Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2006 May 22.
Published in final edited form as: Mol Ecol Notes. 2003 Sep;3(3):450–453. doi: 10.1046/j.1471-8286.2003.00480.x

Characterization of microsatellite markers in the tsetse fly, Glossina pallidipes (Diptera: Glossinidae)

J O Ouma *, M A Cummings *, K C Jones †, E S Krafsur *
PMCID: PMC1464404  NIHMSID: NIHMS56961  PMID: 16718306

Abstract

Glossina pallidipes is a vector of African trypanosomiasis. Here we characterize eight new polymorphic microsatellite loci in 288 G. pallidipes sampled from 12 Kenya populations. The number of alleles per locus ranged from four to 36 with a mean of 20.5 ± 10.1. Expected single locus heterozygosities varied from 0.044 to 0.829. Heterozygosity averaged 0.616 ± 0.246. No linkage disequilibrium was found. We also report results in eight other tsetse species estimated by using the primers developed in G. pallidipes. The primers worked best in G. swynnertoni and G. austeni and worst in G. m. morsitans and G. m. submorsitans.

Keywords: gene diversity, Glossina pallidipes, microsatellites, simple sequence repeats, tsetse flies


Tsetse flies (Diptera: Glossinidae) are obligate and exclusive blood feeders found in much of tropical Africa where they transmit Trypanosoma spp. that cause sleeping sickness in humans and nagana in livestock. Of the 32 known taxa, Glossina pallidipes is among the most important vectors of trypanosomes. It has a wide but patchy distribution in East and southern Africa (Ford 1971).

Three classes of genetic markers have been developed in tsetse flies and used to evaluate natural populations. Gooding (1992) detected allozyme polymorphism in G. morsitans sensu lato and in G. palpalis. Krafsur & Griffiths (1997) examined isozyme variation at 31–45 loci in G. pallidipes, G. morsitans s.l. (consisting of three reproductively isolated taxa), and G. swynnertoni. They observed that 23% of the loci were polymorphic, and heterozygosity averaged over loci and taxa was a statistically homogenous 6.2%. Studies on the breeding structure of G. pallidipes showed surprisingly high levels of genetic differentiation at allozyme loci (Krafsur et al. 1997) and at mitochondrial loci (Krafsur & Wohlford 1999). Microsatellite loci have also been developed in tsetse flies. Solano et al. (1997) isolated an autosomal and two X-linked microsatellite loci from G. palpalis gambiensis. Luna et al. (2001) identified 13 poly-morphic microsatellite markers in G. palpalis palpalis. Baker & Krafsur (2001) isolated and characterized 16 micro-satellite markers in G. morsitans s.l. The primers amplified DNA from other morsitans and palpalis groups. Three of these markers were found to be useful for population genetic studies of G. pallidipes (Krafsur 2002).

There is need to develop more genetic markers in Glossina sp., particularly in G. pallidipes. Here we characterize eight new polymorphic microsatellite loci isolated from G. pallidipes and report their usefulness in related tsetse taxa.

G. pallidipes were obtained from a colony established at the International Atomic Energy Agency (IAEA), Seibersdorf, Austria. Enriched genomic libraries were constructed by Genetic Identification Services (GIS, http://www.genetic-id-services.com; Chatsworth, CA, USA), using 100 µg of DNA. Insert DNA from individual clones was amplified by polymerase chain reaction (PCR) following GIS guidelines. The PCR products were purified by using Qiaquick™ columns (Qiagen® Inc.) and sequenced using forward and reverse universal M13 primers and ABI Prism® BigDye™ Terminator chemistry. Clones with inserts less than 350 bp were not sequenced. Sequencing products were resolved on the ABI Prism® 377 Sequencer (PE Applied Biosystems).

Oligonucleotide primers were designed by using the software designerpcr version 1.03, 1994 (Research Genetics, Inc.). G. pallidipes DNA was used for the initial evaluations of presumptive loci for polymorphisms. Primers were also tested against DNA from other Glossina taxa (Table 2). PCR amplifications were performed in a PTC-100™. thermocycler (MJ Research Inc.) as 10 µL reactions containing 1 × Biolase™ PCR buffer,1.5 or 2.5 mm MgCl2; 0.5 µm each of forward primer (labelled with FAM or HEX), and reverse primer; 0.4 mm dNTPs; 0.4 units Biolase™ polymerase (Bioline USA, Inc., Springfield NJ); and about 100 ng template DNA. The amplification profile consisted of an initial denaturation at 94 °C for 3 min followed by 34 cycles for 1 s at 94 °C, 15 s at the primer-specific annealing temperature (Table 1), 72 °C for 15 s, ending with an extension cycle of 72 °C for 10 min. Analysis of fragment size was performed on the ABI Prism 377 DNA sequencer, using genescan™ 3.1.2 and the TAMRA-350 size standard.

Table 2.

Genetic variability in Glossina taxa estimated by using primers derived from G. pallidipes

Locus Taxa N No. of alleles Size (bp) HO HE FIS H-W (P-value)
GpA19a G. longipennis 8 3 194–224 0.750 0.708 −0.059 0.464
G. austeni 8 5 151–183 0.750 0.857 0.125 1.000
G. f. fuscipes 8 1 177–178 0.000 0.500 1.000 NA
G. m. submorsitans 8 7 142–168‡ 0.400 0.733 0.454 < 0.001
G. m. centralis 8 3 142–160 0.500 0.833 0.400 0.064
G. m. morsitans 8 — — — — — —
G. swynnertoni 8 2 203–209‡ 0.708 0.590 −0.200 0.491
G. brevipalpis 8 2 127–140‡ 0.375 0.325 −0.154 0.182
GpA23b G. longipennis 7 6 131–187‡ 0.875 0.692 −0.264 < 0.001
G. austeni 7 8 140–184‡ 0.625 0.508 −0.230 < 0.001
G. f. fuscipes 8 6 149–162‡ 0.750 0.500 −0.500 < 0.001
G. m. submorsitans 8 6 171–188 0.500 0.433 −0.154 0.018
G. m. centralis 8 10 195–215 0.875 0.867 −0.009 1.000
G. m. morsitans 8 7 171–196 0.500 0.642 0.221 1.000
G. swynnertoni 8 6 177–208 0.833 0.748 −0.114 1.000
G. brevipalpis 7 5 168–198‡ 0.875 0.817 −0.071 0.718
GpB6b G. longipennis 8 3 191–200‡ 0.750 0.575 −0.304 0.209
G. austeni 4 5 211–238‡ 0.875 0.675 −0.296 0.636
G. f. fuscipes 8 2 217 0.000 0.000 NA 0.009
G. m. submorsitans 5 4 153–220 1.000 0.867 −0.153 0.136
G. m. centralis 2 3 174–188 1.000 0.592 −0.689 0.236
G. m. morsitans 8 — — — — — —
G. swynnertoni 8 3 158–213‡ 0.750 0.500 −0.500 0.118
G. brevipalpis 8 2 173–206‡ 0.875 0.525 −0.666 1.000
GpB20b G. longipennis 8 3 126–185‡ 0.286 0.681 0.580 0.127
G. austeni 8 3 137–168‡ 0.286 0.923 0.690 1.000
G. f. fuscipes 8 2 150–181‡ 1.000 0.750 −0.333 1.000
G. m. submorsitans 8 3 155–175 0.625 0.683 0.085 0.364
G. m. centralis 8 7 157–186‡ 1.000 0.900 −0.111 1.000
G. m. morsitans 8 4 156–185 0.875 0.792 −0.105 < 0.001
G. swynnertoni 8 6 155–172‡ 0.875 0.767 −0.141 1.000
G. brevipalpis 8 7 160–179‡ 0.714 0.791 0.097 < 0.001
GpC5b G. longipennis 7 7 197–212‡ 0.125 0.575 0.783 < 0.001
G. austeni 8 3 237–240 0.500 0.500 0.000 0.218
G. f. fuscipes 8 6 224 0.000 0.000 NA 1.000
G. m. submorsitans 8 5 215–221 0.250 0.783 0.681 < 0.001
G. m. centralis 8 2 210–225 0.500 0.667 0.250 1.000
G. m. morsitans 8 4 224–239 0.875 0.792 −0.105 < 0.001
G. swynnertoni 8 2 225–230‡ 0.125 0.125 0.000 0.018
G. brevipalpis 8 4 191–206‡ 0.375 0.325 −0.154 1.000
GpC10b G. longipennis 7 5 306–337‡ 0.429 0.593 0.277 0.591
G. austeni 8 5 267–281 0.375 0.692 0.458 0.100
G. f. fuscipes 8 2 300–306 0.000 0.233 1.000 0.046
G. m. submorsitans 7 6 275–314 0.714 0.868 0.177 < 0.001
G. m. centralis 8 5 275–285 0.750 0.600 −0.250 1.000
G. m. morsitans 3 2 282–288 0.333 0.333 0.000 1.000
G. swynnertoni 8 2 293–294 0.125 0.125 0.000 1.000
G. brevipalpis 8 6 293–350 0.750 0.817 0.082 < 0.001
GpC26b G. longipennis 8 3 147–204‡ 0.286 0.890 0.687 < 0.001
G. austeni 8 2 183–198 0.375 0.708 0.470 1.000
G. f. fuscipes 8 1 151–215‡ 0.625 0.683 0.085 NA
G. m. submorsitans 8 5 180–198 0.375 0.600 0.375 < 0.001
G. m. centralis 8 5 190–202 0.250 0.233 −0.073 < 0.001
G. m. morsitans 8 5 190–194 0.875 0.675 −0.296 0.600
G. swynnertoni 8 2 187–188 0.000 0.400 1.000 1.000
G. brevipalpis 8 2 177–190‡ 0.500 0.442 −0.131 1.000
GpD18b G. longipennis 8 2 139–140 0.000 0.400 1.000 0.064
G. austeni 8 2 143–226‡ 0.125 0.125 0.000 1.000
G. f. fuscipes 8 3 142–264‡ 0.375 0.608 0.383 0.091
G. m. submorsitans 8 3 223–226 0.000 0.633 1.000 < 0.00
G. m. centralis 8 2 222–223 0.000 0.533 1.000 < 0.001
G. m. morsitans 8 — — — — — —
G. swynnertoni 8 2 216–222 0.000 0.233 1.000 0.082
G. brevipalpis 8 2 226–227 0.000 0.500 1.000 < 0.001

N, sample size; HO, observed heterozygosity, HE, expected heterozygosity; —, no or inadequate amplification; H-W (P-value), Hardy–Weinberg probability

‡

PCR yielded multiple bands, NA, not applicable.

Table 1.

Polymorphic microsatellite loci in 288 Glossina pallidipes representing 12 geographical populations.

Locus Allele size range (bp) Ta (°C) Repeat motif No. alleles HO HE FIT Accession number Primer sequence (5′-3′)
GpA19a 142–189 48, 52 (CA)7GA(CA)7 10 0.556 0.590 0.058 AY220498 F: CATATCCACACCCACATACAT
R: GCGATTATGGCTAGAGGTTT
GpA23b 172–215 48, 52 (GT)21 27 0.581 0.609 0.046 AY220499 F: CTCCTGCTTGGGCTCTAT
R: GCGATGAGTTGGTTTCTTT
GpB6b 187–224 48, 52 (CT)15 21 0.542 0.626 0.134 AY220500 F: GTAAACCGCCTGTCACATC
R: AGGGAGAGAGCCGTAAGAG
GpB20b 139–200 48, 52 (GA)29 36 0.718 0.829 0.134 AY220501 F: AGTTTGCTTCTCAACGCAGTAG
R: TTCGGCAGTAGATGGCAA
GpC5b 187–239 52 (GAT)10 21 0.653 0.753 0.133 AY220502 F: GTTGTTTTCTGCTCCTCAATA
R: CAAGGGTGTGTCGTCTTC
GpC10b 283–314 52 (CAT)9 27 0.881 0.748 −0.178 AY220303 F: GTTGATGTTGTGATGGTAATGA
R: GCTGGCAAAGAAACTAATGA
GpC26b 168–201 52 (CAT)3CGT(CAT)12 18 0.776 0.731 −0.062 AY220504 F: GGATCACCCTTCTTGAATG
R: GGACGTTATTTGTTCGTGTAA
GpD18b 220–229 52 (CAG)7 4 0.014 0.044 0.682* AY220505 F: CCTGCGATGTTTACCGAG
R: CGAATCCCTACCTACAAGTCA
Mean ±SD 20.5 ± 10.1 0.59 ± 0.26 0.616 ± 0.246 0.118 ± 0.253

Ta is the annealing temperature. HO, the observed heterozygosity, and HE, the expected heterozygosity

*

P < 0.01.

Analyses of genetic diversity were carried out by using fstat version 2.9.3.2 (Goudet 1995). Tests for Hardy–Weinberg equilibrium of the genotypic frequencies were carried out with arlequin version 2.0 (Schneider et al. 2000). Genotypic disequilibrium was tested by using the log-likelihood ratio G-statistic. cervus (Marshall et al. 1998) was used to estimate genetic diversity parameters and to generate P-values for the Hardy-Weinberg tests in Table 2.

Polymorphisms at eight loci from 288 flies collected from 12 geographical populations are summarized in Table 1. Two loci contained imperfect repeats (GpA19a and GpC26b), while six had perfect repeats. A total of 164 alleles was detected. Numbers of alleles ranged from four to 36 per locus, with a mean of 20.5 ± 10.1. The difference between the longest and the shortest allele varied from nine (GpD18b) to 61 base pairs (GpB20b). Averaged across loci, the difference between the maximum and minimum allele size was 39 bp. Observed (HO) and expected (HE) heterozygosities ranged from 0.014 and 0.044–0.881 and 0.829, respectively. Mean HO = 0.590 ± 0.260 and HE = 0.616 ± 0.246; these lead to an estimate of departures from random mating FIT = 0.042. No significant linkage disequilibrium was detected.

G. pallidipes primers amplified DNA from other Glossina morsitans group taxa (Table 2). G. m. morsitans DNA was not amplified at GpA19a, GpB6b and GpD18b. Mean expected heterozygosities among taxa ranged from 0.404 in G. m. morsitans to 0.700 in G. m. submorsitans. A significant paucity of heterozygotes was detected at 18 of 61 loci-taxa ( c. 30%). The paucity was probably caused by null alleles. G. brevipalpis gave the best results and G. m. submorsitans and G. m. morsitans the worst. Sample sizes and loci numbers were too small to allow phylogenetic inferences.

Acknowledgements

This work was supported by a USPHS-NIH grant AI-5245601 to ESK and by an IAEA Fellowship to JOO. We thank staff at the Kenya Trypanosomiasis Research Institute for sampling G. pallidipes.

Referencmes

  1. Baker MD, Krafsur ES. Identification and properties of micro-satellite markers in tsetse flies Glossina morsitans sensu lato (Diptera: Glossinidae) Molecular Ecology Notes. 2001;1:234–236. doi: 10.1046/j.1471-8278.2001.00087.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ford J. The role of trypanosome in African Ecology. A Study of the Tsetse Fly Problem. London: George Allen & Unwin; 1971. [Google Scholar]
  3. Gooding RH. Genetic variation in tsetse flies and implications for trypanosomiasis. Parasitology Today. 1992;8:92–95. doi: 10.1016/0169-4758(92)90246-x. [DOI] [PubMed] [Google Scholar]
  4. Goudet J. fstat: a computer program to calculate F-Statistics. Journal of Heredity. 1995;86:485–486. [Google Scholar]
  5. Krafsur ES. Population structure of the tsetse fly Glossina pallidipes estimated by allozyme, microsatellite and mitochondrial gene diversities. Insect Molecular Biology. 2002;11:37–45. doi: 10.1046/j.0962-1075.2001.00307.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Krafsur ES, Griffiths NT. Genetic variation at structural loci in the Glossina morsitans species group. Biochemical Genetics. 1997;35:1–11. doi: 10.1023/a:1022252311715. [DOI] [PubMed] [Google Scholar]
  7. Krafsur ES, Griffiths N, Brockhouse CL, Brady J. Breeding structure of Glossina pallidipes (Diptera: Glossinidae) populations in East and southern Africa. Bulletins of Entomological Society. 1997;87:67–73. [Google Scholar]
  8. Krafsur ES, Wohlford DL. Breeding structure of Glossina pallidipes populations evaluated by mitochondrial variation. Journal of Heredity. 1999;90:635–642. doi: 10.1093/jhered/90.6.635. [DOI] [PubMed] [Google Scholar]
  9. Luna C, Bonizzoni M, Cheng Q, Robinson S, Aksoy S, Zheng L. Microsatellite polymorphism in tsetse flies (Diptera: Glossinidae) Journal of Medical Entomology. 2001;38:376–381. doi: 10.1603/0022-2585-38.3.376. [DOI] [PubMed] [Google Scholar]
  10. Marshall TC, Slate J, Kruuk L, Pemberton JM. Statistical confidence for likelihood-based patemity inference in natural populations. Molecular Ecology. 1998;7:639–655. doi: 10.1046/j.1365-294x.1998.00374.x. [DOI] [PubMed] [Google Scholar]
  11. Schneider S, Roessli D, Excoffier L. arlequin, Version 2.000: a Software for Population Genetics Data Analysis. Switzerland: Genetics and Biometry Laboratory. University of Geneva; 2000. [Google Scholar]
  12. Solano P, Duvallet G, Dumas V, Cuisance D, Cuny G. Micro-satellite markers for genetic population studies in Glossina palpalis (Diptera: Glossinidae) Acta Tropica. 1997;65:175–180. doi: 10.1016/s0001-706x(97)00663-3. [DOI] [PubMed] [Google Scholar]

RESOURCES