Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2006 May;72(5):3130–3146. doi: 10.1128/AEM.72.5.3130-3146.2006

Comparative Genomics and Transcriptional Analysis of Prophages Identified in the Genomes of Lactobacillus gasseri, Lactobacillus salivarius, and Lactobacillus casei†

Marco Ventura 1,2,*, Carlos Canchaya 1, Valentina Bernini 2, Eric Altermann 3, Rodolphe Barrangou 3, Stephen McGrath 1, Marcus J Claesson 1, Yin Li 1, Sinead Leahy 1, Carey D Walker 4, Ralf Zink 5, Erasmo Neviani 2, Jim Steele 6, Jeff Broadbent 7, Todd R Klaenhammer 3, Gerald F Fitzgerald 1, Paul W O'Toole 1, Douwe van Sinderen 1
PMCID: PMC1472345  PMID: 16672450

Abstract

Lactobacillus gasseri ATCC 33323, Lactobacillus salivarius subsp. salivarius UCC 118, and Lactobacillus casei ATCC 334 contain one (LgaI), four (Sal1, Sal2, Sal3, Sal4), and one (Lca1) distinguishable prophage sequences, respectively. Sequence analysis revealed that LgaI, Lca1, Sal1, and Sal2 prophages belong to the group of Sfi11-like pac site and cos site Siphoviridae, respectively. Phylogenetic investigation of these newly described prophage sequences revealed that they have not followed an evolutionary development similar to that of their bacterial hosts and that they show a high degree of diversity, even within a species. The attachment sites were determined for all these prophage elements; LgaI as well as Sal1 integrates in tRNA genes, while prophage Sal2 integrates in a predicted arginino-succinate lyase-encoding gene. In contrast, Lca1 and the Sal3 and Sal4 prophage remnants are integrated in noncoding regions in the L. casei ATCC 334 and L. salivarius UCC 118 genomes. Northern analysis showed that large parts of the prophage genomes are transcriptionally silent and that transcription is limited to genome segments located near the attachment site. Finally, pulsed-field gel electrophoresis followed by Southern blot hybridization with specific prophage probes indicates that these prophage sequences are narrowly distributed within lactobacilli.


Sequencing of bacterial genomes has revealed a large number of assumed prophage sequences, which contribute significantly to bacterial interstrain variability (7). Genome comparison of several Streptococcus pyogenes strains associated with different types of streptococcal disease showed that prophages represent up to 16% of the DNA content of the bacterial chromosome (7). Unfortunately, detailed analyses of prophages from sequenced nonpathogenic lactic acid bacteria (LAB) are still limited (7). Genome analysis of Lactococcus lactis IL-1403 revealed three cos site prophages and three prophage remnants (9). In Lactobacillus johnsonii NCC 533 DNA microarray analysis indicated that prophage DNA represents almost half of identified strain-specific DNA (39). Recently, it has been shown that the Lactobacillus plantarum WCFS1 genome contains four prophage elements that share closely related genes encoding structural proteins with each other (41).

The increasing number of available bacterial genome sequences has contributed to the understanding of prophage genome distribution and evolution. The mosaic pattern and localized diversity of many different prophage genomes are obvious from comparative analyses of prophage genome content and organization, as well as similarities of orthologous gene products encoded by these elements (26).

Prophage-like elements and prophage remnants have been identified in almost all bacterial genomes sequenced so far (7), suggesting that this group of mobile elements is widespread in bacteria and may be considered to represent a useful tool in order to investigate bacterial evolution. Prophages contribute a substantial share of the mobile DNA of their bacterial hosts and seem to influence the short-term evolution of pathogenic bacteria. In fact, a large part of bacterial DNA is acquired horizontally by transformation, conjugation, or transduction. In this context, phages are the most efficient gene transfer particles developed during evolution and thus may be considered as important vectors for the lateral transfer of DNA between bacterial strains (8).

Recently, the identification of prophage-like elements in genomes of bifidobacteria, which were generally known to be infected by bacteriophages, indicated that prophage sequences could be used to investigate genome bacterial evolution (42).

Sequence data from Lactobacillus phages are available for different species of lactobacilli (Lactobacillus gasseri, L. johnsonii, L. plantarum, Lactobacillus casei, and Lactobacillus delbrueckii). Interestingly, no significant DNA sequence similarity was detected among Lactobacillus phages infecting distinct bacterial species (10), suggesting the presence of a barrier limiting transfer of phage genes across Lactobacillus species. However, this finding may be biased by the limited amount of currently available Lactobacillus prophage sequences.

Prophages are not only important genetic elements that impart bacterial genome variability. In fact, prophages may also confer a diverse array of phenotypic traits to their hosts, including those that govern the course and the pathobiology of bacterial infections. Prophages in pathogenic strains such as S. pyogenes contribute important virulence factors, which are indicated as lysogenic conversion factors to the lysogenic host and which have been demonstrated to contribute to the ecological fitness of the host (6, 7). Based on evolutionary reasoning, prophages are postulated to contribute genes that increase the fitness of lysogenic bacteria in their specific ecological niche (4) as well as genes encoding immunity factors that prevent infection from other bacteriophages. This realization has changed our understanding of the phage-bacterium interaction from being a simple parasite-host relationship to a mutually beneficial genomic coevolution.

Interestingly, comparative genomics identified putative lysogenic conversion genes downstream of the lysis cassette and within the lysogeny module (7, 40, 43). Moreover, transcription studies in L. johnsonii, L. plantarum, L. lactis, and Streptococcus thermophilus prophages demonstrated that these genes, together with those encoding immunity against phage superinfection and those maintaining the lysogenic state, belong to the small number of prophage genes transcribed during the lysogenic state (5, 38, 41, 43).

In prophages of bacterial pathogens, genes predicted to encode virulence factors, including a wide range of superantigens and enzymes possibly involved in pathogenicity (DNase, hyluronidase, and phospholipase [4, 6]) were all located between the lysin and right prophage attachment site.

In the present report, we extend the transcription and genomic knowledge of lactobacilli prophages through analysis of three additional genome sequences. Members of the genus Lactobacillus are common inhabitants of the gastrointestinal environments where they reach high levels of colonization. They have also been isolated in decaying plant material and many fermented food products. L. gasseri, Lactobacillus salivarius, and L. casei species are human gut commensal members or food isolates (14, 17, 18). Sequencing of L. gasseri ATCC 33323 as well as L. salivarius subsp. salivarius UCC 188 and L. casei ATCC 334 allowed the identification and the subsequent analysis of prophage sequences with respect to their gene content, transcription profile, distribution in other Lactobacillus strains, and comparison to other Lactobacillus prophage sequences.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Lactobacillus strains were grown aerobically in MRS broth (Difco) and incubated for 16 h at 37°C. The bacterial strains used and their origins are listed in Table 1.

TABLE 1.

Bacterial strains and their origins

Species Straina Origin
L. salivarius subsp. salivarius UCC 118 Human
L. salivarius subsp. salivarius DSM 20555 Saliva
L. salivarius subsp. salivarius DSM 20492 Human saliva
L. salivarius subsp. salicinus DSM 20554 Saliva
L. salivarius LMG 14477 Parakeet with sepsis
L. salivarius LMG 14476 Cat with myocarditis
L. casei ATCC 334 Emmental cheese
L. casei NCDO 1202 Cheese
L. casei NCDO 1205 Cheese
L. casei IMPC 21060 Cheese
L. casei NCDO 151 Cheese
L. casei NCDO 155 Mouse feces
L. gasseri ATCC 33323 Human
L. gasseri ATCC 4693 Unknown
L. gasseri DSM 20077 Human feces
L. gasseri UCC 874 Unknown
L. gasseri UCC 2493 Unknown
L. gasseri IMPC 4B2 Human feces
L. gasseri UCC 907 Unknown
a

ATCC, American Type Culture Collection; DSM, Deutsche Sammlung fuer Mikroorganismen; LMG, LMG Bacteria Collection Universiteit Gent; UCC, University College Cork; NCDO, National Collection of Dairy Organisms; JCM: Japanese Collection of Microorganisms; IMPC: Istituto di Microbiologia Universita' Cattolica, Piacenza, Italy.

Sequence analysis.

The prophage sequences of LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 were retrieved from the genome sequencing projects in L. gasseri ATCC 33323, L. salivarius UCC 118, and L. casei ATCC 334.

Open reading frames (ORFs) were predicted using the ORF Finder (NCBI), taking ATG, GTG, and TTG as possible start codons and requiring a minimum size of 50 amino acids. Nucleotide and predicted amino acid sequences were compared with sequences in public sequence databases (GenBank, EMBL, PIR-Protein, SWISS-PROT, and PROSITE) using BLAST (3), PSI-BLAST, and FASTA (23). A scan for tRNA genes was performed using the tRNAscan-SE program (24). Motif searches were performed by using the Pfam database.

RNA isolation and Northern blot analysis.

Total RNA was isolated by resuspending bacterial cell pellets in Trizol (GibcoBRL, United Kingdom), adding glass beads (106 μm; Sigma), and disrupting cells with a Mini-Beadbeater-8 cell disruptor (Biospec Products) as described by Ventura et al. (38). Northern blot analysis of prophages was carried out using 15-μg aliquots of RNA isolated from 10 ml of Lactobacillus strains, collected at an optical density at 600 nm of 0.4, 0.8, and 1.2. The RNA was separated in a 1.5% agarose-formaldehyde denaturing gel, transferred to a Zeta-Probe blotting membrane (Bio-Rad, United Kingdom) according to Sambrook and Russell (37), and fixed by UV cross-linking using a Stratalinker 1800 (Stratagene). Prehybridization and hybridization were carried out at 65°C in 0.5 M NaHPO4 (pH 7.2), 1.0 mM EDTA, and 7.0% sodium dodecyl sulfate (SDS). Following 18 h of hybridization, the membrane was rinsed twice for 30 min at 65°C in 0.1 M NaHPO4 (pH 7.2), 1.0 mM EDTA, and 1% SDS and twice for 30 min at 65°C in 0.1 mM NaHPO4 (pH 7.2), 1.0 mM EDTA, and 0.1% SDS; the membrane was then exposed to X-OMAT autoradiography film (Eastman Kodak).

Probes for Northern blot hybridization were labeled with α-32P using a random-primed DNA labeling system (Boehringer Mannheim GmbH) and purified with Nuc-Trap probe purification columns (Stratagene).

DNA amplification of the attB sites.

A 520-bp PCR fragment corresponding to the attB region of prophage LgaI was generated using the primer combination 1612 A and 1674, while PCR fragments corresponding to the attB region of prophages Sal1, Sal2, Sal3, or Sal4 were generated using the primer sets Sal1-attB1 and Sal1-attB2, Sal2-attB1 and Sal2-attB2, Sal3-attB1 and Sal3-attB2, and Sal4-attB-uni and Sal4-attB-rev, respectively (Table 2 gives details of the primer sequences). The 750 bp encompassing the attB site of Lca1 prophage was generated using the primer set Lca1-attB-uni and Lca1-attB-rev (Table 2). Finally, all PCR fragments corresponding to the attB site of LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 were verified by sequence analysis on both strands.

TABLE 2.

Oligonucleotides used in this study

Oligonucleotide Sequence (5′→3′)
1612A GTAATCGCACTTCTTATTTG
1674 GTTTGGCTGATAGTACCAAAG
Sal1-attB1 CACTAAATGTAAACCATCAAG
Sal1-attB2 GATGAACCGTTCATTTATAATG
Sal2-attB1 GAGAGTGGATTATTATATGGTG
Sal2-attB2 GACTTGCAAGAAGATAAAGAAG
Sal3-attB1 GATATGCAGAGGAGATATTTG
Sal3-attB2 GATGACTTCAATCTCTACATTTTCTC
Sal4-attB-uni GAAAGATATAAGTTTATGGGAG
Sal4-attB-rev CACCTTTAAGTTTACGTGAG
Lca-attB-uni GAAGAGAATTCATAGTTCACTG
Lca-attB-rev GAGACGTGATTTAATGGCAG
LgaI int CTTTACGACATTCTCAAGTTG
LgaI-orf1672 CTTCAACGAACTCACCTCC
Sal1-attP1 CAGCAATATTAACTGGATTTATC
Sal1-attP2 CTTCCACAGTCTGCGACATAC
Sal2-attP1 GAGTTTCAGAAGGTAGTAAC
Sal2-attP2 GTTATGGTGTAAACGTGTATAC
Sal3-attP1 CTTAGCTCTAACGTGGCATG
Sal3-attP2 CTATTATAGATTTTGCTAATGAAC
Sal4-attP1 CTTGAGAGCTTAACCAATC
Sal4-attP2 CATAGCAATGTACAAACAACAC
Lca1-attP1 GATTGCTGCCAACAAACCAC
Lca1-attP2 GAGACGTGATTTAATGGCAG
ORF 1555-uni GTTTGATACACAGTATTAGCATC
ORF 1555-rev GAAGTGTATAGCAAGTCCGAG
394-uni GTCTCTAGGATTAGAAGCTG
394-rev CTATAGATATTCCAGTAGTAAC
ORF 64-uni GTACCATGTCGCTTCGTG
ORF 66-rev GATGGCTGATATTGAAGCTG

Excision of L. gasseri, L. salivarius, and L. casei prophages following addition of mitomycin C or hydrogen peroxide.

Lactobacillus cultures were grown until they reached the mid-exponential growth phase, at which point mitomycin C (Sigma, United Kingdom) was either added to reach a final concentration of 1, 2, 3, or 5 μg/ml or not added (control). Furthermore, possible induction of LgaI, Sal1, Sal2, Sal3, Sal4, or Lca1 prophage was assayed by adding hydrogen peroxide to a final concentration of 2 mM. Growth was allowed to continue for 12 h at 37°C, after which cells were collected by centrifugation at 8,000 × g for 15 min. DNA was extracted as described previously (38). The occurrence of excision of LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 prophages was monitored by PCR with the primer combinations (reverse) LgaI int gene and LgaI-orf1672, Sal1-attP1 primer and (forward) Sal1-attP2 primer, Sal2-attP1 primer and Sal2-attP2 primer, Sal3-attP1 primer and Sal3-attP2 primer, Sal4-attP1 primer and Sal4-attP2 primer, and Lca1-attP1 primer and Lca1-attP2 primer, which are specific for circularized LgaI, Sal1, Sal2, Sal3, Sal4, or Lca1 phage to generate amplicons of 450, 631, 900, 1,600, or 2,100 bp, respectively (Table 2). In the same PCR, positive controls are represented by the amplification of ORF 1555, ORF 794, or ORF 64 in prophage LgaI, Sal2, or Lca1, respectively. Amplifications were performed with a Biometra thermocycler with the following temperature profiles: 1 cycle of 95°C for 10 min; 35 cycles of 95°C for 30 s, 54°C for 30 s, and 72°C for 1 min.

PFGE and Southern blotting.

Agarose-embedded bacterial cells were prepared as described by Walker et al. (44). For digestion with restriction endonucleases, bacterial cells embedded in agarose blocks were treated with 50 U of SmaI or XhoI (Roche Molecular, United Kingdom) as described by the manufacturer. Digestion was stopped by washing the blocks for 20 min in Tris-EDTA buffer. Pulsed-field gel electrophoresis (PFGE) was performed by a contour-clamped homogeneous electric field mode in a CHEF-DRII apparatus (Bio-Rad). All DNA samples were separated in 1% agarose gels in 0.5× Tris-borate-EDTA buffer, cooled to 14°C, for 20 h at 6 V/cm with a ramping pulse time from 1 to 20 s.

Southern blots of agarose gels were performed on Hybond N+ membranes (Amersham, United Kingdom) following the protocols of Sambrook and Russell (37). The filters were hybridized with radiolabeled PCR-generated probes described in the text. Subsequent prehybridization, hybridization, and autoradiography were carried out according to Sambrook and Russell (37). Each filter was hybridized using a set of two probes corresponding to different prophage regions. A specific prophage hybridization signal was identified when both probes gave an identical hybridization signal in terms of size and intensity, whereas a cross-hybridization signal designation was observed when the probes used gave a different hybridization signal in terms of intensity and/or size.

Proteomic tree analysis.

The phylogenetic analysis was performed as described previously (35). Every amino acid sequence, including sequences that encode hypothetical proteins, deduced from identified ORFs in the LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 prophage sequences, was compared to all ORF-derived proteins deposited in the NCBI phage and prophage genome database, which contained annotated protein sequences from 476 bacteriophage and prophage genomes as described previously (35).

Phylogenetic analysis.

Phylogeny calculations were performed using the PHYLIP package (12). The final distance matrix to build the tree was calculated by the neighbor-joining method as implemented in the neighbor module of PHYLIP.

Nucleotide sequence accession numbers.

The sequence of L. gasseri LgaI prophage has been deposited in the GenBank database under accession number AAABO02000006.1. The L. salivarius Sal1, Sal2, Sal3, and Sal4 prophage sequences are contained in the genome sequences of L. salivarius subsp. salivarius UCC 118, accession number CP000233. The L. casei Lca1 prophage sequence has been deposited under accession number DQ411856.

RESULTS

Prophage content of L. gasseri ATCC 33323, L. salivarius subsp. salivarius UCC 118 and L. casei ATCC 334 genomes.

As previously described (7), integrases and/or cI repressors are useful markers for the identification of mobile DNA elements such as prophages in bacterial genomes. L. gasseri ATCC 33323 harbors six predicted integrase genes in its 2-Mb genome. BLAST analysis of the surrounding region of ORF 372 (int) revealed that this gene belongs to a 40,085-bp-long (LgaI) prophage. The screening for integrase genes and cI repressors in the sequenced L. salivarius UCC 118 strain revealed the presence of four apparent genomically complete or partial prophages that are represented by prophage-like sequences 48,625 bp long (Sal1), 40,288 bp long (Sal2), 12,529 bp long (Sal3), and 10,315 bp long (Sal4). Finally, the sequenced L. casei ATCC 334 genome is predicted to contain a 46,986-bp-long (Lca1) prophage.

Genome analysis of prophage LgaI.

The predicted prophage LgaI extends from ORF 372 (integrase gene) to ORF 1673 on the genome of L. gasseri ATCC 33323. These ORFs are flanked by a 47-bp repeat, indicating the existence of attL and attR sites. Moreover, PCR primers placed in the adjacent ORFs 1612 and 1672 resulted in a 520-bp amplicon with genomic DNA from L. gasseri ATCC 33323 (Fig. 1b), indicating a low frequency of excision of LgaI, and from other L. gasseri strains that, based on Southern blot hybridization with specific LgaI probes, appeared to lack prophage LgaI (data not shown). The size of the amplicons corresponds exactly to the ATCC 33323 genome minus the LgaI prophage. Sequencing of this PCR product identified the presence of a single copy of the 47-bp repeat region, suggesting an attB site (Fig. 1a and b). Phage integration complements the 3′ end of a tRNAArg gene. The data thus indicate an integrase-mediated insertion of prophage LgaI into a tRNAArg gene that is functionally reconstituted following prophage integration.

FIG. 1.

FIG. 1.

The integration site of LgaI prophage (a and b) and comparative genome maps of the LgaI prophage with the Lj771 and EJ-1 prophages (c). (a) Gene map around the LgaI prophage. The predicted bacterial DNA genes are in gray and the outermost prophage genes are in black. The attachment sites attL and attR are represented by a white vertical bar, and the nucleotide sequence is provided in an enlarged insert. The core sequences of the attL and attR sites are underlined. (b) PCR amplifications of the attB site for LgaI from the indicated Lactobacillus strains. Lane MK, 1-kb DNA ladder (Gibco BRL). (c) Genome map of the prophage LgaI and alignment with prophage Lj771 and prophage EJ-1. The modular structure of the genomes is indicated according to the following scheme: black, similar to bacterial protein; gray, hypothetical protein; open arrow, transposase; vertical black line, tRNA gene. The degree of amino acid identity is indicated by shading: light gray, ≤40%; dark gray, ≥41%.

Database matches allowed a tentative subdivision of the LgaI prophage genome into functional modules (Fig. 1c). Prophage LgaI shares the modular organization of the Sfi11-like pac site Siphoviridae phages (27). The lysogeny module was predicted to extend from ORF 372 to ORF 1614 and includes the integrase gene, the genetic switch region, and a likely superinfection exclusion gene sie (Table 3). The sie gene encodes a protein closely related to a predicted surface-exposed lipoprotein encoded by S. thermophilus bacteriophage TP-J34 at a corresponding position, where many phages from LAB encode phage resistance functions (28). Downstream of the lysogeny module, several ORFs encoded proteins with similarities to DNA replication proteins from Lactococcus and Lactobacillus phages (29). Database matches included a replication initiation protein, a helicase-like protein, and a single-stranded DNA binding protein, defining this genome segment as the likely DNA replication module (Table 3). Two tRNA genes carrying an anticodon for Gln and Val were located on the LgaI genome in a long noncoding region located upstream of the structural genes. Interestingly, the structural proteins from prophage LgaI showed no amino acid sequence identity with the corresponding structural proteins from the L. gasseri phage adh (1, 15), thus revealing two different lineages of structural genes in phages that infect L. gasseri. An ORF (ORF 1673) encoding a putative 35-amino-acid protein, which possesses a very weak similarity (Table 3) to a peptide toxin Fst encoded by the partitioning toxin-antitoxin stability determinant (fst) of Enterococcus faecalis plasmid pAD1, was located between the lysin and the attR site. Interestingly, the DNA region spanning ORF 1673 possesses a deviating G+C content dropping to 29.75% compared to the LgaI average of 36.75%.

TABLE 3.

Database matches for LgaI, Sal1, Sal2, Sal2, Sal3, Sal4, and Lca1 prophages

ORF Representative similarity to protein in database % Identity E value
LgaI
    372 Integrase, S. thermophilus 29 −35
    207 Lipoprotein, S. thermophilus bacteriophage TP-J34 28 −17
    112 Putative repressor, Streptococcus agalactiae prophage 48 −10
    1613 Cro-like regulatory protein, S. thermophilus bacteriophage Sfi21 37 −4
    1619 Putative DNA recombinase, bacteriophage SPBc2 19 −3
    1620 Single-strand binding protein, bacteriophage LL-H 33 −6
    1621 Replication initiation protein, bacteriophage Tuc2009 46 −24
    1623 Antirepressor, S. thermophilus bacteriophage Sfi21 41 −39
    1640 Terminase, Lactococcus bacteriophage bIL310 50 −15
    1641 Putative HNH homing endonuclease, Lactococcus bacteriophage bIL170 37 −26
    1642 Terminase large subunit, L. johnsonii prophage Lj965 27 −23
    1643 Portal protein, bacteriophage SPP1 25 −31
    1644 Minor head protein, L. johnsonii prophage Lj965 21 −12
    1646 Scaffolding protein, Listeria innocua phage A118 34 −17
    1654 Protein XkdK, phage-like element PBX 31 −44
    1655 Protein XkdM, phage-like element PBX 35 −14
    1656 Protein XkdN, phage-like element PBX 29 −8
    1658 Putative minor tail protein, S. pneumonie phage EJ-1 39 −76
    1659 Protein XkdP, phage-like element PBX 20 −7
    1666 Late gene cluster, ORF585, L. johnsonii prophage Lj771 73 −112
    1667 Late gene cluster, ORF177, L. johnsonii prophage Lj771 88 −83
    1671 Putative holing, L. johnsonii prophage Lj965 37 −6
    1672 Putative lysin, L. johnsonii prophage Lj928 63 −105
    1672 Lysin, L. gasseri bacteriophage adh 69 −127
    1673 Peptide toxin Fst, E. faecalis 42 1.2
Sal1
    729 Integrase, Lactococcus bacteriophage BK5-T 30 −48
    733 Transposase, L. johnsonii NCC533 50 −43
    740 Superinfection immunity protein, L. johnsonii prophage LJ965 40 −18
    741 Metallo proteinase protein, bacteriophage φ105 35 −5
    742 Repressor protein, S. pyogenes phage 3.15 36 −13
    752 Helicase, S. pyogenes phage 3.16 35 −16
    756 NTP binding protein, bacteriophage φAT3 25 −6
    758 DNA polymerase, Burkholderia cenocepacia phage BcepB1A 25 −22
    759 Primase, Lactococcus bacteriophage φ31 27 −4
    760 Primase, Lactobacillus plantarum prophage Lp4 33 −30
    764 Hypothetical protein, Fusibacterium nucleatum subsp. vincentii ATCC 49256 phage 35 −12
    765 Integrase, Lactococcus bacteriophage BK5-T 28 −32
    781 Endonuclease family protein, prophage λ ba02 45 −22
    782 Phage terminase small subunit, Enterococcus faecium 33 −8
    783 Terminase large subunit, Lactococcus bacteriophage BK5-T 27 −28
    784 Portal protein, Staphylococcus aureus temperate phage phiSLT 45 −79
    785 ClpP protease, S. thermophilus bacteriophage 7201 37 −19
    786 Minor head protein, prophage λ ba02 45 −81
    787 DNA packaging protein, S. thermophilus phage Sfi19 32 −5
    788 Head-tail adaptor, Enterococcus faecium phage 29 −4
    789 Head-tail joining protein, S. pyogenes phage 315.2 29 −6
    790 Head-tail joining protein, S. pyogenes MGAS8232 22 −03
    791 Major tail protein, S. thermophilus phage Sfi19 25 −05
    794 Tape measure protein, S. thermophilus phage 7201 20 −29
    796 Phage-related tail protein, Pediococcus pentosaceus ATCC 25745 36 −06
    797 Endolysin, L. plantarum prophage Lp1 50 −49
    799 Minor capsid protein, bacteriophage φg1e 50 −44
    805 Lysin, Lactococcus bacteriophage LC3 48 −100
Sal2
    236 Integrase, L. plantarum Lp3 35 64
    240 Superinfection immunity protein, phage φR73 26 −8
    242 CI repressor, S. pneumonie phage EJ-1 40 −38
    250 Cro repressor, Lactococcus bacteriophage BK5-T 51 −10
    251 Antirepressor protein, S. thermophilus phage Sfi21 65 −83
    256 Replisome organizer protein, Lactococcus bacteriophage BK5-T 40 −22
    264 Helicase protein, Enterococcus faecium 25 −3
    271 Endonuclease, enterobacteria phage RB49 27 3.1
    279 HNH endonuclease family protein, prophage L54a 43 −10
    280 Terminase small subunit, S. thermophilus 7201 55 −42
    281 Terminase large subunit, Lactococcus phage BK5-T 68 −99
    283 Portal protein, S. thermophilus Sfi21 51 −103
    284 Clp protease, S. thermophilus Sfi21 52 −54
    285 Major head protein, Lactococcus phage BK5-T 63 −132
    294 Tail tape measure protein, S. thermophilus Sfi21 32 −77
    296 Endolysin, L. plantarum prophage Lp1 48 −40
    300 Endonuclease, lambda Sa2 bacteriophage 20 −10
    304 Lysin, Lactococcus bacteriophage LC3 49 −100
Sal3
    1648 Integrase, L. plantarum prophage Lp3 36 −66
    1649 Transcriptional regulator, Bacillus halodurans C-125 39 −7
    1650 Antirepressor protein, Staphylococcus aureus phage phiSLT 30 −11
    1658 Primase, helicase protein, L. plantarum prophage Lp4 25 −13
Sal4
    1189 Integrase, L. plantarum prophage Lp3 36 −67
    1190 Superinfection immunity protein, bacteriophage phi-105 27 −5
    1191 Transcription repressor, Lactococcus phage ps2 46 −14
    1192 Repressor protein, bacteriophage TPW22 47 −7
    1193 Transcriptional regulator, E. faecalis V583 46 −11
    1202 DNA primase protein, Lactobacillus acidophilus NCFM 41 −83
Lca1
    74 Integrase, L. casei bacteriophage A2 27 −9
    71 Chromosome partitioning ATPase, ParA family, E. faecalis V583 40 −49
    64 Transcriptional repressor, bacteriophage 2638A 33 −17
    62 Putative transcriptional regulator, Burkholderia pseudomallei K96243 38 −6
    60 Helicase, L. plantarum prophage Lp2 34 −18
    52 Putative SSB protein, bacteriophage φAT3 29 −07
    51 Replication protein, Lactococcus prophage BK5-T 36 −08
    50 Putative DNA replication protein, bacteriophage φAT3 93 −134
    34 Aspartate/tyrosine/aromatic aminotransferase, L. casei ATCC 334 98 −22
    31 Putative terminase small subunit, bacteriophage φg1e 46 −33
    30 Terminase large subunit, L. johnsonii prophage Lj965 64 −153
    29 Putative portal protein, Lactococcus bacteriophage ul36 39 −78
    28 Minor head protein, S. thermophilus bacteriophage 2972 30 −29
    23 Transposase subunit B, Lactobacillus sakei 46 −59
    22 Probable transposase, Lactobacillus sakei plasmid 51 −15
    18 Head-tail joining protein, Lactococcus bacteriophage TP901-1 35 −11
    17 Major structural protein, bacteriophage Tuc2009 30 −11
    16 Major tail protein, Lactococcus bacteriophage ul36 29 −11
    13 Tape measure protein, L. plantarum bacteriophage φJL-1 34 −125
    12 Transposase and inactivated derivatives, IS30 family S. pyogenes M49 591 41 −56
    11 Tail component, bacteriophage φAT3 30 −66
    10 Host interaction protein, L. casei bacteriophage A2 57 −124
    6 Putative holin protein, bacteriophage φAT3 92 −53
    5 Lysin, Lactococcus bacteriophage TP901-1 43 −93

Notably, the LgaI prophage genome shows a considerable sequence similarity and conserved symmetry with the L. johnsonii Lj771 prophage genome, whose complete sequence was not publicly available at the time of this writing (GenBank accession number AF195902). The currently deposited 7,200-bp Lj771 sequence includes ORFs encoding predicted structural components of the phage with protein identities of greater than 77% to the homologous LgaI gene products (Fig. 1c). Moreover, the genetic organization of the right part of the LgaI prophage (from ORF 1642 to ORF 1665) showed the greatest overall similarity (at the amino acid level) to the Streptococcus pneumoniae prophage EJ-1 (35). The general organization of the regions spanning ORF 1642 to ORF 1664 and ORF 1654 to ORF 1665, respectively, showed a one-to-one correspondence to similarly sized genes in the head morphogenesis and tail morphogenesis clusters of EJ-1 prophage (Fig. 1c).

Genome analysis of L. salivarius Sal1, Sal2, Sal3, and Sal4 prophages.

Based on the presumptive prophage genome length, only prophages Sal1 and Sal2 appear to be complete, whereas Sal3 and Sal4 appear to be prophage remnants. The exact length of all L. salivarius prophages was determined by sequencing the PCR product achieved using primers placed in bacterial genes that flank each of the assumed prophages in strain UCC 118 and/or in other L. salivarius strains.

Genome analysis of prophage Sal1.

The predicted prophage Sal1 in L. salivarius subsp. salivarius UCC 118 extends from ORF 729 (integrase gene) to ORF 805 (lysin gene) (Fig. 2a). These ORFs are flanked by a 14-bp repeat, indicating the existence of putative attL and attR sites. Moreover, PCR-primers (Sal1-attB1 and Sal1-attB2) placed in the flanking bacterial ORF 808 and ORF 728 genes, encoding an rRNA methylase protein and a exodeoxyribonuclease V α-chain protein, yielded a 1.6-kb amplicon with genomic DNA from L. salivarius subsp. salivarius DSM 20555 and L. salivarius subsp. salivarius LMG 14447, a size which accords with a chromosome lacking prophage sequence at this site. Sequencing of this PCR product identified the presence of a single copy of a 14-bp repeat region, suggesting an attB site (Fig. 2a). Phage integration complements the 3′ end of a tRNA carrying the anticodon specific for Ser.

FIG. 2.

FIG. 2.

Sal1 (a), Sal2 (b), Sal3 (c), and Sal4 (d) prophage integration and PCR amplification of the attB site of each prophage are indicated in each panel. The predicted bacterial DNA genes are in shown gray, and the outermost prophage genes are shown in black. The attachment sites attL and attR are represented by a black vertical bar, and the nucleotide sequence is provided. The core sequences of the attL and attR sites are underlined.

Database matches allowed the subdivision of the Sal1 prophage genome into functional modules (Fig. 3 and Table 3). In this prophage-like element, the lysogenic module is limited to a region spanning ORF 729 to ORF 746. The next ORFs (ORF 752 to ORF 760) constitute the likely DNA replication module. Downstream of the replication module an endonuclease gene (ORF 781) is notable in Sal1. Related endonucleases are intron-associated in a number of phage systems (13). Identification of likely structural modules such as the head morphogenesis genes (from ORF 782 to ORF 786), DNA packaging genes (from ORF 787 to ORF 790), and tail morphogenesis genes (from ORF 791 to ORF 796) was possible on the basis of observed homology to genes in lactococcal and streptococcal phages with low G+C content. Further upstream, a gene (ORF 797) that possesses a glycosyl hydrolase family motif (Pfam 01183) and is similar to the endolysin detected in the genome of L. plantarum Lp2 prophage was identified; separated from this gene by four anonymous ORFs, a lysis cassette formed by only the lysin gene (ORF 805) was also identified (Fig. 3).

FIG. 3.

FIG. 3.

Comparative genome maps of the Sal1, Sal2, Sal3, and Sal4 prophages. Genes sharing similarity are linked by shading. Probable functions of encoded proteins identified by bioinformatic analysis are noted. The modular structure of the genomes is indicated as described in the legend of Fig. 1. The degree of amino acid identity is indicated by shading as described in the legend to Fig. 1.

Genome analysis of prophage Sal2.

Prophage-like element Sal2 is located between a gene (ORF 235) encoding an ammonium transporter on one side and a gene (ORF 305) encoding an arginino-succinate lyase on the other side, while being flanked by a 24-bp repeat (Fig. 2b). Using primers targeting the sequences of the bacterial genes flanking the prophage, we amplified a 750-bp-long DNA segment from several L. salivarius strains (Fig. 2b). Sequencing of this 750-bp amplicon identified the presence of a single copy of a 24-bp repeat suggesting an attB site. The 24-bp core sequence overlaps the 5′ end of the arginino-succinate lyase-encoding gene, which appeared to be reconstructed upon phage integration (Fig. 2b). The arginino-succinate lyase is an enzyme of the urea cycle which splits arginino-succinate to fumarate and arginine (30), so its preservation from gene interruption appeared to be highly important for maintaining correct cell metabolism. Database matches also allowed a tentative subdivision of the Sal2 prophage genome into functional modules. The modular organization was typical for temperate phages from low-GC-content gram-positive bacteria (Fig. 3). The likely extent of the lysogeny module is from ORF 236 to ORF 251. The lysogeny module of Sal2 prophage contains two genes (ORF 247 and ORF 250) whose deduced protein products show a high level of protein identity to Cro-like proteins and a gene (ORF 242) that resembles the cI repressor gene (Table 3). However, these putative cI- and cro-like genes were not located adjacent to each other as is commonly found for other phages. The following genes were assigned to the DNA replication module. Across the DNA packaging, head, and tail fiber modules, prophage Sal2 shared sequence similarity with S. thermophilus phage 7201 and L. lactis BK5-T phage. Furthermore, several genes encoding hypothetical proteins of unknown function are located between the tail fiber module and the host lysis cluster in Sal2 prophage. ORF 300 displays a noteworthy homology to the HNH family of homing endonucleases found in many phages (Table 3). These endonucleases are often part of bacteriophage intron systems that give rise to modular enzymes. Sal2 prophage possesses a very similar genetic organization to the region encompassing ORF 279 to ORF 304 with an amino acid similarity greater than 40% with the homologous region of Sal1 prophage. Moreover, other regions of similarity were identified that encompassed the integrase gene, an endonuclease gene, and genes encoding hypothetical proteins of unknown function (Fig. 3).

Genome analysis of Sal3 and Sal4 prophages.

Prophage-like element Sal3 extends from ORF 1648 to ORF 1665, whereas the likely extent of prophage Sal4 is from ORF 1189 to ORF 1205. Sal3 and Sal4 prophages are flanked by a 19-bp repeat and a 21-bp repeat, respectively. Most of the L. salivarius strains from our collection yielded a 300-bp or 700-bp PCR product when primers (the pair Sal3-attB1 and Sal3-attB2 and the pair Sal4-attB1 and Sal4-attB2) were placed in the bacterial genes that surround the Sal3 or Sal4 prophage in L. salivarius UCC 118, respectively. Interestingly, using L. salivarius UCC 118 genomic DNA as a template also generated PCR products using these set of primers, thereby indicating that a subfraction of an L. salivarius UCC 118 culture may have been subject to excision of these phages. These PCR products contained the 19-bp or the 21-bp sequences, and the sequences to the right and left of these deduced attB sites were identical to those abutting the likely attL and attR sites (Fig. 2c and d).

As shown in Fig. 3 and Table 3, the genetic structures of Sal3 and Sal4 appear to have been shaped by multiple DNA deletion and rearrangement events. In fact, their limited lengths and the absence of a region encoding structural phage components suggest that one or more major DNA deletion events may have occurred. Comparison of the Sal3 and Sal4 prophage genome sequences showed significant sequence similarity at the DNA level. Strikingly, the similarity extended to the whole prophage genome in a patchwork fashion (Fig. 3).

Genome analysis of L. casei Lca1 prophage.

The predicted prophage-like element Lca1 has a genome size of 46,986 bp, extending from ORF 74 (integrase) to ORF 4 (hypothetical protein). This determination was based on the observation that ORF 74 and ORF 4 are surrounded by a 27-bp repeat. Using primers targeting the sequences of the bacterial genes flanking the prophage, we obtained a 750-bp PCR product apparently from a possible nonlysogenic L. casei ATCC 334 subpopulation (Fig. 4a and b), which contained the 27-bp attB sequence that is placed in an intergenic region.

FIG. 4.

FIG. 4.

The integration site of Lca1 prophage and its defect in excision (a and b) and genome maps of the Lca1 prophage and alignment with the phage A2 (c). For figure details see the legend to Fig 1.

Database matches allowed a functional annotation of some of the identified ORFs of the Lca1 prophage genome, thus allowing the identification of a number of functional modules (Fig. 4c and Table 3). The Lca1 lysogeny module covers ORF 74 to ORF 63 (Fig. 4c), comprising the integrase gene, a possible superinfection exclusion gene sie (ORF 66), and the genetic switch region with divergently transcribed cI- and cro-like repressor genes (ORF 64-ORF 63). Notably, another gene which is similar to the E. faecalis V583 chromosome partitioning the ATPase ParA family was identified within the Lca1 lysogeny module. Downstream of the lysogeny module, several ORFs were predicted to encode proteins with homology to DNA replication proteins (Table 3), thus defining this genome segment as the likely DNA replication module. Also interesting is an aminotransferase gene in Lca1 (ORF 34). Related aminotransferases were also observed in Lactobacillus phage φg1e and Listeria phage A118 and may be involved in the modification of phage and host DNA (36). Further database matches allowed a distinction of likely DNA packaging and head morphogenesis genes, possible head-to-tail joining genes, and putative tail genes. Interestingly, several genes encoding transposase proteins are present within the structural region of the genome of Lca1. A lysis cassette was identified downstream of the tail fiber module, which is constituted by the classical genetic constellation of holin and lysin genes. Finally, a small ORF (ORF 4) without any database match is located between the lysin and the attR site. When the deduced protein products of the genome of Lca1 were compared to those encoded by the L. casei A2 phage (34), protein similarities were only observed between proteins specified by the tail and tail fiber modules, as well as the lysogeny module for the integrase and cI repressor-encoding ORFs. This suggested that, although they infect the same bacterial host, these phages are nevertheless very different from a genetic point of view.

Transcription analysis.

Analysis of the transcription of prophage genes was conducted by performing Northern blot hybridization using DNA probes that cover a large portion of the L. gasseri LgaI and the L. salivarius Sal1, Sal2, Sal3, and Sal4 prophage genomes (Fig. 5; see also Fig. S1 in the supplemental material). From these results it is obvious that large regions of these prophage genomes are transcriptionally silent. No transcription of the cro-like and the antirepressor genes was detected, which frequently constitute early or middle lytic transcripts in phages from LAB (43). Also the DNA packaging and head morphogenesis, tail, and tail fiber genes did not appear to be transcribed. In contrast, probes corresponding to parts of the lysogeny module of these prophages revealed in each case prophage-specific transcripts.

FIG. 5.

FIG. 5.

Schematic representation of the transcription pattern of prophage LgaI (a), Sal1 (b), Sal2 (c), and Sal4 (d). The relative position and extent of the probes used for Northern blot analysis are provided as horizontal lines just below each of the schematically displayed phage genomes. The thin arrows just below the probe positions indicate the deduced position and direction of the transcripts; the numbers above the thin arrows refer to the estimated length of the transcripts.

LgaI.

Using an LgaI ORF 112 (cI)-specific probe, a transcript of 1.4 kb was detected. According to its estimated length, this transcript would cover the cI repressor gene, ORF 160 (encoding a hypothetical protein) and ORF 207 (encoding a putative superinfection exclusion protein) (Fig. 5a). In fact, when an ORF 207-specific probe was used, the 1.4-kb mRNA species was also detected. In addition, a 0.7-kb signal with greater autoradiographic intensity was identified (see Fig. S1a in the supplemental material). A probe corresponding to ORF 1673, located between the phage lysin and attR, hybridized with a prominent but small transcript of 0.6 kb (Fig. 5a; see also Fig. S1a in the supplemental material). The length of the transcript predicts termination between ORF 1673 and the right attachment site. No transcripts were observed using probes covering several structural genes and the lysin gene.

Sal1.

The lysogeny module of Sal1 gave rise to a small number of transcripts (Fig. 5b; see Fig. S1b in the supplemental material). A probe corresponding to the cI repressor (ORF 742) yielded a 1.5-kb signal, which was also revealed with a probe covering the putative superinfection exclusion gene (ORF 740). The 1.5-kb mRNA thus spanned ORFs 742 and 740. The likely constellation of the transcripts from the lysogeny module of Sal1 is depicted in Fig. 5b. Furthermore, a series of mRNAs with sizes ranging from 3.5, 2.9, and 2.0 to 1.5 kb were detected in the lysogeny module when an ORF 733-specific probe was employed (Fig. 5b; see Fig. S1b in the supplemental material). These messenger RNAs cover only the region enclosed between the putative sie gene and the integrase gene since an int-specific probe did not reveal any signals. Interestingly, when the predicted lysin gene of Sal1 was used as a probe, a prominent 1.2-kb transcript was detected. No transcripts were detected when probes were used that correspond to the two predicted integrase genes (ORF 729 and ORF 765) or genes from the DNA packaging and structural modules and in the surrounding region of the lysin-encoding gene (Fig. 5b; see Fig. S1b in the supplemental material).

Sal2.

Transcription analysis of this prophage revealed that only the regions at the two extremities of the Sal2 genome are transcribed (Fig. 5c; see Fig. S1c in the supplemental material). In fact, using an int-specific probe, a weak transcript of 1.2 kb was detected. The lysogeny module produced a transcript of 1.3 kb when the cI gene was used as a probe. On the rightmost end of the Sal2 genome, using a lysin-specific probe, three transcripts of 4.4 kb, 1.8 kb, and 1.2 kb were detected. In contrast, no transcripts were identified with probes covering the DNA replication module or several of the genes representative of the structural modules (Fig. 5c and data not shown; see also Fig. S1c in the supplemental material).

Sal3 and Sal4.

Transcription analysis of the Sal3 prophage using several probes spanning various portions of the Sal3 genome did not reveal any hybridization signal, thus indicating that the Sal3 genome is transcriptionally silent (data not shown). In contrast, in the case of Sal4, Northern hybridizations revealed a 2.5-kb-long transcript using probes covering the int gene, the sie gene, and the cI repressor gene (Fig. 5d; see Fig. S1d in the supplemental material), indicating that these genes constitute a polycistronic unit. The remainder of the Sal4 genome appeared to be transcriptionally silent (data not shown).

Induction of LgaI prophage.

The inducibility of LgaI prophage was assessed by exposing an L. gasseri ATCC 33323 culture to mitomycin C or to 2 mM hydrogen peroxide (Fig. 6a). The presence of the Lga1 phage sequence in a circular form was verified using a set of primers annealing with the integrase and the lysogenic conversion region of LgaI prophage in a PCR approach. Furthermore, in order to ensure that the lack of any PCR product was attributable to the absence of circularized phage DNA target rather than a failure of the amplification reaction, a second pair of primers (1555-uni and 1555-rev) targeting a 1,600-bp region within the prophage genome was used as a positive control. Specific 450-bp amplicons with primers running outward from the ends of the linear prophage genomes were achieved with DNA isolated from cells following the addition of mitomycin C or hydrogen peroxide (data not shown), indicating that free circularized phage genomic DNA is present. Spontaneous excision of LgaI was also observed (data not shown). When the 450-bp amplicon, which corresponds to the LgaI attP site, was sequenced and aligned with the LgaI attL, attR, and attB sites, a common 47 bp with a single variable nucleotide was found (Fig. 6a). In this common core, DNA strand exchange is expected to occur during phage genome integration into the bacterial chromosome.

FIG. 6.

FIG. 6.

Induction of LgaI (a), Sal1 (d), Sal2 (b), Sal3 (e), Sal4 (c), and Lca1 (f) prophages. Each panel shows the amplification of prophage sequences from culture filtrate supernatants and from cells after mitomycin C or hydrogen peroxide treatment (indicated with an asterisk). The amount of mitomycin C (μg/ml) or hydrogen peroxide (mM) is indicated. Panels a, b, and c also show the nucleotide sequence alignments of the regions containing attL, attR, attP, and attB of the LgaI, Sal2, and Sal4 phages. The conserved regions representing the core sequences of the att sites are indicated.

L. salivarius Sal1, Sal2, Sal3, and Sal4 prophage induction.

In order to detect excised and circularized Sal1, Sal2, Sal3, or Sal4 phage genome following treatment of L. salivarius UCC 118 cultures with mitomycin C or to 2 mM hydrogen peroxide, a PCR product of 631 bp, 900 bp, 1,600 bp, or 2,100 bp, respectively, should be obtained with primers placed in the left- and rightmost part of each prophage genome and running outward from each of these four prophages. The PCR primer pair 394-1 and 394-2 and the pair 394-1 and 392-2, which are targeted to amplify internal Sal1 prophage genes and provide amplicons of 1,900 bp or 2,100 bp, respectively, were used as PCR positive controls.

Amplicons of 900 bp and 2,100 bp were obtained with primers placed at the periphery of the Sal2 and Sal4 prophages, respectively, which indicates that circularized bacteriophages were obtained after either mitomycin C or hydrogen peroxide treatment (data not shown). In contrast, no such PCR products were obtained when DNA extracted from a noninduced UCC 118 culture was used (data not shown). When the 900-bp amplicon, which corresponds to the Sal2 attP site, was sequenced and aligned with the Sal2 attL, attR, and attB sites, a common 24-bp core region was found (Fig. 6b). In this common core, DNA strand exchange is expected to occur during phage genome integration into the bacterial chromosome. Similarly, when the 2,100-bp PCR product, which corresponds to the attP site of Sal4, was sequenced and aligned with the Sal4 attL, attR, and attB sites, a common 21-bp core region was found (Fig. 6c).

In contrast, no specific amplicons were obtained using primers running out of the Sal1 or Sal3 prophage genome, indicating that free circularized Sal1 and Sal3 phage genomes are not present following mitomycin C or hydrogen peroxide treatment (Fig. 6d and e).

L. casei Lca1 prophage induction.

The inducibility of Lca1 prophage was assessed using an identical procedure as outlined for the L. salivarius prophages. A PCR primer pair (Lca1-attP-uni and Lca1-attP-rev) was designed at each border of the Lca1 prophage, and each was directed outward from the prophage sequences. Moreover, another PCR primer pair (64-1 and 66-2) which targets ORF 64 was used as a PCR positive control. DNA isolated from cells upon the addition of different concentrations of mitomycin C or hydrogen peroxide yielded amplicons only with primers placed within prophage sequences (positive control), whereas no specific amplicons were achieved using primers running out of the prophage genome, indicating that no free circularized phage genomes are present (Fig. 6f). Furthermore, no PCR products suggestive of prophage excision were obtained with primers running out of the prophage genome in the culture supernatants after filtration (Fig. 6f).

Distribution of L. gasseri, L. salivarius, and L. casei prophages.

To analyze the distribution of prophage sequences in different lactobacillus species, we performed a Southern hybridization of PFGE-separated chromosomal digests using a set of probes specific for prophages LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 (Fig. 7).

FIG. 7.

FIG. 7.

PFGE of different Lactobacillus strains and Southern blot hybridization with PCR probes obtained from the LgaI (a), Sal1 (b), Sal2 (c), Sal3 (d), Sal4 (e), or Lca1 (f) prophage. The PCR probes used are indicated below each panel. The restriction fragment containing the LgaI, Sal1, Sal2, Sal3, Sal4, or Lca1 prophage is indicated in each by a black arrow. Bands cross-hybridizing with the specific probes are indicated with white arrows.

LgaI prophage.

Seven L. gasseri strains were employed to analyze the distribution of LgaI prophages (Fig. 7a). The seven strains represented seven different SmaI restriction patterns in PFGE, and all were distinct from the pattern of the reference strain ATCC 33323. In two different hybridization experiments using an ORF 1664 (encoding a hypothetical protein)-specific probe or an ORF 372 (int)-specific probe, hybridization signals were obtained to a 110-kb fragment from L. gasseri ATCC 33323. The probes were selected in a manner that represents the two borders of the LgaI prophage genome. With the ORF 1664-specific probe, a 200-kb hybridization signal in strain DSM 20077 and a 160-kb hybridization signal in strain ATCC 4693 were obtained, whereas the ORF 372-specific probe yielded a hybridization signal of 200 kb in strain DSM 20077. Although the LgaI prophage may be restricted to the ATCC 33323 strain, it appears that homologs of individual genes are found in distinctly different L. gasseri strains. This could indicate the presence of phages that belong to a lineage related to LgaI (or phage remnants) in L. gasseri species.

Sal1, Sal2, Sal3, and Sal4 prophages.

We used all L. salivarius strains deposited in several international bacteria collections (i.e., ATCC, DSM, LMG, and JCM) to analyze the distribution of the Sal1, Sal2, Sal3, and Sal4 prophages. All five strains used represented five different SmaI restriction patterns in PFGE analysis. Two Sal1-specific probes, located in the lysogeny module (ORF 734) and in the structural encoding region (ORF 794), hybridized exclusively with a 655-kb fragment from UCC 118 DNA (Fig. 7b), suggesting the absence of Sal1-like prophages in the tested strains or at least the absence of homologous regions of the probes used. A Sal2-specific probe covering the ORF 294 hybridized exclusively with a 215-kb fragment in the UCC 118 strain. In contrast, a probe corresponding to the sie gene (ORF 240) produced hybridization signals with all four L. salivarius strains (Fig. 7c), suggesting the presence of prophages containing sie-like genes in these strains.

A Sal3-specific probe covering the ORF 1656 hybridized with a fragment of about 40 kb from L. salivarius UCC 118 and L. salivarius DSM 20555 and also produced hybridization signals with a fragment of 655 kb in L. salivarius DSM 20492 and L. salivarius DSM 20555 (Fig. 7d). This would therefore indicate that Sal3 prophage-like elements are also present in other L. salivarius strains. Similarly, a Sal4-specific probe (ORF 1190) hybridized with a 655-kb SmaI fragment in L. salivarius UCC 118 as well as in L. salivarius DSM 20554 (Fig. 7e). The latter results therefore suggest that this small prophage is not specific to the UCC 118 strain. Since the prophages in the two strains are found on SmaI fragments of the same size, they might be located at corresponding sites in these strains. PCR across the attL-attR site of Sal4 prophage agreed with this hypothesis (data not shown).

Lca1 prophage.

We selected six L. casei strains to determine the distribution of Lca1-like prophages in L. casei species. All these strains were assayed by molecular fingerprinting using PFGE. The six strains represented six different XhoI restriction patterns in PFGE, which were different from the pattern of the reference strain ATCC 334 (Fig. 7f). Two Lca1-specific probes located in the structural part of the phage genome (ORFs 64 and 66) hybridized with a 51-kb fragment from ATCC 334 DNA (Fig. 7f). A weak 51-kb hybridization signal was also observed in L. casei strains NCDO 155, NCDO 1202, NCDO 1205, and IMPC 21060 when a probe specific for ORF 66 was used, suggesting the presence of a prophage-like sequence that shares at least some DNA homology with Lca1 (Fig. 7f). This finding is in agreement with the failure to generate a PCR product using chromosomal DNA from these L. casei strains as a template with PCR primers flanking the putative attB site of L. casei ATCC 334, indicating that a prophage is integrated in this site (Fig. 7f). The other L. casei strains tested were shown to contain an intact attB site (Fig. 7f). Moreover, these strains did not reveal any hybridization signal, suggesting that they do not contain sequences homologous to the Lca1 prophage.

Phylogenetic analysis of the LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 prophages.

A sequence-based taxonomic system has been established for inferring phylogeny among phages and prophages (35) through the generation of a proteomic tree. This system is based on the overall relatedness of both complete phage genomes and prophages identified within complete bacterial genomes (35). We performed such a proteomic tree analysis (Fig. 8a) using the database of phage and prophage sequences which was updated with the LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 sequences. These latter prophage sequences were shown not to group together. The LgaI prophage is contained in the Enterococcus phage group, which also includes the S. pneumonia EJ-1 phage and the partially sequenced L. johnsonii Lj771 prophage. The Lca1 prophage appeared to be phylogenetically related to the L. casei A2, AT3, and EDTA phages. On the other hand, the L. salivarius prophages described here are not located within the same phylogenetic group. In fact, the two largest L. salivarius prophages, i.e., Sal1 and Sal2, are closely related to the Bacillus licheniformis phages, whereas the two prophage remnants Sal3 and Sal4 cluster with a number of Bacillus subtilis and E. faecalis phages (Fig. 8a).

FIG. 8.

FIG. 8.

(a) Phage proteomic tree illustrating the relationship between LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 prophages and other sequenced phages and prophages. (b) Phylogenetic tree based on the 16S rRNA gene from various Lactobacillus strains. The tree is based on the more closely related phage and prophage sequences of LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 deduced on the basis of a previous proteomic tree based on 476 sequenced phage genomes and prophages (data not shown). In panel b, bootstrap values are reported for a total of 1,000 replicates.

Furthermore, we compared the evolutionary development of these prophage sequences and those of their bacterial hosts. A phylogenetic analysis using a classical molecular marker such as the 16S rRNA gene sequences revealed significant discrepancies with the evolutionary development of the phage sequences (Fig. 8b). The phylogenetic tree of the bacterial hosts clearly showed a branching of close bacterial taxa such as L. gasseri and L. johnsonii, whereas in the proteomic tree, L. gasseri phages, such as LgaI and adh, do not cluster with L. johnsonii phages, such as Lj928 and Lj965.

DISCUSSION

Many bacterial genome sequences deposited in public databases contain integrated phage DNA, which often constitutes a sizable part of the total bacterial DNA. Among the available Lactobacillus genomes, which include bacteria of relevant industrial and ecological interest, all sequenced species except L. delbrueckii subsp. bulgaricus contain prophage sequences. Prophages can be present in many different forms ranging from inducible prophages to prophages showing apparent (small) deletions, insertions, and rearrangements, to prophage remnants that appear to have lost most of their genome. The amount of prophage sequence in Lactobacillus genomes is variable, ranging from polylysogenic strains, e.g., L. plantarum WCFS1 (20) and L. johnsonii NCC 533 (33), to strains containing prophage remnants, e.g., Lactobacillus acidophilus NCFM genome (2). In contrast, some strains that have been subjected to extensive industrial processing such as Lactobacillus helveticus DPC4571 do not contain any prophage-like sequence (M. Callanan, personal communication). The host-parasite interaction constitutes a highly dynamic equilibrium. Prophages will kill the lysogenic cell upon their induction.

The genome sequencing of L. gasseri ATCC 33323, L. salivarius UCC 118, and L. casei ATCC 334 contributed six new prophage sequences to the already existing repertoire of Lactobacillus prophage sequences (40-41). This extended database will not only substantially increase the volume of the current phage database but also provide a greater phylogenetic breadth to the present database. Interestingly, phylogenetic relationships of currently available Lactobacillus prophage sequences revealed a very different phylogenetic image from that of their bacterial hosts. This indicates that prophage sequences and bacterial hosts have followed a different evolutionary development. These findings are in contrast to the phage-host coevolution hypothesis of Rohwer et al. (35), perhaps as a consequence of the enlarged Lactobacillus phage database. These observations indicate that Lactobacillus prophage sequences are an example of genetic mosaicism apparently arising from nonhomologous recombination between ancestral sequences following a web-like, rather than a tree-like, phylogeny.

Notably, with respect to overall genome organization, the LgaI, Sal1, Sal2, Sal3, Sal4, and Lca1 prophages were shown to belong to the group of Sfi11-like pac site Siphoviridae (34), which also contain L. plantarum prophages Lp1 and Lp2 (41), L. johnsonii prophages Lj928 and Lj965 (40), φg1e (21), and L. delbrueckii phage LL-H (31). However, very limited sequence similarity was observed between the presumptive structural phage proteins of these new prophage sequences. The structural gene cluster of LgaI and Lca1 prophage sequences belonged to a widely distributed lineage of Sfi11-like phages detected in LAB genera, e.g., S. pyogenes and L. lactis. Since sequence-related phages were isolated from different bacterial genera, it is unlikely that these new Sfi11-like phages have evolved within the confines of one of these bacterial genera. In fact, Sfi11-like phages share part of the genome organization and even distant sequence relatedness with lambdoid phages infecting gram-negative bacteria, suggesting descent from a structural phage module of a common but rather distant ancestor (34).

Interestingly, phages isolated from closely related taxa that occupy very similar ecological niches could be used as a test case in order to investigate lateral gene transfer between Lactobacillus phages. In this context, L. gasseri and L. johnsonii are two closely related species belonging to the L. acidophilus cluster B that share the same ecological niches (gastrointestinal tract of human and animals). The genome similarity shown by the LgaI prophage and by the available partial Lj771 prophage sequence reflects the overall similarity of the genome sequences of their hosts (unpublished results). Comparative phage genomics has suggested that phages may have evolved through exchange of functional modules, individual genes, or gene segments via various genetic recombination events (26). Since L. gasseri and L. johnsonii share the same ecological niche, it is possible that horizontal gene transfer and recombination events may have occurred between some phages of L. gasseri and L. johnsonii origin. Alternatively, a common ancestor phage infecting one species may have acquired the capacity, not necessarily via horizontal gene transfer and/or recombination events, to infect the other bacterial species. The high DNA similarity shown by LgaI and Lj771 (10) and EJ-1 (36) may suggest a capacity for interspecies cross-infection similar to that reported for L. plantarum and L. brevis phages (25). Furthermore, the predicted existence of DNA uptake systems in various sequenced lactobacilli (2, 20, 33) may also have allowed modular exchanges between bacteriophages that infect different species.

Previous phage transcription studies in Streptococcus, Lactococcus, and Lactobacillus have shown that large parts of the prophage genome were transcriptionally silent during the lysogenic state, while genes near either attachment site were highly transcribed (38, 40, 41, 43). A similar pattern was identified for L. gasseri LgaI and L. salivarius Sal1, Sal2, Sal3, and Sal4. Transcription analysis revealed the presence of mRNA encompassing the presumed phage repressor and superinfection exclusion genes and the lack of expression of the cro-like gene. Furthermore, all prophage genome regions corresponding to the structural part of the phage and DNA replication appeared to be transcriptionally silent. Interestingly, the lysin-encoding genes in Sal1 and Sal2 prophages were shown to be transcribed, although the significance of this finding is still unknown in terms of culture lysis. In fact, either the transcript may not be translated in significant amounts or the corresponding enzyme is not functional. Another hypothesis is that it acts as a hok/sok-like portioning system; however, no homology to these systems has been identified. The experimental observations accord with the theoretical expectations in that the genes encoding immunity functions (cI and sie) should be expressed during the lysogenic state. Notably, the genes located between the lysin and the attR (presumed lysogenic conversion region) were highly transcribed in the LgaI prophage. A previous study identified an alternative candidate for the lysogenic conversion region within the lysogeny module (41). Of note, in Sal1 the DNA region encompassing ORFs 448 to 442, which encodes a putative transposase and hypothetical protein, was transcribed during the lysogenic state. In phages infecting bacterial pathogens, this region carries genes that may contribute to a selective advantage to the lysogens (11, 19). In many dairy prophages it has been reported that the transcription of genes located in the lysogenic conversion region is more prominent than that of the phage repressor (38, 43). These observations suggest a physiological function for these prophage genes in the lysogen. So far, the lack of functional characterization to support the bioinformatic predictions for these phage genes makes it difficult to speculate about possible lysogenic conversion phenotypes. Conversely, the LgaI genome contains a small gene within the lysogenic conversion region, which showed a very limited similarity at the amino acid level with peptide toxin Fst encoded by the par toxin-antitoxin stability determinant. These systems have been detected in different bacteria, including in the pau-LA III remnant of L. acidophilus NCFM (2) and in E. coli phage P1 (16, 32). These par systems act in general as a maintenance killer system of prophages or plasmids. However, the identity between the LgaI gene and fst is very low, and therefore no definitive role can be attributed to these genes in this L. gasseri prophage.

Paradoxically, all prophage sequences that have been identified in Lactobacillus genomes appear to be very stable since attempts to induce their excision have failed so far (40, 41). However, LgaI and Sal2 appeared to be complete phages that can be excised from their bacterial host. Interestingly, although the Sal4 prophage-like element appears to represent a deficient bacteriophage, it was shown to be inducible and perhaps constitutes a functional satellite phage that can become mobile in a manner similar to that described for the cryptic mycophages Rv1 and Rv2 (22).

The mobility of Lactobacillus prophage DNA was assessed by PFGE hybridization. As demonstrated in this study, DNA from the majority of a representative set of strains for each of the species tested indicates a narrow range of distribution in L. gasseri, L. salivarius, and L. casei species. This observation confirms a previous study where two L. johnsonii NCC 533 prophages were found to constitute a substantial part of the strain-specific DNA (39). Similarly, prophages of L. plantarum WCFS1 seem to be narrowly distributed within their own bacterial species (41).

A number of additional Lactobacillus genomes are currently being sequenced, making it likely that other prophage sequences will be identified. This increased resource of (Lactobacillus) phage sequences will expand our ability to provide answers by comparative genomics to questions such as those concerning horizontal versus vertical DNA transfer within different species of Lactobacillus.

Supplementary Material

[Supplemental material]

Acknowledgments

This work was financially supported by the Department of Agriculture and Food FIRM Program under the National Development Plan 2000-2006, by the Higher Education Authority Programme for Research in Third Level Institutions (PRTLI3), by the Science Foundation Ireland Alimentary Pharmabiotic Centre located at University College Cork, by a Marie Curie Development Host Fellowship (HPMD-2000-00027) to M.V., by an IRCSET Embark postdoctoral fellowship scheme 2005 to C.C., and by Dairy Management Inc. Efforts at North Carolina State University were supported by the North Carolina Dairy Foundation, Southeast Dairy Foods Research Center, and Danisco USA, Inc. (Madison, WI).

Genome sequencing of L. gasseri was carried out by the Joint Genome Institute of the U.S. Department of Energy and Fidelity Systems, Inc., in conjunction with the Lactic Acid Bacteria Genome Consortium.

Finally, we thank Paul Ross, Mike Callanan, and Tom Beresford for sharing with us their unpublished results on L. helveticus DPC4571 genome sequences.

Footnotes

†

Supplemental material for this article may be found at http://aem.asm.org/.

REFERENCES

  • 1.Altermann, E., J. R. Klein, and B. Henrich. 1999. Primary structure and features of the genome of the Lactobacillus gasseri temperate bacteriophage φadh. Gene 236:333-346. [DOI] [PubMed] [Google Scholar]
  • 2.Altermann, E., W. M. Russell, M. A. Azcarate-Peril, R. Barrangou, B. L. Buck, O. McAuliffe, N. Souther, A. Dobson, T. Duong, M. Callanan, S. Lick, A. Hamrick, R. Cano, and T. R. Klaenhammer. 2005. Complete genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus NCFM. Proc. Natl. Acad. Sci. USA 102:3906-3912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Altschul, S. F., T. L. Madden, A. A. Shaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Beres, S. B., G. L. Sylva, K. D. Barbian, B. Lei, J. S. Hoff, N. D. Mammarella, M. Y. Liu, J. C. Smoot, S. F. Porcella, L. D. Parkins, D. S. Campbell, T. M. Smith, J. K. McCormick, D. Y. Leung, P. M. Shlievert, and J. M. Musser. 2002. Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype and clone emergence. Proc. Natl. Acad. Sci. USA 99:10078-10083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Boyce, J. D., B. E. Davidson, and A. J. Hiller. 1995. Identification of prophage genes expressed in lysogens of the Lactococcus lactis bacteriophage BK5-T. Appl. Environ. Microbiol. 61:4099-4104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Boyd, E. F., and H. Brussow. 2002. Common themes among bacteriophage-encoded virulence factors and diversity among the bacteriophages involved. Trends Microbiol. 10:521-529. [DOI] [PubMed] [Google Scholar]
  • 7.Canchaya, C., C. Proux, A. Bruttin, and H. Brussow. 2003. Prophage genomics. Microbiol. Mol. Biol. Rev. 67:238-276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Casjens, S., G. Hatfull, and R. Hendrix. 1992. Evolution of dsDNA tailed-bacteriophage genomes. Semin. Virol. 3:383-397. [Google Scholar]
  • 9.Chopin, A., A. Bolotin, A. Sorokin, S. D. Ehrlich, and M. Chopin. 2001. Analysis of six prophages in Lactococcus lactis IL1403: different genetic structure of temperate and virulent phage populations. Nucleic Acids Res. 29:644-651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Desiere, F., and H. Brussow. 2000. Comparative genomics of the late gene cluster from Lactobacillus phages. Virology 275:294-305. [DOI] [PubMed] [Google Scholar]
  • 11.Desiere, F., W. M. McShan, D. van Sinderen, J. J. Ferretti, and H. Brussow. 2001. Comparative genomics reveals close genetic relationships between phages from dairy bacteria and pathogenic streptococci: evolutionary implications for prophage-host interactions. Virology 288:325-341. [DOI] [PubMed] [Google Scholar]
  • 12.Felsenstein, J. 1993. PHYLIP (phylogeny inference package) version 3.5c. Department of Genetics, University of Washington, Seattle, Wash.
  • 13.Foley, S., A. Bruttin, and H. Brussow. 2000. Widespread distribution of a group I intron and its three deletion derivatives in the lysin gene of Streptococcus thermophilus bacteriophages. J. Virol. 74:611-618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fujishawa, T., Y. Benno, T. Yaeshima, and T. Mitsuoka. 1992. Taxonomic study of the Lactobacillus acidophilus group, with recognition of Lactobacillus gallinarum sp. nov. and Lactobacillus johnsonii sp. nov. and synonym of Lactobacillus acidophilus group A3 (Johnson et al. 1980) with type-strain of Lactobacillus amylovorus (Nakamura 1981). Int. J. Syst. Bacteriol. 42:487-491. [DOI] [PubMed] [Google Scholar]
  • 15.Hendrich, B., B. Binishofer, and U. Blasi. 1995. Primary structure and functional analysis of the lysis genes of Lactobacillus gasseri bacteriophage phi adh. J. Bacteriol. 177:723-732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jansen, R., J. D. van Embden, W. Gaastra, and L. M. Schouls. 2002. Identification of a novel family of sequence repeats among prokaryotes. OMICS 6:23-33. [DOI] [PubMed] [Google Scholar]
  • 17.Johnson, J. L., C. F. Phelps, C. S. Cummins, J. London, and F. Gasser. 1980. Taxonomy of the Lactobacillus acidophilus group. Int. J. Syst. Bacteriol. 30:53-68. [Google Scholar]
  • 18.Kandler, O., and N. Weiss. 1986. Regular, nonsporing gram-positive rods, p. 1208-1260. In P. H. A. Sneath, N. S. Mair, M. E. Sharpe, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. William & Wilkins, Baltimore, Md. [Google Scholar]
  • 19.Kaneko, J., T. Kimura, S. Narita, T. Tomita, and Y. Kamio. 1998. Complete nucleotide sequence and molecular characterization of the temperate staphylococcal bacteriophage PVL carrying Panton-Valentine leukocidin genes. Gene 215:57-67. [DOI] [PubMed] [Google Scholar]
  • 20.Kleerebezem, M., J. Boekhorst, R. van Kranenburg, D. Molenaar, O. P. Kuipers, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. W. Fiers, W. Stiekema, R. M. Lankhorst, P. A. Bron, S. M. Hoffer, M. N. Groot, R. Kerkhoven, M. de Vries, B. Ursing, W. M. de Vos, and R. J. Siezen. 2003. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. USA 100:1990-1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kodaira, K. I., M. Kakikawa, N. Watanabe, M. Hirakawa, K. Yamada, and A. Taketo. 1997. Genome structure of the Lactobacillus temperate phage φg1e: the whole genome sequence and the putative promoter/repressor system. Gene 187:45-53. [DOI] [PubMed] [Google Scholar]
  • 22.Lindqvist, B. H., G. Deho, and R. Calendar. 1993. Mechanisms of genome propagation and helper exploitation by satellite phage P4. Microbiol. Rev. 57:683-702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lipman, D. J., and W. R. Pearson. 1985. Rapid and sensitive protein similarity searches. Science 227:1435-1441. [DOI] [PubMed] [Google Scholar]
  • 24.Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25:955-964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lu, Z., F. Breidt, Jr., H. P. Fleming, E. Altermann, and T. R. Klaenhammer. 2003. Isolation and characterization of a Lactobacillus plantarum bacteriophage, φJL-1, from a cucumber fermentation. Int. J. Food Microbiol. 84:225-235. [DOI] [PubMed] [Google Scholar]
  • 26.Lucchini, S., F. Desiere, and H. Brussow. 1999. Comparative genomics of Streptococcus thermophilus phage species supports a modular evolution theory. J. Virol. 73:8647-8656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lucchini, S., F. Desiere, and H. Brussow. 1999. Similarly organized lysogeny modules in temperate Siphoviridae from low GC content gram-positive bacteria. Virology 263:427-435. [DOI] [PubMed] [Google Scholar]
  • 28.McGrath, S., G. F. Fitzgerald, and D. van Sinderen. 2002. Identification and characterization of phage-resistance genes in temperate lactococcal bacteriophages. Mol. Microbiol. 43:509-520. [DOI] [PubMed] [Google Scholar]
  • 29.McGrath, S., J. Seegers, G. F. Fitzgerald, and D. van Sinderen. 1999. Molecular characterization of a phage-encoded resistance system in Lactococcus lactis. Appl. Environ. Microbiol. 65:1891-1899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mendz, G. L., and S. L. Hazell. 1996. The urea cycle of Helicobacter pylori. Microbiology 142:2959-2967. [DOI] [PubMed] [Google Scholar]
  • 31.Mikkonen, M., L. Dupont, T. Alatossava, and P. Ritzenthaler. 1996. Defective site-specific integration elements are present in the genome of virulent bacteriophage LL-H of Lactobacillus delbrueckii. Appl. Environ. Microbiol. 62:1847-1851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pecota, D. C., C. S. Kim, K. Wu, K. Gerdes, and T. K. Wood. 1997. Combining the hok/sok, parDE, and pnd postsegregational killer loci to enhance plasmid stability. Appl. Environ. Microbiol. 63:1917-1924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Pridmore, R. D., B. Berger, F. Desiere, D. Vilanova, C. Barretto, A. C. Pittet, M. C. Zwahlen, M. Rouvet, E. Altermann, R. Barrangou, B. Mollet, A. Mercenier, T. Klaenhammer, F. Arigoni, and M. A. Schell. 2004. The genome sequence of the probiotic intestinal bacterium Lactobacillus johnsonii NCC 533. Proc. Natl. Acad. Sci. USA 101:2512-2517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Proux, C., D. van Sinderen, J. Suarez, P. Garcia, V. Ladero, G. F. Fitzgerald, F. Desiere, and H. Brussow. 2002. The dilemma of phage taxonomy illustrated by comparative genomics of Sfi21-like Siphoviridae in lactic acid bacteria. J. Bacteriol. 184:6026-6036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rohwer, F., and R. Edwards. 2002. The phage proteomic tree: a genome based taxonomy for phage. J. Bacteriol. 184:4529-4535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Romero, P., R. Lopez, and E. Garcia. 2004. Genomic organization and molecular analysis of the inducible prophage EJ-1, a mosaic myovirus from an atypical pneumococcus. Virology 322:239-252. [DOI] [PubMed] [Google Scholar]
  • 37.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 38.Ventura, M., A. Bruttin, C. Canchaya, and H. Bruessow. 2002. Transcription analysis of Streptococcus thermophilus phages in the lysogenic state. Virology 302:21-32. [DOI] [PubMed] [Google Scholar]
  • 39.Ventura, M., C. Canchaya, and H. Brussow. 2003. Integration and distribution of Lactobacillus johnsonii prophages. J. Bacteriol. 185:4603-4608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ventura, M., C. Canchaya, and H. Brussow. 2004. The prophages of Lactobacillus johnsonii NCC 533: comparative genomics and transcription analysis. Virology 320:229-242. [DOI] [PubMed] [Google Scholar]
  • 41.Ventura, M., C. Canchaya, M. Kleerebezem, W. M. de Vos, R. Siezen, and H. Brussow. 2003. The prophages sequences of Lactobacillus plantarum strain WCFS1. Virology 316:245-255. [DOI] [PubMed] [Google Scholar]
  • 42.Ventura, M., J. H. Lee, C. Canchaya, R. Zink, S. Leahy, J. A. Moreno-Munoz, M. O'Connell-Motherway, D. Higgins, G. F. Fitzgerald, D. J. O'Sullivan, and D. van Sinderen. 2005. Prophage-like elements in bifidobacteria: insights from genomics, transcription, integration, distribution and phylogenetic analysis. Appl. Environ. Microbiol. 71:8692-8705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ventura, M., S. Foley, A. Bruttin, C. Canchaya, and H. Brussow. 2003. Transcription mapping as a tool in phage genomics: the case of temperate Streptococcus thermophilus phage Sfi21. Virology 296:62-76. [DOI] [PubMed] [Google Scholar]
  • 44.Walker, D. C., H. S. Girgis, and T. R. Klaenhammer. 1999. The groESL chaperone operon of Lactobacillus johnsonii. Appl. Env. Microbiol. 65:3033-3041. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES