Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2005 Jul 21;568(Pt 2):445–458. doi: 10.1113/jphysiol.2005.092957

Functional role of Na+–HCO3− cotransport in migration of transformed renal epithelial cells

A Schwab 1, H Rossmann 2, M Klein 3, P Dieterich 4, B Gassner 3, C Neff 2, C Stock 1, U Seidler 2
PMCID: PMC1474735  PMID: 16037087

Abstract

Cell migration is crucial for immune defence, wound healing or formation of tumour metastases. It has been shown that the activity of the Na+–H+ exchanger (NHE1) plays an important role in cell migration. However, so far it is unknown whether Na+– HCO3− cotransport (NBC), which has similar functions in the regulation of intracellular pH (pHi) as NHE1, is also involved in cell migration. We therefore isolated NHE-deficient Madin-Darby canine kidney (MDCK-F) cells and tested whether NBC compensates for NHE in pHi and cell volume regulation as well as in migration. Intracellular pH was measured with the fluorescent pH indicator 2′7′-bis(carboxyethyl)-5-carboxyfluorescein (BCECF). The expression of NBC isoforms was determined with semiquantitative PCR. Migration was monitored with time-lapse video microscopy and quantified as the displacement of the cell centre. We found that MDCK-F cells express the isoform NBC1 (SLCA4A gene product) at a much higher level than the isoform kNBC3 (SLCA4A8 gene product). This difference is even more pronounced in NHE-deficient cells so that NBC1 is likely to be the major acid extruder in these cells and the major mediator of propionate-induced cell volume increase. NHE-deficient MDCK-F cells migrate more slowly than normal MDCK-F cells. NBC activity promotes migration during an acute intracellular acid load and increases migratory speed and displacement on a short timescale (< 30 min) whereas it has no effect on the long-term behaviour of migrating MDCK-F cells. Taken together, our results show that NBC actvity, despite many functional similarities, does not have the same importance for cell migration as NHE1 activity.

Na+–H+ exchangers (NHEs) are found ubiquitously, with different isoforms showing a high degree of tissue specificity (Counillon & Pouyssegur, 2000). NHE1 is regarded as the ‘house keeping’ isoform. Its major functions are intracellular pH (pHi) and cell volume regulation. However, it has also been shown to be involved in cell migration (Simchowitz & Cragoe, 1986; Rosengren et al. 1994; Ritter et al. 1998; Klein et al. 2000; Denker & Barber 2002). Cell migration plays an important role in physiological and pathophysiological processes such as embryogenesis, immune defence, wound healing and the formation of tumour metastases (Schwab, 2001). At least three functions of NHE1 appear to be important for cell migration. (i) NHE1 activity which is restricted to the front (lamellipodium) of migrating cells (Grinstein et al. 1993; Klein et al. 2000; Lagana et al. 2000; Denker & Barber, 2002) contributes to migration by acting as a solute transport protein (Rosengren et al. 1994; Klein et al. 2000; Denker & Barber, 2002). It operates in parallel with the Cl−–HCO3− exchanger, AE2, and causes a localized isosmotic regulatory volume increase at the leading edge of the lamellipodium (Lauffenburger & Horwitz, 1996; Mitchison & Cramer, 1996; Klein et al. 2000). (ii) NHE1 activity has a pronounced effect on the organization of the actin cytoskeleton (Vexler et al. 1996; Tominaga & Barber, 1998; Lagana et al. 2000). (iii) NHE1 functions as a plasma membrane anchor for actin filaments by binding to ezrin–radixin–moesin (ERM) (Denker et al. 2000). Therefore, it is not surprising that the lack of NHE1 has a pronounced effect on migratory behaviour (Denker & Barber, 2002; Dieterich et al. 2003).

Na+–HCO3− cotransporters (NBCs) share some of the functions of NHEs. They are also important regulators of intracellular pH homeostasis (Bevense et al. 1997), and they are also involved in transepithelial solute transport (Schmitt et al. 1999; Jacob et al. 2000; Soleimani & Burnham, 2000; Romero et al. 2004). However, to our knowledge it is not known whether their activity plays a role in cell migration. The restitution of frog injured gastric epithelium may rely on the availability of HCO3− (Svanes et al. 1983), and can be inhibited by stilbenes (Hagen et al. 2004). We therefore wanted to define the role of Na+–HCO3− cotransport in cell migration. We selected NHE-deficient MDCK-F cells by the ‘acid-suicide’ method (Pouysségur et al. 1984). We found that these cells rely on NBC activity for pHi homeostasis, and that they up-regulate NBC1 expression in relation to other membrane transport proteins. This makes them a good model for disclosing the possible role of NBC activity in cell migration more clearly. The contribution of NBCs to cell migration in NHE-deficient MDCK-F cells is compared to that in normal MDCK-F cells.

Methods

Cell culture

Experiments were carried out on transformed Madin-Darby canine kidney (MDCK-F) cells (Oberleithner et al. 1991) and on NHE-deficient MDCK-F cells. Cells were kept at 37°C in humidified air containing 5% CO2 and grown in bicarbonate-buffered minimal essential medium (MEM; pH 7.4) with Earle's salts (Biochrom, Berlin, Germany) supplemented with 10% fetal calf serum (Biochrom). Cells were plated on poly-l-lysine-coated coverslips (0.1 g l−1; Serva, Heidelberg, Germany) for pH measurements and for short-term migration experiments. Experiments were performed 1 and 2 days after seeding.

Isolation of NHE-deficient MDCK-F cells

We applied the acid-suicide technique originally described by Pouysségur et al. (1984). Some 1.2 × 107 cells were mutagenized for 16 h with 2.35 mm ethyl-methane-sulphonate. After 24 h, NHE-deficient MDCK-F cells were selected in two steps. First, cells were loaded with Li+ by incubating them for 2 h in Ringer solution in which all Na+ was replaced by Li+. In the second step, which lasted 1 h, Li+ was replaced by choline and extracellular pH was lowered to pH 5.5 (buffered with 20 mm Mes-Tris). Under these conditions NHEs mediate lethal uptake of H+ ions into the cell. Only cells devoid of NHE activity can survive. One clonal cell line was isolated after repeating this selection process four times.

Cell volume measurements

The effect of propionate on the volume of freshly trypsinized, suspended cells was determined electronically with a Coulter Counter (Coulter, Hialeah, FL, USA). We adopted the following protocol (Grinstein et al. 1984). Cells were suspended for equilibration either in Hepes- or in CO2/HCO3−-buffered Ringer solution for 10–15 min. Then aliquots were transferred into the experimental solutions containing (mm): sodium propionate 140, KCl 1, MgCl2 1, CaCl2 1, glucose 10 and Hepes 10; pH 7.4. Alternatively, NaHCO3 was isosmotically replaced by 24 mm sodium propionate. When needed, experimental solutions were supplemented with 10 μm ethyl-isopropyl-amiloride (EIPA) or 50 μm S0859. Cell volume was measured immediately after transfer to the experimental solutions and after 5, 10 and 15 min.

Measurements of pHi

Measurements of pHi of parent and NHE-deficient MDCK-F cells were made by using video-imaging techniques and the fluorescent pH indicator 2′7′-bis(carboxyethyl)-5-carboxyfluorescein (BCECF). (Molecular Probes, Eugene, OR, USA; Klein et al. 2000). For dye-loading, MDCK-F cells were incubated in culture medium containing 2 μm acetoxymethyl ester form of BCECF for 1–2 min. Coverslips were placed on the stage of an inverted microscope (Axiovert TV 100, Zeiss, Oberkochen, Germany) and continuously superfused with prewarmed (37°C) Ringer solution which contained (mm): NaCl 122.5, KCl 5.4, MgCl2 0.8, CaCl2 1.2, NaH2PO4 1.0, d-glucose 5.5 and Hepes 10.0; pH 7.4 titrated with 1 m NaOH. When indicated cells were superfused with CO2/HCO3−-buffered Ringer solution (equilibrated with 5% CO2; pH 7.4) containing 24 mm NaHCO3 (replacing NaCl isosmotically). Excitation wavelength alternated between 488 nm and 460 nm. The emitted fluorescence was monitored at 500 nm (Atto Instruments, Rockville, MD, USA). Filter change and data acquisition were controlled by Attofluor software (Atto Instruments). Average fluorescence intensities (corrected for background fluorescence) were measured in 10-s intervals in several demarcated regions of interest placed over the projected cell surface.

