Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1998 Feb 15;26(4):1070–1075. doi: 10.1093/nar/26.4.1070

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

W R Jones 1, M P Stone 1
PMCID: PMC147363  PMID: 9461470

Abstract

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Full Text

The Full Text of this article is available as a PDF (151.2 KB).

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Aoyama T., Yamano S., Guzelian P. S., Gelboin H. V., Gonzalez F. J. Five of 12 forms of vaccinia virus-expressed human hepatic cytochrome P450 metabolically activate aflatoxin B1. Proc Natl Acad Sci U S A. 1990 Jun;87(12):4790–4793. doi: 10.1073/pnas.87.12.4790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bailey E. A., Iyer R. S., Harris T. M., Essigmann J. M. A viral genome containing an unstable aflatoxin B1-N7-guanine DNA adduct situated at a unique site. Nucleic Acids Res. 1996 Jul 15;24(14):2821–2828. doi: 10.1093/nar/24.14.2821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bailey E. A., Iyer R. S., Stone M. P., Harris T. M., Essigmann J. M. Mutational properties of the primary aflatoxin B1-DNA adduct. Proc Natl Acad Sci U S A. 1996 Feb 20;93(4):1535–1539. doi: 10.1073/pnas.93.4.1535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bressac B., Kew M., Wands J., Ozturk M. Selective G to T mutations of p53 gene in hepatocellular carcinoma from southern Africa. Nature. 1991 Apr 4;350(6317):429–431. doi: 10.1038/350429a0. [DOI] [PubMed] [Google Scholar]
  5. Callahan D. E., Trapane T. L., Miller P. S., Ts'o P. O., Kan L. S. Comparative circular dichroism and fluorescence studies of oligodeoxyribonucleotide and oligodeoxyribonucleoside methylphosphonate pyrimidine strands in duplex and triplex formation. Biochemistry. 1991 Feb 12;30(6):1650–1655. doi: 10.1021/bi00220a030. [DOI] [PubMed] [Google Scholar]
  6. Cho B. P., Beland F. A., Marques M. M. NMR structural studies of a 15-mer DNA duplex from a ras protooncogene modified with the carcinogen 2-aminofluorene: conformational heterogeneity. Biochemistry. 1994 Feb 15;33(6):1373–1384. doi: 10.1021/bi00172a013. [DOI] [PubMed] [Google Scholar]
  7. Cho B. P., Beland F. A., Marques M. M. NMR structural studies of a 15-mer DNA sequence from a ras protooncogene, modified at the first base of codon 61 with the carcinogen 4-aminobiphenyl. Biochemistry. 1992 Oct 13;31(40):9587–9602. doi: 10.1021/bi00155a011. [DOI] [PubMed] [Google Scholar]
  8. Croy R. G., Essigmann J. M., Reinhold V. N., Wogan G. N. Identification of the principal aflatoxin B1-DNA adduct formed in vivo in rat liver. Proc Natl Acad Sci U S A. 1978 Apr;75(4):1745–1749. doi: 10.1073/pnas.75.4.1745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. D'Andrea A. D., Haseltine W. A. Modification of DNA by aflatoxin B1 creates alkali-labile lesions in DNA at positions of guanine and adenine. Proc Natl Acad Sci U S A. 1978 Sep;75(9):4120–4124. doi: 10.1073/pnas.75.9.4120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Eckel L. M., Krugh T. R. 2-Aminofluorene modified DNA duplex exists in two interchangeable conformations. Nat Struct Biol. 1994 Feb;1(2):89–94. doi: 10.1038/nsb0294-89. [DOI] [PubMed] [Google Scholar]
  11. Eckel L. M., Krugh T. R. Structural characterization of two interchangeable conformations of a 2-aminofluorene-modified DNA oligomer by NMR and energy minimization. Biochemistry. 1994 Nov 22;33(46):13611–13624. doi: 10.1021/bi00250a012. [DOI] [PubMed] [Google Scholar]
  12. Essigmann J. M., Croy R. G., Nadzan A. M., Busby W. F., Jr, Reinhold V. N., Büchi G., Wogan G. N. Structural identification of the major DNA adduct formed by aflatoxin B1 in vitro. Proc Natl Acad Sci U S A. 1977 May;74(5):1870–1874. doi: 10.1073/pnas.74.5.1870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Feng B., Stone M. P. Solution structure of an oligodeoxynucleotide containing the human n-ras codon 61 sequence refined from 1H NMR using molecular dynamics restrained by nuclear Overhauser effects. Chem Res Toxicol. 1995 Sep;8(6):821–832. doi: 10.1021/tx00048a002. [DOI] [PubMed] [Google Scholar]
  14. Gopalakrishnan S., Byrd S., Stone M. P., Harris T. M. Carcinogen-nucleic acid interactions: equilibrium binding studies of aflatoxin B1 with the oligodeoxynucleotide d(ATGCAT)2 and with plasmid pBR322 support intercalative association with the B-DNA helix. Biochemistry. 1989 Jan 24;28(2):726–734. doi: 10.1021/bi00428a047. [DOI] [PubMed] [Google Scholar]
  15. Gopalakrishnan S., Harris T. M., Stone M. P. Intercalation of aflatoxin B1 in two oligodeoxynucleotide adducts: comparative 1H NMR analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2. Biochemistry. 1990 Nov 20;29(46):10438–10448. doi: 10.1021/bi00498a002. [DOI] [PubMed] [Google Scholar]
  16. Gopalakrishnan S., Liu X., Patel D. J. Solution structure of the covalent sterigmatocystin-DNA adduct. Biochemistry. 1992 Nov 10;31(44):10790–10801. doi: 10.1021/bi00159a021. [DOI] [PubMed] [Google Scholar]
  17. Gruenwedel D. W., Cruikshank M. K. Mercury-induced DNA polymorphism: probing the conformation of Hg(II)-DNA via staphylococcal nuclease digestion and circular dichroism measurements. Biochemistry. 1990 Feb 27;29(8):2110–2116. doi: 10.1021/bi00460a021. [DOI] [PubMed] [Google Scholar]
  18. Hsu I. C., Metcalf R. A., Sun T., Welsh J. A., Wang N. J., Harris C. C. Mutational hotspot in the p53 gene in human hepatocellular carcinomas. Nature. 1991 Apr 4;350(6317):427–428. doi: 10.1038/350427a0. [DOI] [PubMed] [Google Scholar]
  19. Iyer R. S., Harris T. M. Preparation of aflatoxin B1 8,9-epoxide using m-chloroperbenzoic acid. Chem Res Toxicol. 1993 May-Jun;6(3):313–316. doi: 10.1021/tx00033a010. [DOI] [PubMed] [Google Scholar]
  20. Johnson W. W., Guengerich F. P. Reaction of aflatoxin B1 exo-8,9-epoxide with DNA: kinetic analysis of covalent binding and DNA-induced hydrolysis. Proc Natl Acad Sci U S A. 1997 Jun 10;94(12):6121–6125. doi: 10.1073/pnas.94.12.6121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Johnson W. W., Yamazaki H., Shimada T., Ueng Y. F., Guengerich F. P. Aflatoxin B1 8,9-epoxide hydrolysis in the presence of rat and human epoxide hydrolase. Chem Res Toxicol. 1997 Jun;10(6):672–676. doi: 10.1021/tx960209j. [DOI] [PubMed] [Google Scholar]
  22. Johnston D. S., Stone M. P. Refined solution structure of 8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 opposite CpA in the complementary strand of an oligodeoxynucleotide duplex as determined by 1H NMR. Biochemistry. 1995 Oct 31;34(43):14037–14050. doi: 10.1021/bi00043a009. [DOI] [PubMed] [Google Scholar]
  23. Kobertz W. R., Wang D., Wogan G. N., Essigmann J. M. An intercalation inhibitor altering the target selectivity of DNA damaging agents: synthesis of site-specific aflatoxin B1 adducts in a p53 mutational hotspot. Proc Natl Acad Sci U S A. 1997 Sep 2;94(18):9579–9584. doi: 10.1073/pnas.94.18.9579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
  25. McCann J., Spingarn N. E., Kobori J., Ames B. N. Detection of carcinogens as mutagens: bacterial tester strains with R factor plasmids. Proc Natl Acad Sci U S A. 1975 Mar;72(3):979–983. doi: 10.1073/pnas.72.3.979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. McMahon G., Davis E. F., Huber L. J., Kim Y., Wogan G. N. Characterization of c-Ki-ras and N-ras oncogenes in aflatoxin B1-induced rat liver tumors. Proc Natl Acad Sci U S A. 1990 Feb;87(3):1104–1108. doi: 10.1073/pnas.87.3.1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Moe J. G., Reddy G. R., Marnett L. J., Stone M. P. 1H NMR characterization of a duplex oligodeoxynucleotide containing propanodeoxyguanosine opposite a two-base deletion in the (CpG)3 frameshift hotspot of Salmonella typhimurium hisD3052. Chem Res Toxicol. 1994 May-Jun;7(3):319–328. doi: 10.1021/tx00039a008. [DOI] [PubMed] [Google Scholar]
  28. Moser H. E., Dervan P. B. Sequence-specific cleavage of double helical DNA by triple helix formation. Science. 1987 Oct 30;238(4827):645–650. doi: 10.1126/science.3118463. [DOI] [PubMed] [Google Scholar]
  29. Muro A. F., Pesce C. G., Kornblihtt A. R. DNA sequencing by the chemical method: a 10 minute procedure for the G+A reaction. Trends Genet. 1993 Oct;9(10):337–338. doi: 10.1016/0168-9525(93)90025-d. [DOI] [PubMed] [Google Scholar]
  30. Raney K. D., Coles B., Guengerich F. P., Harris T. M. The endo-8,9-epoxide of aflatoxin B1: a new metabolite. Chem Res Toxicol. 1992 May-Jun;5(3):333–335. doi: 10.1021/tx00027a002. [DOI] [PubMed] [Google Scholar]
  31. Raney K. D., Gopalakrishnan S., Byrd S., Stone M. P., Harris T. M. Alteration of the aflatoxin cyclopentenone ring to a delta-lactone reduces intercalation with DNA and decreases formation of guanine N7 adducts by aflatoxin epoxides. Chem Res Toxicol. 1990 May-Jun;3(3):254–261. doi: 10.1021/tx00015a011. [DOI] [PubMed] [Google Scholar]
  32. Raney V. M., Harris T. M., Stone M. P. DNA conformation mediates aflatoxin B1-DNA binding and the formation of guanine N7 adducts by aflatoxin B1 8,9-exo-epoxide. Chem Res Toxicol. 1993 Jan-Feb;6(1):64–68. doi: 10.1021/tx00031a010. [DOI] [PubMed] [Google Scholar]
  33. Ripley L. S. Model for the participation of quasi-palindromic DNA sequences in frameshift mutation. Proc Natl Acad Sci U S A. 1982 Jul;79(13):4128–4132. doi: 10.1073/pnas.79.13.4128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shimada T., Guengerich F. P. Evidence for cytochrome P-450NF, the nifedipine oxidase, being the principal enzyme involved in the bioactivation of aflatoxins in human liver. Proc Natl Acad Sci U S A. 1989 Jan;86(2):462–465. doi: 10.1073/pnas.86.2.462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Singh U. S., Moe J. G., Reddy G. R., Weisenseel J. P., Marnett L. J., Stone M. P. 1H NMR of an oligodeoxynucleotide containing a propanodeoxyguanosine adduct positioned in a (CG)3 frameshift hotspot of Salmonella typhimurium hisD3052: Hoogsteen base-pairing at pH 5.8. Chem Res Toxicol. 1993 Nov-Dec;6(6):825–836. doi: 10.1021/tx00036a012. [DOI] [PubMed] [Google Scholar]
  36. Soman N. R., Wogan G. N. Activation of the c-Ki-ras oncogene in aflatoxin B1-induced hepatocellular carcinoma and adenoma in the rat: detection by denaturing gradient gel electrophoresis. Proc Natl Acad Sci U S A. 1993 Mar 1;90(5):2045–2049. doi: 10.1073/pnas.90.5.2045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Stone M. P., Gopalakrishnan S., Harris T. M., Graves D. E. Carcinogen-nucleic acid interactions: equilibrium binding studies of aflatoxins B1 and B2 with DNA and the oligodeoxynucleotide d(ATGCAT)2. J Biomol Struct Dyn. 1988 Apr;5(5):1025–1041. doi: 10.1080/07391102.1988.10506447. [DOI] [PubMed] [Google Scholar]
  38. Streisinger G., Okada Y., Emrich J., Newton J., Tsugita A., Terzaghi E., Inouye M. Frameshift mutations and the genetic code. This paper is dedicated to Professor Theodosius Dobzhansky on the occasion of his 66th birthday. Cold Spring Harb Symp Quant Biol. 1966;31:77–84. doi: 10.1101/sqb.1966.031.01.014. [DOI] [PubMed] [Google Scholar]
  39. Strobel S. A., Dervan P. B. Single-site enzymatic cleavage of yeast genomic DNA mediated by triple helix formation. Nature. 1991 Mar 14;350(6314):172–174. doi: 10.1038/350172a0. [DOI] [PubMed] [Google Scholar]
  40. Strobel S. A., Doucette-Stamm L. A., Riba L., Housman D. E., Dervan P. B. Site-specific cleavage of human chromosome 4 mediated by triple-helix formation. Science. 1991 Dec 13;254(5038):1639–1642. doi: 10.1126/science.1836279. [DOI] [PubMed] [Google Scholar]
  41. Weisenseel J. P., Moe J. G., Reddy G. R., Marnett L. J., Stone M. P. Structure of a duplex oligodeoxynucleotide containing propanodeoxyguanosine opposite a two-base deletion in the (CpG)3 frame shift hotspot of Salmonella typhimurium hisD3052 determined by 1H NMR and restrained molecular dynamics. Biochemistry. 1995 Jan 10;34(1):50–64. doi: 10.1021/bi00001a007. [DOI] [PubMed] [Google Scholar]
  42. Wogan G. N. Aflatoxin carcinogenesis: interspecies potency differences and relevance for human risk assessment. Prog Clin Biol Res. 1992;374:123–137. [PubMed] [Google Scholar]
  43. Xodo L. E., Manzini G., Quadrifoglio F. Spectroscopic and calorimetric investigation on the DNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) at acidic pH. Nucleic Acids Res. 1990 Jun 25;18(12):3557–3564. doi: 10.1093/nar/18.12.3557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zegar I. S., Stone M. P. Solution structure of an oligodeoxynucleotide containing the human N-ras codon 12 sequence refined from 1H NMR using molecular dynamics restrained by nuclear Overhauser effects. Chem Res Toxicol. 1996 Jan-Feb;9(1):114–125. doi: 10.1021/tx9500787. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES