Novel Thermophilic Sulfate-Reducing Bacteria from a Geothermally Active Underground Mine in Japan

Abstract

Thermophilic sulfate-reducing bacteria were enriched from samples obtained from a geothermal underground mine in Japan. The enrichment cultures contained bacteria affiliated with the genera Desulfotomaculum, Thermanaeromonas, Thermincola, Thermovenabulum, Moorella, “Natronoanaerobium,” and Clostridium. Two novel thermophilic sulfate-reducing strains, RL50JIII and RL80JIV, affiliated with the genera Desulfotomaculum and Thermanaeromonas, respectively, were isolated.

Thermophilic sulfate-reducing prokaryotes (TSRP) have increasingly attracted interest due to their potential in various biotechnological applications, such as biodesulfurization of flue gases and biohydrometallurgical processes (13, 21). The majority of TSRP have been isolated from geothermal habitats, including oil field waters (1, 2, 30), hot springs (12, 19, 27, 35), and geothermal groundwaters (5, 22). The objective of the present study was to enrich and isolate TSRP from a geothermal underground mine in Japan.

Samples were obtained from the underground mine, 250 m below ground, from a black sediment layer beneath a thin red layer (overall thickness of approximately 1 mm) on a tunnel wall that was covered with ferric iron. Sulfate-reducing and other anaerobic bacteria were enriched at 50°C and 80°C using modified Postgate and Pfennig media (18). Sulfate reducers were isolated with anaerobic roll tubes (solidified with 1.5% agar or Gelrite gellan gum). The isolates were examined by phase-contrast microscopy (Zeiss Axioskop 2). Spore formation by the strains was examined microscopically and by testing for growth after heat treatment (95°C for 25 min). The Gram type was determined by both Gram staining and the KOH test (10).

The enrichment cultures were characterized by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes. Nucleic acids were extracted with a bead-beating method (29). The 16S rRNA genes were amplified using a nested-PCR approach with outer primer pair 27F and 1492R and inner primer pair 357F-GC and 907R (Table 1). The PCR conditions used were described previously (17), but in the second PCR, the annealing temperature was 40°C. The PCR products were purified with a QIAquick PCR purification kit (QIAGEN). DGGE was performed using a DCode universal mutation detection system (Bio-Rad Laboratories) (17). The DGGE bands were reamplified using primers 357F (no GC clamp) and 907R (Table 1) and sequenced with primer 357F. The 16S rRNA genes of the isolates were amplified and sequenced (with primers shown in Table 1), and a phylogenetic tree was constructed as previously described (17, 18).

TABLE 1.

Target positions of the PCR and sequencing primers used in this study

Primera	Positionsb	Sequence (5′ to 3′)	Target	Reference
27F	11-27	GTTGATCCTGGCTCAG	Bacteria	20c
357F-GCd	341-357	CCTACGGGAGGCAGCAG	Bacteria	25
530F	515-530	GTGCCAGCMGCCGCGG	Universal	20
518R	518-534	ATTACCGCGGCTGCTGG	Universal	25
704F	685-704	GTAGCGGTGAAATGCGTAGA	Bacteria	20c
787R	787-803	CTACCAGGGTATCTAAT	Universal	14
907R	907-926	CCGTCAATTCMTTTGAGTTT	Universal	20c
1100R	1100-1115	AGGGTTGCGCTCGTTG	Bacteria	20c
1492R	1492-1512	ACGGYTACCTTGTTACGACTT	Prokaryotes	20c

^aThe number corresponds to the Escherichia coli position (3) to which the 3′ end of the primer anneals. F and R correspond to forward and reverse primer, respectively.

^bE. coli numbering.

^cModified from the original primer.

^dGC is a 40-nucleotide GC-rich sequence attached to the 5′ end of the primer. The GC sequence is 5′-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG-3′ (25).

Genomic DNA for G+C content (mol%) determination and DNA-DNA hybridization was released by rupturing cells with a French pressure cell (Thermo Spectronic) and purified by chromatography on hydroxyapatite (4). The DNA was hydrolyzed with P1 nuclease, and the nucleotides were dephosphorylated with bovine alkaline phosphatase (23). The G+C content of the resulting deoxyribonucleosides was determined by reversed-phase high-performance liquid chromatography (Shimadzu Corp., Japan) and calculated from the ratio of deoxyguanosine to deoxythymidine (23). DNA-DNA hybridization was performed according to the method of De Ley et al. (6) with the modifications described previously (9, 15) using a Gilford model 2600 spectrophotometer with a Gilford model 2527-R thermoprogrammer and plotter. Renaturation rates were computed with the TRANSFER.BAS program of Jahnke (16).

The effects of temperature, pH, and NaCl on growth were determined in modified DSM medium 641 containing lactate or pyruvate (20 mM) as an electron donor. The temperature range for growth was determined using a model TN-3 temperature gradient incubator (Toyo Kagaku Sangyo Co., Ltd., Tokyo, Japan). The pH optimum was determined using a variety of pH buffers (at 10 mM): MES (morpholineethanesulfonic acid; pHs 5.5 and 6); PIPES [piperazine-N,N′-bis(2-ethanesulfonic acid); pHs 6.5 and 7]; MOPS (morpholinepropanesulfonic acid; pHs 7.25 and 7.5); HEPES (pHs 7.75 and 8); Tris (pH 8.5); CHES [2-(N-cyclohexylamino)ethanesulfonic acid; pH 9.5]; and CAPSO [3-(cyclohexylamino)-2-hydroxypropanesulfonic acid; pHs 10 and 10.5]. The growth rate was determined from the straight-line portion of a plot of the natural log of optical density (660 nm) versus time (Ultrospec II LKB Biochrom 4050 UV/visible spectrophotometer).

The strains RL50JIII and RL80JIV were deposited with DSMZ under the accession numbers DSM 16057 and DSM 16036, respectively.

Several thermophilic cultures were enriched at 50°C and 80°C from the geothermal underground mine. The sequence analysis of DGGE fragments revealed the presence of bacteria affiliated with the genera Desulfotomaculum, Thermanaeromonas, Thermincola, Thermovenabulum, Moorella, “Natronoanaerobium,” and Clostridium in the enrichments (Fig. 1 and 2). The closest relatives were Clostridium thermosuccinogenes (96% similar to DGGE-J1), Thermincola carboxydophila (90% similar to DGGE-J2), Desulfotomaculum kuznetsovii or Desulfotomaculum solfataricum (both 99% similar to DGGE-J3 and DGGE-J4), Desulfotomaculum luciae, D. kuznetsovii, or D. solfataricum (95% similar to DGGE-J9), Moorella glycerini (99% similar to DGGE-J5), “Natronoanaerobium aggerbacterium” (89% similar to DGGE-J6), Thermovenabulum ferriorganovorum (93% similar to DGGE-J7), and Thermanaeromonas toyohensis (95% similar to DGGE-J8 and 99% similar to DGGE-J10).

FIG. 1.

DGGE profiles of the partial 16S rRNA gene fragments for enrichment cultures from two Japanese samples (III and IV) at 50°C or 80°C using Postgate (A, acetate; E, ethanol; L, lactate [electron donor]) or Pfennig (Pf) medium. The marked unnumbered bands were excised but did not produce readable sequence data.

FIG. 2.

Phylogenetic tree generated using distance matrix and neighbor-joining methods based on the 16S rRNA gene sequences of DGGE fragments (480 to 531 bp between Escherichia coli positions 367 and 906 [3]) and isolates (1,436 to 1,505 bp between E. coli positions 28 and 1,453) obtained from two Japanese samples (III and IV) and reference sequences from databases. Archaeoglobus veneficus (accession number AF418181) was used as the outgroup. Numbers at the nodes represent bootstrap values based on 1,000 samplings. The scale bar indicates 0.05 changes per nucleotide.

Two sulfate-reducing strains, RL50JIII and RL80JIV, were isolated from lactate-containing enrichment cultures at 50°C and 80°C, respectively. Both strains were gram-positive, motile spore-forming rods. The temperature for growth of strain RL50JIII ranged from 50°C to 72°C (optimum, 61 to 66°C). Strain RL80JIV grew over the temperature range of 61 to 80°C (optimum, 67 to 73°C) (Fig. 3a). The pH range for growth of strain RL50JIII was 6.4 to 7.8 (optimum, pH 7.2 to 7.4). The pH range for growth of strain RL80JIV was 6.4 to 7.9 (optimum, pH 6.8 to 7.3) (Fig. 3b). Strain RL50JIII grew in the presence of up to 1.5% NaCl (its fastest growth was at 0 to 1% NaCl). Strain RL80JIV grew in the presence of up to 0.5% NaCl (its fastest growth was at 0% NaCl) (Fig. 3c).

FIG. 3.

Effects of (a) temperature, (b) pH, and (c) NaCl on growth of strains RL50JIII (closed circles) and RL80JIV (open circles). The specific growth rates at different pHs and NaCl concentrations were calculated as means of results from duplicate cultures (error bars show standard deviations).

Based on 16S rRNA gene sequencing, the closest relative of strain RL50JIII was Desulfotomaculum solfataricum (98.7% 16S rRNA gene similarity) (Fig. 2). The DNA-DNA similarities of RL50JIII were 59.5%, 47.8%, and 47.4% with Desulfotomaculum kuznetsovii DSM 6115, D. luciae DSM 12396, and D. solfataricum DSM 14956, respectively, indicating a new species (33). Strain RL80JIV was affiliated with thiosulfate-reducing Thermanaeromonas toyohensis (90.9% 16S rRNA gene similarity), which was isolated from the Toyoha Mine, in Japan (24). However, the strain also shared 90.0% sequence similarity with Desulfotomaculum thermocisternum and clustered among the Desulfotomaculum species in the phylogenetic tree (Fig. 2). At this level of sequence similarity, this organism must represent at least a new species, if not a new genus (33). The G+C contents of the genomic DNA of strains RL50JIII and RL80JIV were 54.5 and 60.1 mol%, respectively.

The role of TSRP in geothermal mine areas may be to attenuate acid mine drainage naturally by reducing sulfur compounds with organic compounds or hydrogen and to promote the formation of metal sulfides (8, 32). Both RL50JIII and RL80JIV were able to use sulfate, sulfite, thiosulfate, and sulfur as electron acceptors and to grow autotrophically using H₂ and CO₂ as the sole sources of energy and carbon, respectively (data not shown). H₂S oxidizers serve as primary producers in hydrothermal vents (8), and in a similar manner, sulfur- and iron-oxidizing autotrophs provide organic electron donors and carbon sources for sulfate reduction in geothermal underground mines. Salo-Zieman et al. (31) recently described a Sulfolobus sp.-dominated thermophilic iron- and sulfur-oxidizing enrichment culture obtained from the same underground mine. Hydrogen has been suggested to be an important electron and energy source for deep subsurface microbial life (28). Pedersen (28) proposed a hypothesis of a deep hydrogen-driven biosphere, where at relevant temperature and water availability conditions, intraterrestrial microorganisms are capable of performing a life cycle that is independent of sun-driven ecosystems. Hydrogen and carbon dioxide from the deep crust of the earth are used as energy and carbon sources (28). Another source of hydrogen in the subsurface may be fermentative microorganisms which scavenge cell debris. In this study, the PCR-DGGE approach revealed the presence of species related to known hydrogen producers, such as Clostridium thermosuccinogenes (7) and Thermovenabulum ferriorganovorum (34). Nakagawa et al. (26) proposed that the ability to grow autotrophically with H₂ as the electron donor by sulfate reduction is essential for sulfate-reducing bacteria to survive and distribute in deep-rock aquifers, as are the phenotypes for high optimum temperature and spore formation. An engineering solution for enhancing natural acid mine drainage remediation may be to stimulate the biological hydrogen sulfide production by supplying organic matter to the abandoned underground mine shafts (11).

Nucleotide sequence accession numbers.

The 16S rRNA gene sequences of the isolated strains and the DGGE fragments were deposited in the GenBank database under accession numbers DQ208688 to DQ208699.