Na+–H+ exchange or Na+–HCO3− cotransport were assessed with the NH4+-prepulse technique. Cells were superfused with Na+-free solutions (NaCl replaced by N-methyl-d-glucamine chloride (NMDG-Cl) or 98.5 mm NMDG-Cl and 24 mm choline-HCO3). When NH4Cl (40, 20, 10, 5 mm) was added, the osmolarity of the solution was kept constant by isosmotically substituting NMDG-Cl. All NH4+-containing solutions (which were Na+-free) were supplemented with 1 mm BaCl2 and 1 μm bumetanide in order to block NH4+ transport via K+ channels and the Na+–K+–2 Cl− cotransporter, respectively. Removal of NH4Cl elicits a rapid decrease of pHi. pHi recovers when Na+ is added to the superfusate. The slope of the change of pHi after re-addition of Na+ in Hepes-buffered solution was taken as a measure of NHE activity. NBC activity was assessed either as the difference in pHi recovery in the presence and absence of CO2/HCO3− or as EIPA-independent acid flux (in the presence of CO2/HCO3−; buffer capacity taken into account).

The intracellular buffer capacity β was determined by a modification of the method described by Weintraub & Machen (1989) and Zaniboni et al. (2003). After a 3-min pulse with 40 mm NH4Cl, extracellular NH4Cl was reduced in a stepwise fashion while recording pHi. The ensuing changes in pHi and the calculated changes in the intracellular NH4+ concentration were used to determine the intracellular intrinsic (CO2/HCO3−-independent) buffering capacity β.

At the end of each experiment, pHi measurements were calibrated by superfusing MDCK-F cells or NHE-deficient MDCK-F cells with a modified Ringer solution containing (mm): KCl 125, MgCl2 1, CaCl2 1 and Hepes 20, and 10 μm nigericin (Boyarski et al. 1988). We performed either two-point (pH 7.5 and 6.5) or four-point calibrations (pH 8.0, 7.5, 6.5 and 6.0).

Migration experiments

Migration of individual MDCK-F cells was monitored with time-lapse video microscopy using either a video camera (Hamamatsu, Hersching, Germany) or a digital camera (Hamamatsu) controlled by HiPic or Simple PCI software (Hamamatsu), respectively. Images were acquired in 1-min intervals for 2.5 h. Cells were kept at 37°C in tissue culture flasks in their standard culture medium at pH 7.4 or pH 7.1 buffered either with 20 mm Hepes or with CO2/HCO3−. The circumference of cell was defined at each time step with Amira software (TGS, France; www.amiravis.com). These segmentation data were the basis for further analysis of cell migration. Quantitative data analysis was performed with JAVA programs developed by ourselves. Migration was determined as the movement of the cell centre with time (Schwab et al. 2005). We calculated the average speed of migrating cells (estimated from 1-min time intervals applying a three-point difference quotient) and their mean displacement (i.e. the distance covered within 2.5 h). Moreover, we calculated the angle at which protrusions occurred with respect to the trajectory of the cell.

Short-term migration experiments were performed to test the importance of Na+–HCO3− cotransport for compensating the effects of an acute intracellular acidosis. They were quantified from calibrated videoprints as the distance lamellipodia advanced with time (Schwab et al. 1994). During the entire course of the experiments, cells were superfused with prewarmed (37°C) Ringer solution which had the same composition as that used for pHi measurements. During these migration experiments, a 15-min control period was followed by a 10-min experimental period.

Cloning of MDCK NHE1, NBC1 and kNBC3 cDNA fragments and semiquantitative analysis of their mRNA expression

Total cellular RNA was isolated from parent and from NHE-deficient MDCK-F cells, and first strand cDNA was synthesized as previously described (Rossmann et al. 1999; Jacob et al. 2000). In order to obtain partial sequence information of canine NHE1, NBC1 and kNBC3, heterologous primers were deduced from published sequences (see Table 1). PCR fragments were subcloned (TOPO TA cloning, Invitrogene NV Leek, the Netherlands) and sequenced (SeqLab, Göttingen, Germany) in order to derive homologous primers (Table 1) for the semiquantitative PCR analysis of NHE1, NBC1 and kNBC3 mRNA levels in parental and NHE-deficient MDCK-F cells. The identity of the amplimers generated with homologous primers was confirmed by sequencing.

Table 1.

Primers used for cloning and semiquantitative PCR experiments

Primer name Primer sequence PCR product Annealing Species
Primers for cloning NBC1, NHE1 and kNBC3 cDNA fragments from MDCK cells
 NBC1-1 for CATCAAACCAAGAAATCCAACC 480 bp 50°C, 60 s Human1
 NBC1-1 rev GAACTCATCAATACCAGCAATCAG Human1
 NBC1-2 for CATCAAACCAAGAAATCCAACC 2.1 kb 50°C, 60 s Human1
 NBC1-2 rev TGGGAGAAGAGGTAGTCC Human1
 NHE1-1 for TGGCCTGCCTCATGAAGATAG 1672 bp 60°C– 46°C, 30 s Human2
 NHE1-1 rev GAGCAGCATCTGGTTCCAGG (touchdown) Human2
 kNBC3-1 for CATGGCCACCATCATGACAG 458 bp 52°C, 60 s Human3
 kNBC3-1 rev CAATTGCACTTATGCGTCCCTC Human3
Primers for semiquantitative RT-PCR
 NBC1- for TAAACCAGAGAAGGACCAG 263 bp 51°C, 60 s MDCK
 NBC1- rev CGTCAGACATCAAGGTGGC MDCK
 kNBC3-2 for GCATATAAGGCAAAAGAGCGAG 378 bp 56°C, 60 s MDCK
 kNBC3-2 rev TCCCCCAAAGGTGATGACAG MDCK
 NHE1-2 for ATCAGACGTCTTCTTCCTTTTCC 369 bp 46°C, 60 s MDCK
 NHE1-2 rev AACTCCTCAAAGAGGTGATACAGG MDCK
 Na+–K+ for ACAATCAAATCCACGAAGCC 587 bp 57°C, 60 s Dog4
 Na+–K+ rev GATGAAGCCCACAAAGCAG Dog4
 18S rRNA for Ambion (Austin, Texas) 488 bp 58°C, 60 s Universal
 18S rRNA rev Ambion (Austin, Texas) Universal
 GAPDH for CCATCACCATCTTCCAGGAG 761 bp 50°C, 60 s Alignment5
 GAPDH rev TGAGGTCCACCACCCTGTT Alignment5
 Histone 3.3 for CCACTGAACTTCTGATTCGC 215 bp 58°C, 60 s Human6
 Histone 3.3 rev GCGTGCTAGCTGGATGTCTT Human6
Open in a new tab
1

Deduced from human kidney NBC1, GB Acc. AF007216;

2

deduced from human NHE1, GB Acc. M81768;

3

deduced from human brain NBC3, GB Acc. AB018282;

4

deduced from dog Na+–K+-ATPase α-subunit, GB Acc. L42173;

5

deduced from a multiple sequence alignment of GAPDH sequences from several species: M11254, X52674, K01458, L23961, X53778, M32599 and X02231;

6

published by Futscher et al. (1993).

Semiquantitative PCR was carried out as previously described (Rossmann et al. 1999; Jacob et al. 2000) using homologous primers for NHE1, NBC1, kNBC3 and Na+–K+-ATPase α-subunit, universal primers for 18S rRNA, and heterologous primers for glyceraldehyde-3-phosphate dihydrogenase (GAPDH) and histone 3.3 (Table 1). Amplified cDNA fragments were size fractionated in an ethidium bromide-containing agarose gel. The integrated optical density (ODI) of the bands was determined with an Image Master VDS system (Amersham Pharmacia Biotech, Freiburg, Germany) and corrected according to the length of the respective PCR products. The ODI values of all PCR reactions were normalized to those of 18S rRNA. The ratio between ODI values of the gene of interest and that of 18S rRNA, which represents a virtual ratio between the respective mRNA levels, was calculated within the exponential phase of both reactions. The PCR for the gene of interest had always proceeded 10 cycles further than the control PCR (18S rRNA). Only those PCR experiments were accepted, which showed approximately parallel amplification curves for the gene of interest and 18S rRNA (see Fig. 3).

Figure 3. Semiquantitative PCR analysis of NBC1 expression in normal (A) and NHE-deficient MDCK-F cells (B).

Figure 3

Open in a new tab

Upper panels, ethidium bromide-stained agarose gels loaded with 488-bp 18S rRNA and 263-bp NBC1 amplimers obtained after various numbers of PCR cycles. Lower panels, optical density NBC1 and 18S rRNA amplimers plotted as a function of PCR cycle number. The amplification curves for NBC1 and 18S rRNA are in parallel.

Western blotting

Cells were grown to subconfluency, then washed with cold PBS and lysed at 4°C in lysis buffer containing (mm): NaCl 150, EDTA 5.0, Tris-HCl 50 (pH 7.5) and Pefabloc SC Plus 1.0 (Roche Molecular Biochemicals, Mannheim, Germany), and 0.2% (v/v) of a protease inhibitor cocktail (Sigma, P 8340). Lysates were mixed with reducing sample buffer (4: 1, v/v) containing 500 mm Tris, 100 mm dithiothreitol, 8.5% SDS, 27.5% sucrose and 0.03% bromophenol blue indicator. SDS-PAGE was performed using acrylamide gels (7.5%) and a Minigel System (Bio-Rad Laboratories, Hercules, CA, USA). Electroblotting was performed at 0.8 mA per cm2 gel for 50 min. The nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) carrying the blotted proteins were bathed in 5% (w/v) milk in 0.1% (v/v) Tween in PBS for 1 h at room temperature (20°C) and then washed with 0.1% Tween in PBS. Overnight incubation with the primary antibody (mouse anti-NHE1, clone 4E9; 1: 500; Chemicon) at 4°C was followed by a 1-h incubation with a horseradish peroxidase-conjugated secondary antibody (1: 20 000; Dianova, Hamburg) at room temperature. Blots were developed using an enhanced chemiluminescence (ECL) immunoblotting detection reagent kit (Amersham, Arlington Heights, IL, USA).

Statistics

Data are presented as mean values ± s.e.m. of cell ensembles. Paired or unpaired Student's t tests were performed where applicable. Statistical significance was assumed when P < 0.05.

Results

Isolation of NHE-deficient MDCK-F cells

We isolated a cell clone which is virtually devoid of NHE activity. As shown in Fig. 1A, pHi of parent MDCK-F cells recovers at a rate of 0.31 ± 0.005 pH units min−1 in a Na+-dependent fashion after an NH4+ prepulse. In contrast, pHi of NHE-deficient MDCK-F cells remains unchanged after the re-addition of extracellular Na+ (0.006 ± 0.002 pH units min−1). Under these conditions (Hepes-buffered Ringer solution), pHi of NHE-deficient MDCK-F cells is slightly more acidic than that of parent MDCK-F cells (pH 7.20 ± 0.025; n = 18 versus pH 7.29 ± 0.001; n = 91), which is consistent with the lack of one of the major acid extruders in NHE-deficient MDCK-F cells. Loss of NHE function is accompanied by a reduced amount of the mature NHE1 protein in NHE-deficient MDCK-F cells (see immunoblot in Fig. 1B). Thus, the term ‘NHE-deficient’ is strictly speaking not correct. However, we will use this term in order to refer to the virtual absence of NHE activity.

Figure 1. NHE1 expression and buffer capacities in MDCK-F cells.

Figure 1

Open in a new tab

A, the presence of NHE activity in NHE-deficient (NHE−, black curve) and parent MDCK-F cells (NHE+, grey curve) is tested with the NH4+-prepulse technique. After superfusing cells with Hepes-buffered Ringer solution (con), cells are alkalinized by a brief pulse of 20 mm NH4Cl (NH4+). Removal of NH4Cl in the absence of extracellular Na+ (Na+-free) elicits a marked intracellular acidosis. Intracellular pH (pHi) recovers in parent MDCK-F cells upon the re-addition of extracellular Na+ (con). Na+-dependent recovery of pHi is virtually absent in NHE-deficient MDCK-F cells, when they are superfused with Hepes-buffered Ringer solution. B, immunoblot of a crude membrane protein preparation of normal (NHE+) and NHE-deficient (NHE−) MDCK-F cells. Equal amount of proteins were loaded. The NHE1 antibody detects the mature NHE1 protein in both cell types (arrow). However, it is approximately three times more abundant in normal than in NHE-deficient MDCK-F cells. C, original recordings of intracellular pH for the determination of the intrinsic buffering capacity. NHE-deficient MDCK-F cells (NHE−; black curve); parental MDCK-F cells (NHE+; grey curve). D, buffering capacity of NHE-deficient (NHE−, black curve) and normal MDCK-F cells (NHE+, grey curve).

In order to calculate Na+-dependent H+ flux and thereby assess the NHE transport rate we determined the intrinsic (CO2/HCO3−-independent) intracellular buffer capacity (β) of both cell strains. Figure 1C shows representative original tracings of these experiments. At resting pHi, β is 9 mm per pH unit) for normal and NHE-deficient MDCK-F cells (see Fig. 1D). NHE activity in NHE-deficient MDCK-F cells was calculated to be reduced to approximately 2% of that in parent MDCK-F cells.

Na+–HCO3− cotransport mediates acid extrusion in MDCK-F cells

As shown in Fig. 1A, pHi of NHE-deficient cells does not recover following an intracellular acidification when kept in Hepes-buffered Ringer solution. However, in CO2/HCO3−-buffered Ringer solution, pHi of NHE-deficient MDCK-F cells recovers at a rate of 0.058 ± 0.006 pH units min−1 (n = 33). As shown in Fig. 2A this effect can be blocked reversibly by the stilbene DIDS (100 μm) which is an inhibitor of the Na+–HCO3− cotransporter. A similar effect is observed when Na+–HCO3− cotransport is inhibited with 50 μm of the compound S0859, an NBC inhibitor that does not influence AE2 activity (Bachmann et al. 2003).

Figure 2. NBC activity in MDCK-F cells.

Figure 2

Open in a new tab

A, the presence of NBC activity in NHE-deficient (NHE−) MDCK-F cells is tested with the NH4+-prepulse technique. Cells are superfused throughout the experiment with CO2/HCO3−- buffered Ringer solution. An intracellular acidosis is induced with a brief pulse of 20 mm NH4Cl. pHi recovers following the re-addition of Na+ (con). Na+–HCO3−-dependent pHi recovery is blocked by 100 μm DIDS (DIDS). B, the presence of NBC activity is tested in a similar way in parent MDCK-F cells (NHE+). NHE activity is blocked with 10 μm EIPA during Na+–HCO3−-dependent pHi recovery (con+EIPA). Na+–HCO3−-dependent pHi recovery is inhibited by 50 μm S0859 (S0859).

