews is needed.

It is noteworthy that different types of SEs had different emetic activities in house musk shrews. In an emetic assay of monkeys, the doses of SEA, SEB, SEC2, SED, and SEE required to cause emesis by the oral or intragastric route have been reported to be between 5 and 20 μg per animal (3). It has been thought that there are no differences in emetic activities of SEA, SEB, SEC, SED, and SEE in humans and primates. There is a possibility that SEs administered by the intraperitoneal route are degraded by proteases in the abdominal cavity. However, it is well known that SEs are stable toxins and are resistant to many proteases (2, 4). SEs should be stable in the abdominal cavities of house musk shrews. In addition, superantigen activity analysis of recombinant SEs showed that the SEs used in the present study were superantigenically active. We assume that the requirement of relatively high doses of SEB, SEC2, SED, SEG, and SEH to elicit emesis in house musk shrews may not reflect loss of activity but reflect the nature of these toxins per se. Phylogenetically, SEs were classified into three groups according to their amino acid sequences or nucleic acid sequences: the SEA group (SEA, SED, SEE, SEJ, SEH, SEN, SEO), the SEB group (SEB, SECs, SEG), and the SEI group (SEI, SEK, SEL, SEM) (12, 22). In this study, we can not observe a definite correlation between the diversity of SEs and the emetic activities in house musk shrews, although for SEs belonging to the SEB group, there was a tendency for relatively high doses to be required to elicit an emetic reaction. The mechanism of different emetic activities among different types of SEs in house musk shrews is not understood. Abdominal viscera in monkeys have been indicated as the site of emetic action for SEs (27). There is no information concerning the receptors for SEs in the abdominal viscera. However, it seems likely that such receptors exist in the gut of the house musk shrew and that the differences in affinities between different types of SEs and their receptors might explain the different emetic activities of different types of SEs in house musk shrews.

In this study, all house musk shrews survived after the administration of SEs by the intraperitoneal route, even if the administered doses proved lethal in other test animals. The house musk shrews did not display significant clinical signs of shock after SE administration. SEs are superantigens that cause toxic shock syndrome in humans. The reason(s) for the hyposensitivity to superantigens in house musk shrews is unknown. We suppose that SEs may exhibit very weak superantigen activity against house musk shrew T cells. Besides, it seems that there is no correlation between the superantigen activities observed in mouse cells and the emetic activities observed in house musk shrews in response to different serotypes of SEs.

Recently, Wright et al. (28) reported that ferrets responded to SEB orally administered at 5 mg/animal, and they have concluded that ferrets can be used as alternatives to primates in the study of the biological activity of SEB. At present, it is still unknown whether house musk shrews, ferrets, monkeys, and humans share a common mechanism that causes them to respond to the emetic activity of SEs in the same way. However, it is important to develop and evaluate new experimental animal models, such as house musk shrews and ferrets, in order to study the emetic activity of SEs. The house musk shrew appears to be a valuable animal model for studying the emetic activity of native, recombinant, and mutant SEs. Comparative studies using monkeys, house musk shrews, or ferrets on the emetic activity of SEs will lead to an understanding of the molecular basis of the emesis caused by SEs.