Volume 80, no. 7, p. 3135-3146, 2006. Page 3136, column 1, Materials and Methods, paragraph 4: The last sentence should read “Primers were as follows: fwd primer, 5′-GCCTGTTGTACCTCTAATGTCACT-3′; rev primer, 5′-GACCCAGGAAGAAAGACCGTAAG-3′; mouse probe, 5′-CTCTTCCTCTTCCTCCTGTGTTGG-3′; human probe, 5′ 6-FAM TTCCTGAGCCACCTGCCACCTCCT butylhydroquinone-1 3′.”
. 2006 May;80(10):5100. doi: 10.1128/JVI.80.10.5100.2006
Mice Transgenic for a Human Porcine Endogenous Retrovirus Receptor Are Susceptible to Productive Viral Infection
Y Martina
1, K T Marcucci
1, S Cherqui
1, A Szabo
1, T Drysdale
1, U Srinivisan
1, C A Wilson
1, C Patience
1, D R Salomon
1
Y Martina
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by Y Martina
K T Marcucci
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by K T Marcucci
S Cherqui
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by S Cherqui
A Szabo
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by A Szabo
T Drysdale
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by T Drysdale
U Srinivisan
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by U Srinivisan
C A Wilson
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by C A Wilson
C Patience
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by C Patience
D R Salomon
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
Find articles by D R Salomon
1Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142
PMCID: PMC1472064
This corrects the article "Mice Transgenic for a Human Porcine Endogenous Retrovirus Receptor Are Susceptible to Productive Viral Infection " on page 3135.