Figure 2B shows that Na+- HCO3− cotransport is also present in parent MDCK-F cells. pHi rises at a rate of 0.03 ± 0.01 pH units min−1 (n = 19) in the presence of HCO3− when the Na+–H+ exchanger is inhibited with 10 μm EIPA. This effect can be blocked with the compound S0859 (50 μm). The parallel operation of Na+–H+ exchange and Na+–HCO3− cotransport in parent MDCK-F cells is also reflected by the effect of the simultaneous inhibition of both transporters with 10 μm EIPA and 25 μm DIDS on steady-state pHi. pHi falls by 0.20 ± 0.02 pH units (n = 18; data not shown) when both transporters are inhibited, while pHi decreases by 0.13 ± 0.04 pH units (n = 4) when only EIPA is added to CO2/HCO3−-buffered Ringer solution. Calculation of the transport rate of the Na+–HCO3− cotransporter in both cell strains (ΔpHNBC/Δt×β (where ΔpHNBC/Δt is NBC mediated pHi recovery as a function of time)) reveals that it is approximately two times higher in NHE-deficient than in parent MDCK-F cells (2.0 ± 0.18 and 1.07 ± 0.38 mm min−1 at pHi 7.06 ± 0.01 and pHi 7.1 ± 0.02, respectively.

Expression of NBC1, kNBC3 and NHE1 in MDCK-F cells

We cloned cDNA fragments of the Na+– HCO3− cotransporter isoforms NBC1 (SLC4A4; GenBank AF311209 and AF311210) and kNBC3 (SLC4A8; GenBank AF311211), and of the Na+–H+ exchanger isoform NHE1 (GenBank AF311207 and AF311208) from MDCK-F cells. These canine amplimers are approximately 93% homologous to their human counterparts. These experiments show that MDCK-F cells express at least two isoforms of the Na+– HCO3− cotransporter. In order to determine which of them is likely to be responsible for increased Na+– HCO3− cotransport activity observed in the NHE-deficient MDCK-F cells, we compared their mRNA levels in parent cells and in the two cell strains by means of semiquantitative PCR. Figure 3 shows a representative example of these experiments. First, we tested the expression of ‘house-keeping genes’ such as GAPDH or histone 3.3a. GAPDH mRNA levels for GAPDH are slightly, and for histone 3.3a markedly lower in NHE-deficient compared to parent MDCK-F cells when normalized to 18S rRNA (Table 2). This possibly reflects the smaller size and lower proliferative activity of NHE-deficient MDCK-F cells. Likewise, the mRNA levels for Na+–K+-ATPase, kNBC3 and NHE1 are also much lower in NHE-deficient cells. This is paralleled by a lower protein expression of the NHE1 (see Fig. 1B) and of the Na+–K+-ATPase (α-subunit; data not shown) in NHE-deficient MDCK-F cells. In contrast, NBC1 mRNA levels are slightly increased in NHE-deficient MDCK-F cells. Thus, the relative abundance of NBC1 mRNA with respect to that of the Na+–K+-ATPase is four times higher in NHE-deficient than in parent MDCK-F cells. The mRNA ratios kNBC3/Na+–K+-ATPase and NHE1/Na+–K+-ATPase are not different in parent and NHE-deficient MDCK-F cells.

Table 2.

Summary of semiquantitative PCR experiments

MDCK-F, control MDCK-F, NHE− ratio NHE−/control
NBC1/18S rRNA 0.24 ± 0.06 0.27 ± 0,02 1.12
kNBC3/18S rRNA 0.01 ± 0.002 0.003 ± 0.001 0.33
NHE1/18S rRNA 0.044 ± 0.013 0.013 ± 0.004 0.3
Na+–K+-ATPase/18S rRNA 1.29 ± 0.37 0.34 ± 0.06 0.26
GAPDH/18S rRNA 1.1 ± 0.23 0.82 ± 012 0.75
histone 3.3a/18S rRNA 7.08 ± 2.61 0.77 ± 0.0 0.11
Open in a new tab

Migration of NHE-deficient MDCK-F cells

Long-term experiments

In order to assess the role of NBC activity in migration of parent and NHE-deficient MDCK-F cells, we compared their migratory behaviour (speed and displacement) in the presence and absence of HCO3−. Cells were kept at pH 7.4 or at pH 7.1. We chose the acidic pH in order to disclose more clearly a possible role of NBC activity (which is an important mechanism for acid extrusion in NHE-deficient MDCK-F cells) in cell migration. Na+–HCO3− cotansporters are known to be up-regulated during acidosis (Amlal et al. 1999). Figure 4 displays two examples of migrating parent and NHE-deficient MDCK-F cells. The comparison of the trajectories shows that NHE-deficient MDCK-F cells make more frequent turns than parent MDCK-F cells. The results of these migration experiments are summarized in Figs 5 and 6. The mean speed (Fig. 5) of MDCK-F cells is independent of the presence or absence of HCO3− (0.79 ± 0.03 or 0.85 ± 0.05 μm min−1 at pH 7.1, respectively). The values are 0.94 ± 0.05 μm min−1 (with HCO3−) and 0.83 ± 0.04 μm min−1 (without HCO3−) at pH 7.4. Similarly, there is also no effect of HCO3− or pH on the displacement of parent MDCK-F cells (see Table 3). In contrast, NHE-deficient MDCK-F cells migrate faster in the presence of HCO3− (0.76 ± 0.04 versus 0.64 ± 0.04 μm min−1 at pH 7.1, and 0.83 ± 0.04 versus 0.68 ± 0.04 μm min−1 at pH 7.4). Figure 6 compares the trajectories and mean displacements of parent MDCK-F cells with those of NHE-deficient MDCK-F cells. NHE-deficiency leads to a significant reduction of the displacement at each time point investigated. NHE-blockade with 10 μm Hoe642 results in the same reduction of the displacement of wild-type MDCK-F cells (69.0 ± 7.2 with HCO3− and 70.0 ± 5.7 μm without HCO3− at t= 150 min). The presence of HCO3− and the change from pH 7.4 to 7.1 have no effect on the displacement of both cell strains when assessed at t= 90 min and t= 150 min. However, on a shorter timescale (i.e. at t= 30 min), NHE-deficient MDCK-F cells migrate significantly further in the presence of HCO3− than in its absence (22.0 ± 1.3 versus 15.3 ± 1.2 μm at pH 7.4; 19.0 ± 1.3 versus 14.3 ± 1.4 μm at pH 7.1). The NBC inhibitor S0859 (20 μm) also reduces the displacement of NHE-deficient MDCK-F cells on a short timescale (t= 30 min) (14.0 ± 1.5 versus 21.0 ± 0.9 μm under control conditions; n = 28). At later time points this blocker has no effect on the displacement. S0859 has no significant effect on migration of parent MDCK-F cells at t= 30 min either (18.4 ± 1.6 versus 22.7 ± 2.7 μm under control conditions; n = 14).

Figure 4. Time lapse series of a migrating parent MDCK-F cell (NHE+; A) and a migrating NHE-deficient MDCK-F cell (NHE−; B) incubated in CO2/HCO3−-buffered medium (pH 7.4).

Figure 4

Open in a new tab

The trajectories of the two cells are shown. The cross indicates the starting position of the cell centre, and the arrow heads mark the current position. Comparison of the two cells reveals that the parent MDCK-F cell maintains its direction of migration fairly well while the NHE-deficient MDCK-F cell makes sharp turns more frequently.

Figure 5. Comparison of the migratory speed of parent MDCK-F cells (NHE+) and NHE-deficient MDCK-F cells (NHE−) under different conditions.

Figure 5

Open in a new tab

Speed was calculated from the displacement of the cell centre in 1-min time intervals applying a three-point difference quotient. The speed of NHE-deficient MDCK-F cells is significantly faster in the presence of HCO3−.

Figure 6. Displacement of parent MDCK-F cells (NHE+) and NHE-deficient MDCK-F cells (NHE−) in CO2/HCO3−- or Hepes-buffered medium (pH 7.4).

Figure 6

Open in a new tab

The left and middle panels show the original trajectories covered within 150 min. The inner circles surrounding the grey shaded areas correspond to the mean displacements for 30 min and the outer circles indicate the mean displacements for 150 min. The right panels provide a summary of these analyses. The grey shaded parts of the bars correspond to the grey shaded circles in the left and middle panels. It is noteworthy that NHE-blockade with 10 μm Hoe642 leads to the same reduction of the displacement as NHE-deficiency.

Table 3.

Displacement of parent MDCK-F cells (NHE+) and NHE-deficient MDCK-F cells (NHE−) in different time intervals

30 min 60 min 90 min
MDCK-F, NHE+ (pH 7.4)
 Hepes (n = 27) 23.1 ± 1.8 58.0 ± 3.7 91.0 ± 5.8
 CO2/HCO3− (n = 28) 27.1 ± 2.3 62.1 ± 4.5 96.0 ± 6.5
MDCK-F, NHE+ (pH 7.1)
 Hepes (n = 33) 27.2 ± 1.8 58.9 ± 3.9 78.9 ± 5.6
 CO2/HCO3− (n = 27) 24.8 ± 2.4 63.0 ± 4.1 96.9 ± 5.6
MDCK-F, NHE+, Hoe642 (pH 7.4)
 Hepes (n = 33) 22.4 ± 2.2 49.8 ± 4.4 70.0 ± 5.7
 CO2/HCO3− (n = 34) 20.5 ± 1.7 49.4 ± 5.0 69.0 ± 7.2
MDCK-F, NHE− (pH 7.4)
 Hepes (n = 31) 15.3 ± 1.2 40.6 ± 5.3 59.4 ± 5.3
 CO2/HCO3− (n = 42) 22.0 ± 1.3 * 47.9 ± 3.0 67.2 ± 4.6
MDCK-F, NHE− (pH 7.1)
 Hepes (n = 35) 14.3 ± 1.4 36.9 ± 3.6 53.6 ± 5.4
 CO2/HCO3− (n = 49) 19.0 ± 1.3 * 43.7 ± 2.7 60.4 ± 5.4
Open in a new tab
*

Statistically significant differences (P < 0.05) between migration in Hepes- or CO2/HCO3−-buffered medium. The distances (in μm) covered within the indicated time intervals are listed.

In addition, we determined the angles at which cell protrusions occur with respect to the cell's trajectory. The angles centre around 0 deg when the cells are highly polarized and have only one leading lamellipodium. Angles of around ± 180 deg indicate that the cells reverse their direction of migration so that protrusions occur at the rear part. The normalized histograms for parent MDCK-F cells treated with 10 μm Hoe642, and NHE-deficient MDCK-F cells kept at pH 7.4 are shown in Fig. 7. There are only subtle differences in the shape of the histograms. This analysis is summarized in Fig. 7B. Here we plotted the protrusive activity occurring in the forward direction (angles smaller than ± 90 deg) and rearward direction (angles greater than ± 90 deg) and compared the effect of the presence or absence of HCO3− on the directionality of potrusive activity. This figure shows that NHE blockade results in the same distribution of protrusive activity in parent MDCK-F cells as in NHE-deficient MDCK-F cells. Moreover, the presence of HCO3− (at pH 7.4) and thereby NBC activity has no effect on the directionality of protrusive activity and thereby on the polarization of NHE-deficient and Hoe642-treated parent MDCK-F cells. The polarization of NHE-deficient MDCK-F cells is slightly improved in the presence of HCO3− at pH 7.1 (69.5%‘forward’ activity with HCO3−versus 66.4% in its absence).

Figure 7. Directionality of protrusive activity of migrating MDCK-F cells.

Figure 7

Open in a new tab

A, normalized histogram of the angles at which protrusions occur with respect to the trajectory of NHE-deficient MDCK-F cells (grey triangles) and parent MDCK-F cells treated with 10 μm Hoe642 (continous black line) kept in Hepes-buffered medium at pH 7.4. The peak around 0 deg represents the protrusive activity of the leading lamellipodia. The ‘shoulders’ at around ± 180° indicate that protrusions also occur at the rear part of the cells. B, binning of the histograms into forward direction (angles smaller than ± 90 deg) and rearward direction (angles greater than ± 90 deg). This figure compares the effect of the presence or absence of CO2/HCO3− on the directionality of protrusive activity of parent MDCK-F cells treated with 10 μm (NHE+/Hoe) and NHE-deficient MDCK-F cells (NHE−) at pH 7.4. Both cell types behave alike, and HCO3− has virtually no effect on the directionality of protrusions.

Short-term experiments

Our pH measurements showed that NBC activity mediates the rapid pHi recovery when the cells are acidified by an NH4+-prepulse (see Fig. 2). Next we tested the effect of an acute acid load on cell migration. First, we superfused NHE-deficient MDCK-F cells with Hepes-buffered Ringer solution. Under these conditions, the Na+– HCO3− cotransporter is not functional. We ‘turned’ the transporter on by switching to a solution buffered with CO2/HCO3−. Figure 8 shows that migration is not impaired although the sudden influx of CO2 causes a massive intracellular acidosis. Cells are even accelerated slightly (111.5 ± 15.9% of Hepes-buffered control; n = 33). When Na+–HCO3− cotransport is inhibited during this manoeuvre with 50 μm DIDS, the rate of migration is reduced to 52.9 ± 9.3% of control with Hepes-buffered Ringer solution (n = 17). Concomitantly, pHi recovery is also inhibited. These findings are consistent with the notion that NBC activity can overcome the negative effects that intracellular acidification has on cell migration. Nevertheless, we cannot dismiss the possibility that DIDS inhibits migration non-specifically.

Figure 8. The effects of an accute CO2-induced intracellular acidosis on pHi and migration.

Figure 8

Open in a new tab

A, switching from Hepes- to CO2/HCO3−-buffered Ringer solution rapidly acidifies the cytosol. Recovery of pHi which is mediated by Na+–HCO3− cotransport is partially inhibited by 50 μm DIDS. B, the same manoeuvre is performed in short-term migration experiments (15 min control, 10 min experimental period). We plotted changes of the speed of migration following the switch from a Hepes- to a CO2/HCO3−-buffered Ringer solution in the absence and presence of 50 μm DIDS. Migration is not inhibited by the intracellular acidosis as long as the Na+–HCO3− cotransporter is active. *Statistically different from the control condition with Hepes buffered Ringer solution which is set to 100%.

An acute effect of NBC inhibition on migration can also be seen in parent MDCK-F cells kept in CO2/HCO3−-buffered Ringer solution. The combined application of 10 μm EIPA and 25 μm DIDS acutely leads to an almost complete inhibition of migration (26.6 ± 11.9% of control; n = 10, data not shown). In contrast, EIPA or DIDS alone (in CO2/HCO3−-buffered Ringer solution) reduce the rate of migration to only 48 or 49% of control, respectively (Klein et al. 2000).

Collectively, the results of our migration experiments indicate that NBC activity plays a role in migration of MDCK-F cells only on a short timescale and that it does not fully compensate for the NHE function in migrating NHE-deficient cells.

Cell volume measurements

We proposed that NHE activity supports migration by mediating isosmotic regulatory volume increase at the cell front (Klein et al. 2000). We tested whether NBC activation following an intracellular acid load can also induce an isosmotic volume increase in parent and NHE-deficient MDCK-F cells (see Fig. 9). When NHE-deficient MDCK-F cells are incubated in a modified, Hepes-buffered Ringer solution containing 140 mm sodium propionate, cell volume remains constant (100.8 ± 0.5% of control; n = 6). Parent MDCK-F cells respond to this treatment with an increase of their volume within 5 min by 8.4 ± 1.0% (Klein et al. 2000). However, when NHE-deficient MDCK-F cells are exposed to sodium propionate in a CO2/HCO3−-buffered Ringer solution their volume increases by 2.0 ± 0.5% (n = 10). This effect does not occur when the NBC-blocker S0859 (50 μm) is applied simultaneously (100.4 ± 0.4% of control; n = 11).

Figure 9. Summary of cell volume measurements.

Figure 9

Open in a new tab

NHE-deficient and parent MDCK-F cells were exposed to 140 mm sodium propionate in the absence and presence of the NBC inhibitor S0859 (50 μm). Cells were incubated in CO2/HCO3−- (A) or Hepes-buffered Ringer solution (B). Exposure to sodium propionate causes cell swelling of NHE-deficient MDCK-F cells only when they are incubated in CO2/HCO3−-buffered Ringer solution. Cell swelling is inhibited by the NBC1 blocker S0859. Parent MDCK-F cells also swell in Hepes-buffered Ringer solution. (Data for MDCK-F cells in B are taken from Klein et al. (2000)). *Significantly different (P < 0.05) from the respective control period.

Discussion

Our study indicates that Na+–HCO3− cotransport is not as important for cell migration as the Na+–H+ exchanger NHE1. It can only partially subsitute for the function of NHE1 in NHE-deficient MDCK-F cells. It compensates for NHE1 in pHi and volume regulation relatively well. Its function improves; however, it does not abrogate the disturbed migratory activity of NHE-deficient MDCK-F cells. Previously, we had isolated a strain of MDCK cells with a constant migratory phenotype (MDCK–F; Oberleithner et al. 1991, Schwab et al. 1994). Here we have isolated a subclone from the MDCK-F cells with virtually no NHE activity and observed that these cells use a Na+- and HCO3−-dependent base import mechanism to recover from an acid load, which we characterized functionally as a Na+–HCO3− cotransport. Our semiquantitative RT-PCR experiments suggest that this Na+–HCO3− cotransport is mediated by the SLC4A4 gene product (NBC1) rather than by a Na+-dependent Cl−–HCO3− exchange (SLC4A8 gene product kNBC3 or NDBCE) whose mRNA levels were much lower in both cell strains. However, we cannot dismiss the possibility that other isoforms of the SLC family, whose expression we did not test, also contribute to the observed effects.

Our next question was whether the NHE-deficient MDCK-F cells selectively up-regulate NBC transport on a molecular and functional level. To this end we cloned canine NBC1 and kNBC3 cDNA fragments from these cells and quantified their mRNA expression levels as well as those of a number of other ion transporter genes. NHE-deficient MDCK-F cells differ morphologically from the parent cell line, have a lower growth rate, and reduced expression levels of a number of ‘housekeeping’ genes such as histone 3.3a and Na+–K+-ATPase. The mRNA level of GAPDH is quite similar in both cell strains when normalized to 18S rRNA. Presently, we do not know whether these multiple effects on gene expression are a consequence of the non-specific chemical mutagenesis or whether they reflect adaptive mechanisms in response to the lack of NHE function. Nonetheless, it is noteworthy that NBC1 mRNA is selectively exempt from the relative down-regulation of mRNA from all transport proteins tested in NHE-deficient MDCK-F cells. Thus, the ratio of NBC1/Na+–K+-ATPase mRNA is four times higher in NHE-deficient than in parent MDCK-F cells. This is parallelled by increased NBC function. NBC activity was assessed as the initial speed of Na+- and HCO3−-dependent base import rate after an acid load. In contrast to mutagenized and acid-stressed mouse inner medullary collecting duct cells (Amlal et al. 1999), kNBC3 is not up-regulated in NHE-deficient MDCK-F cells. The fact that NHE1 expression levels (mRNA and protein) are reduced to a similar extent to those for Na+–K+-ATPase or kNBC3 while NHE function is virtually absent in NHE-deficient cells, suggests that we had generated a lack of function mutation. The lack of function could be due to a ‘dead’ NHE1 protein or due to a mutation that precludes its correct insertion into the plasma membrane. The immunoblot in Fig. 1B shows a strong band of approximately 75 kDa which is of much lower intensity in normal MDCK-F cells. However, so far we do not know whether this band represents an immature and/or truncated NHE1 protein or whether it is a completely unrelated protein found in NHE-deficient cells. Further biochemical studies are needed to elucidate the exact molecular mechanisms underlying the lack of NHE activity in NHE-deficient MDCK-F cells.

Furthermore, our experiments show that NBC activity can mediate an isosmotic volume increase in NHE-deficient MDCK-F cells. Sodium proprionate induces cell swelling in the parent cell line but not in NHE-deficient MDCK-F cells when they are kept in Hepes-buffered Ringer solution. In CO2/HCO3−-buffered Ringer solution, we observed an S0859-sensitive volume increase in NHE-deficient cells, clearly demonstrating that Na+–HCO3− cotransport also plays a role in cell volume regulation.

Given these parallels between NBC and NHE1 function in migrating MDCK-F cells, it was surprising that NBC activity has only a subtle effect on migration of NHE-deficient MDCK-F cells. The displacement of migrating cells, when observed for a longer time period (e.g. > 1 h), critically depends on their ability to migrate in one direction without making sharp turns. This also applies to our experiments where no chemotactic gradient was present. NHE-deficiency decreases the ability to move in one direction which becomes evident when comparing speed and displacement of parent and NHE-deficient MDCK-F cells. Displacement of NHE-deficient MDCK-F cells is reduced to a greater extent than speed, indicating that these cells not only migrate more slowly but also make more turns when compared with parent MDCK-F cells. This is also reflected by the fact that protrusions frequently occur at the rear part in NHE-deficient MDCK-F cells. Inhibition of NHE activity in parent MCK-F cells mimicks the migratory phenotype of NHE-deficient MDCK-F cells to a large extent. NHE blockade also leads to a reduced displacement and the histograms of protrusive activities of NHE-deficient and Hoe642-treated parent MDCK-F cells are very similar. This supports the conclusion that the characteristic migratory phenotype of NHE-deficient MDCK-F cells is due to the lack of NHE activity. NHE-deficient fibroblasts behave similarly in a wound assay. They have a defect in maintaining a given direction when they are transfected with a mutated, non-functional NHE1. This impairment is absent when they contain a wild-type NHE1 (Denker & Barber, 2002). Thus, one effect of NHE1 activity is to control the polarization of migrating cells within the plane of movement. Our results indicate that NBCs, presumably NBC1, do not have the ability to exert such an influence on the directionality of MDCK-F cell migration. Despite increase in NBC activity, and despite the effects of NBC on short-term migratory speed, the disturbance of long-term migratory behaviour of MDCK-F cells is not compensated for. It was shown in fibroblasts that a defect in the cytoskeletal anchoring of NHE1 leads to the appearance of several lamellipodia which protrude in different directions and are involved in a sort of ‘tug of war’ (Denker & Barber 2002). NHE-deficient MDCK-F cells behave alike. The fact that enhanced expression and activity of NBC1 in NHE-deficient MDCK-F cells does not promote the generation of one leading lamellipodium and normalization of cellular polarity points to the special quality of the cytoskeletal anchoring of NHE1 which is not mimicked by NBC1.

This does not exclude the possibility that NBC1 is linked to the cytoskeleton and influences cytoskeletal dynamics in migrating cells. NBC activity does affect migration when assessed on a short timescale. Increased NBC1 activity in NHE-deficient MDCK-F cells increases their speed which was measured in 1-min intervals. In slowly migrating cells, such as MDCK-F cells, variations of the migratory speed reflect alterations of cytoskeletal dynamics rather than global changes of cell polarity and directionality. The Na+–HCO3− cotransporter NBC1 is localized in the basolateral membrane of epithelial cells. Therefore, it is likely that NBC1 is concentrated at the leading edge of the lamellipodium (Peränen et al. 1996; Schwab, 2001); that is, at a similar localization as NHE1 or the anion exchanger AE2 (Grinstein et al. 1993; Klein et al. 2000; Denker et al. 2000). In such a scenario, NBC1 could support migration in a similar way to NHE1 and AE2. These transporters influence cell migration via a local effect on cell volume (Klein et al. 2000). By analogy, we suggest that the short-term effect of NBC1 activity on migration is also mediated by local solute and osmotically obliged water uptake at the leading edge of the lamellipodium. This assumption is supported by the following observations. Migration is not impaired when cells are acutely acidified by changing from Hepes- to CO2/HCO3−-buffered Ringer solution as long as the Na+–HCO3− cotransporter is active. This manoeuvre inhibits migration only when it is performed in the presence of DIDS, a blocker of Na+–HCO3− cotransport. We are aware that DIDS may bind non-specifically to other proteins and also inhibits the Cl−–HCO3− exchanger. However, this exchanger is not active during an intracellular acidification (Alper et al. 2001). Moreover, a more specific NBC1 blocker, S0859, also reduces the speed of NHE-deficient MDCK-F cells. We therefore interpret the effect of DIDS in the present migration experiments as being consistent with the inhibition of Na+–HCO3− cotransport. Moreover, we observed in some experiments with NHE-deficient MDCK-F cells that the change from Hepes- to CO2/HCO3−-buffered Ringer solution results in local cell swelling at the front of the lamellipodium (data not shown). This concept is supported by the recent finding that aquaporins (AQP1), which are concentrated at the leading edge of the lamellipodium, increase the protrusive activity of lamellipodia (Saadoun et al. 2005).

In the renal proximal tubule, the basolateral Na+–HCO3− cotransporter activity is regulated by the Na+–H+ exchange regulatory factor (NHE-RF; Bernardo et al. 1999) which is also concentrated at the leading edge of the lamellipodium (Murthy et al. 1998). NHE-RF binds to members of the ERM family of membrane–cytoskeletal linking proteins, some of which are also concentrated at the leading edge of the lamellipodium (Murthy et al. 1998). It is conceivable that a physical interaction between NBC1 and NHE-RF could provide a link to the cytoskeleton and contribute to its short-term effect on migration.

In summary, we have now identified another acid–base transport protein – Na+–HCO3− cotransport – which is, under certain circumstances, required for optimal cell migration and which can render cell migration, to some extent, independent of pHi. This may be of particular physiological relevance for cells migrating in an acidotic environment, for instance leucocytes or tumour cells. In addition, this may also be relevant for epithelial restitution of the gastroduodenal mucosa whose apical surface is exposed to an acid milieu. When the epithelium is damaged, efficient restitution of the epithelium requires the presence of HCO3− (Svanes et al. 1983; Feil et al. 1989) and thereby the activity of the Na+–HCO3− cotransporter which is expressed in the gastroduodenal mucosa (Rossmann et al. 1999; Jacob et al. 2000). Although the role of Na+–HCO3− cotransport in cell migration during epithelial restitution was not directly tested in these studies, they provide indirect evidence for its involvement. It is possible that NBC activity also plays a role in migration of vascular smooth muscle cells that express the electroneutral Na+–HCO3− cotransporter (Boron, 2001). Migration of NHE-deficient vascular smooth muscle cells is inhibited by an extracellular acidosis in the absence of HCO3−. However, this effect is completely reversed in the presence of HCO3− (Mitsuka et al. 1993), suggesting a potential involvement of NBC in migration of these cells as well. The generation of NBC isoform-deficient mice will hopefully allow further elucidation of the role of NBCs in would healing, organogenesis and tumour formation, and their suitability as potential drug targets for the modulation of these function in various disease states.

Acknowledgments

The expert technical assistance of Sabine Mally is gratefully acknowledged. This work was supported by Deutsche Forschungsgemeinschaft grants Schw 407/9-1 and -2 (to A.S.), and Se 460/13-1 and 9-4 (to U.S.) and by the Fritz-Bender-Stiftung (to A.S.).

References

  1. Alper SL, Chernova MN, Stewart AK. Regulation of Na+-independent Cl−/HCO3− exchangers by pH. JOP. 2001;2(4 Suppl.):171–175. [PubMed] [Google Scholar]
  2. Amlal H, Burnham CE, Soleimani M. Characterization of Na+/HCO3− cotransporter isoform NBC-3. Am J Physiol Renal Physiol. 1999;276:F903–F913. doi: 10.1152/ajprenal.1999.276.6.F903. [DOI] [PubMed] [Google Scholar]
  3. Bachmann O, Rossmann H, Berger UV, Colledge WH, Ratcliff R, Evans MJ, Gregor M, Seidler U. cAMP-mediated regulation of murine intestinal/pancreatic Na+/HCO3− cotransporter subtype pNBC1. Am J Physiol Gastrointest Liver Physiol. 2003;284:G37–G45. doi: 10.1152/ajpgi.00209.2002. [DOI] [PubMed] [Google Scholar]
  4. Bernardo AA, Kear FT, Santos AVP, Ma J, Steplock D, Robey RB, Weinman EJ. Basolateral Na+/HCO3− cotransport activity is regulated by the dissociable Na+/H+ exchanger regulatory factor. J Clin Invest. 1999;104:195–201. doi: 10.1172/JCI5344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bevensee MO, Weed RA, Boron WF. Intracellular pH regulation in cultured astrocytes from rat hippocampus. I. Role of HCO3−. J Gen Physiol. 1997;110:453–465. doi: 10.1085/jgp.110.4.453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boron WF. Sodium-coupled bicarbonate transporters. JOP. 2001;2(4 Suppl.):176–181. [PubMed] [Google Scholar]
  7. Boyarski G, Ganz MB, Sterzel RB, Boron WF. pH regulation in single glomerular mesangial cells. I. Acid extrusion in absence and presence of HCO3−. Am J Physiol Cell Physiol. 1988;255:C844–C856. doi: 10.1152/ajpcell.1988.255.6.C844. [DOI] [PubMed] [Google Scholar]
  8. Counillon L, Pouyssegur J. The expanding family of eucaryotic Na+/H+ exchangers. J Biol Chem. 2000;275:1–4. doi: 10.1074/jbc.275.1.1. [DOI] [PubMed] [Google Scholar]
  9. Denker SP, Barber DL. Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1. J Cell Biol. 2002;159:1087–1096. doi: 10.1083/jcb.200208050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Denker SP, Huang DC, Orlowski J, Furthmayr H, Barber DL. Direct binding of the Na-H exchanger NHE1 to ERM proteins regulates the cortical cytoskeleton and cell shape independently of H+ translocation. Mol Cell. 2000;6:1425–1436. doi: 10.1016/s1097-2765(00)00139-8. [DOI] [PubMed] [Google Scholar]
  11. Dieterich P, Dreval V, Schwab A. Comprehensive analysis of single cell migration. Pflugers Arch. 2003;445(Suppl.):S44. [Google Scholar]
  12. Feil W, Klimesch S, Karner P, Wenzl E, Starlinger M, Lacy ER, Schiessel R. Importance of an alkaline microenvironment for rapid restitution of the rabbit duodenal mucosa in vitro. Gastroenterology. 1989;97:112–122. doi: 10.1016/0016-5085(89)91423-6. [DOI] [PubMed] [Google Scholar]
  13. Futscher BW, Blake LL, Gerlach HJ, Grogan TM, Dalton WS. Quantitative polymerase chain reaction analysis of mdr1 mRNA in multiple myeloma cell lines and clinical specimens. Anal Biochem. 1993;213:414–421. doi: 10.1006/abio.1993.1440. [DOI] [PubMed] [Google Scholar]
  14. Grinstein S, Goetz JD, Furuya W, Rothstein A, Gelfand EW. Amiloride-sensitive Na+-H+ exchange in platelets and leukocytes: detection by electronic cell sizing. Am J Physiol. 1984;247:C293–C298. doi: 10.1152/ajpcell.1984.247.3.C293. [DOI] [PubMed] [Google Scholar]
  15. Grinstein S, Woodside M, Waddell TK, Downey GP, Orlowski J, Pouysségur J, Wong DCP, Foskett JK. Focal localization of the NHE-1 isoform of the Na+/H+ antiport: assessment of effects on intracellular pH. EMBO J. 1993;12:5209–5218. doi: 10.1002/j.1460-2075.1993.tb06216.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hagen SJ, Morrison SW, Law CS, Yang DX. Restitution of the bullfrog gastric mucosa is dependent on a DIDS-inhibitable pathway not related to HCO3− ion transport. Am J Physiol Gastrointest Liver Physiol. 2004;286:G596–G605. doi: 10.1152/ajpgi.00390.2002. [DOI] [PubMed] [Google Scholar]
  17. Jacob P, Christiani S, Rossmann H, Lamprecht G, Vieillard-Baron D, Müller R, Gregor M, Seidler U. Role of Na+-HCO3− cotransporter NBC1, Na+/H+ exchanger NHE1, and carbonic anhydrase in rabbit duodenal bicarbonate secretion. Gastroenterology. 2000;119:406–419. doi: 10.1053/gast.2000.9358. [DOI] [PubMed] [Google Scholar]
  18. Klein M, Seeger P, Schuricht B, Alper SL, Schwab A. Polarization of Na+/H+ and Cl−/HCO3− exchangers in migrating renal epithelial cells. J Gen Physiol. 2000;115:599–607. doi: 10.1085/jgp.115.5.599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lagana A, Vadnais J, Le PU, Nguyen TN, Laprade R, Nabi IR, Noel J. Regulation of the formation of tumor cell pseudopodia by the Na+/H+ exchanger NHE1. J Cell Sci. 2000;113:3649–3662. doi: 10.1242/jcs.113.20.3649. [DOI] [PubMed] [Google Scholar]
  20. Lauffenburger DA, Horwitz AF. Cell migration: a physically integrated molecular process. Cell. 1996;84:359–369. doi: 10.1016/s0092-8674(00)81280-5. [DOI] [PubMed] [Google Scholar]
  21. Mitchison TJ, Cramer LP. Actin-based cell motility and cell locomotion. Cell. 1996;84:371–379. doi: 10.1016/s0092-8674(00)81281-7. [DOI] [PubMed] [Google Scholar]
  22. Mitsuka M, Nagae M, Berk BC. Na+-H+ exchange inhibitors decrease neointimal formation after rat carotid injury. Effects on smooth muscle cell migration and proliferation. Circ Res. 1993;73:269–275. doi: 10.1161/01.res.73.2.269. [DOI] [PubMed] [Google Scholar]
  23. Murthy A, Gonzalez-Agosti C, Cordero E, Pinney D, Candia C, Solomon F, Gusella F, Ramesh V. NHE-RF, a regulatory cofactor for Na+-H+ exchange, is a common interactor for merlin and ERM (MERM) proteins. J Biol Chem. 1998;273:1273–1276. doi: 10.1074/jbc.273.3.1273. [DOI] [PubMed] [Google Scholar]
  24. Oberleithner H, Westphale H-J, Gaßner B. Alkaline stress transforms Madin-Darby canine kidney cells. Pflugers Arch. 1991;419:418–420. doi: 10.1007/BF00371126. [DOI] [PubMed] [Google Scholar]
  25. Peränen J, Auvinen P, Virta H, Wepf R, Simons K. Rab8 promotes polarized transport through reorganization of actin and microtubules in fibroblasts. J Cell Biol. 1996;135:153–167. doi: 10.1083/jcb.135.1.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pouysségur J, Sardet C, Franchi A, L'Allemain G, Paris S. A specific mutation abolishing Na+/H+ antiport activity in hamster fibroblasts precludes growth at neutral and acidic pH. Proc Natl Acad Sci U S A. 1984;81:4833–4837. doi: 10.1073/pnas.81.15.4833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ritter M, Schratzberger P, Rossmann H, Wöll E, Seiler K, Seidler U, Reinisch U, Kahler CM, Zwierzina H, Lang H-J, Lang F, Wiedermann CJ. Effect of inhibitors of Na+/H+-exchange and gastric H+/K+ ATPase on cell volume, intracellular pH and migration of human polymorphonuclear leucocytes. Br J Pharmacol. 1998;124:627–638. doi: 10.1038/sj.bjp.0701864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Romero MF, Fulton CM, Boron WF. The SLC family of HCO3− transporters. Pflugers Arch. 2004;447:495–509. doi: 10.1007/s00424-003-1180-2. [DOI] [PubMed] [Google Scholar]
  29. Rosengren S, Henson PM, Worthen GS. Migration-associated volume changes in neutrophils facilitate the migratory process in vitro. Am J Physiol. 1994;267:C1623–C1632. doi: 10.1152/ajpcell.1994.267.6.C1623. [DOI] [PubMed] [Google Scholar]
  30. Rossmann H, Bachmann D, Vieillard-Baron D, Gregor M, Seidler U. Na+/HCO3− cotransport and expression of NBC1 and NBC2 in rabbit gastric parietal and mucous cells. Gastroenterology. 1999;116:1389–1398. doi: 10.1016/s0016-5085(99)70503-2. [DOI] [PubMed] [Google Scholar]
  31. Saadoun S, Papadopoulos MC, Hara-Chikuma M, Verkman AS. Impairment of angiogenesis and cell migration by targeted aquaporin-1 gene disruption. Nature. 2005;434:786–792. doi: 10.1038/nature03460. [DOI] [PubMed] [Google Scholar]
  32. Schmitt BM, Biemesderfer D, Romero MF, Boulpeap EL, Boron WF. Immunolocalization of the electrogenic Na+-HCO3− cotransporter in mammalian and amphibian kidney. Am J Physiol. 1999;276:F27–F36. doi: 10.1152/ajprenal.1999.276.1.F27. [DOI] [PubMed] [Google Scholar]
  33. Schwab A. Function and spatial distribution of ion channels and transporters in cell migration. Am J Physiol Renal Physiol. 2001;280:F739–F747. doi: 10.1152/ajprenal.2001.280.5.F739. [DOI] [PubMed] [Google Scholar]
  34. Schwab A, Wojnowski L, Gabriel K, Oberleithner H. Oscillating activity of a Ca2+-sensitive K+ channel. A prerequisite for migration of transformed Madin-Darby canine kidney focus cells. J Clin Invest. 1994;93:1631–1636. doi: 10.1172/JCI117144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Schwab A, Wulf A, Schulz C, Kessler W, Nechyporuk-Zloy V, Römer M, Reinhardt J, Weinhold D, Dieterich P, Stock C, Hebert SC. Subcellular distribution of Ca2+ sensitive K+ channels in migrating cells in press. J Cell Physiol. 2005 doi: 10.1002/jcp.20434. (in press) [DOI] [PubMed] [Google Scholar]
  36. Simchowitz L, Cragoe EJ. Regulation of human neutrophil chemotaxis by intracellular pH. J Biol Chem. 1986;261:6492–6500. [PubMed] [Google Scholar]
  37. Soleimani M, Burnham CE. Physiologic and molecular aspects of the Na+-HCO3− cotransporter in health and disease processes. Kidney Int. 2000;57:371–384. doi: 10.1046/j.1523-1755.2000.00857.x. [DOI] [PubMed] [Google Scholar]
  38. Svanes K, Takeuchi K, Ito S, Silen W. Effect of luminal pH and nutrient bicarbonate concentration on restitution after gastric surface cell injury. Surgery. 1983;94:494–500. [PubMed] [Google Scholar]
  39. Tominaga T, Barber DL. Na-H exchange acts downstream of RhoA to regulate integrin-induced cell adhesion and spreading. Mol Biol Cell. 1998;9:2287–2303. doi: 10.1091/mbc.9.8.2287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Vexler ZS, Symons M, Barber DL. Activation of Na+-H+ exchange is necessary for RhoA-induced stress fiber formation. J Biol Chem. 1996;271:22281–22284. doi: 10.1074/jbc.271.37.22281. [DOI] [PubMed] [Google Scholar]
  41. Weintraub WH, Machen TE. pH regulation in hepatoma cells: roles for Na-H exchange, Cl-HCO3 exchange, and Na-HCO3 cotransport. Am J Physiol. 1989;257:G317–G327. doi: 10.1152/ajpgi.1989.257.3.G317. [DOI] [PubMed] [Google Scholar]
  42. Zaniboni M, Swietach P, Rossini A, Yamamoto T, Spitzer KW, Vaughan-Jones RD. Intracellular proton mobility and buffering power in cardiac ventricular myocytes from rat, rabbit, and guinea pig. Am J Physiol Heart Circ Physiol. 2003;285:H1236–H1246. doi: 10.1152/ajpheart.00277.2003. [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES