Skip to main content
EMBO Reports logoLink to EMBO Reports
. 2006 May 12;7(6):617–621. doi: 10.1038/sj.embor.7400701

An adhesion molecule in free-living Dictyostelium amoebae with integrin β features

Sophie Cornillon 1, Leigh Gebbie 1, Mohammed Benghezal 1,†, Prashant Nair 1, Sebastien Keller 2, Bernhard Wehrle-Haller 1, Steve J Charette 1, Franz Brückert 2, François Letourneur 3, Pierre Cosson 1,a
PMCID: PMC1479592  PMID: 16699495

Abstract

The study of free-living amoebae has proven valuable to explain the molecular mechanisms controlling phagocytosis, cell adhesion and motility. In this study, we identified a new adhesion molecule in Dictyostelium amoebae. The SibA (Similar to Integrin Beta) protein is a type I transmembrane protein, and its cytosolic, transmembrane and extracellular domains contain features also found in integrin β chains. In addition, the conserved cytosolic domain of SibA interacts with talin, a well-characterized partner of mammalian integrins. Finally, genetic inactivation of SIBA affects adhesion to phagocytic particles, as well as cell adhesion and spreading on its substrate. It does not visibly alter the organization of the actin cytoskeleton, cellular migration or multicellular development. Our results indicate that the SibA protein is a Dictyostelium cell adhesion molecule presenting structural and functional similarities to metazoan integrin β chains. This study sheds light on the molecular mechanisms controlling cell adhesion and their establishment during evolution.

Keywords: adhesion, Dictyostelium , integrin, motility, talin

Introduction

Cell–substrate adhesion is a crucial step in many biological processes such as development, wound healing, metastasis and phagocytosis. In mammalian cells, several proteins are involved in cellular adhesion, in particular cell-surface receptors, signalling molecules and components of the actin cytoskeleton. Integrin-mediated cell adhesion is one of the most widely studied adhesion mechanisms. Integrins are heterodimeric type I transmembrane proteins composed of one α-subunit and one β-subunit, which bind to the extracellular matrix by their extracellular domain and control cell spreading, migration, proliferation and survival (Schwartz, 2001).

The amoeba Dictyostelium discoideum is a widely used model to study cellular adhesion, phagocytosis and the dynamics of the actin cytoskeleton. This unicellular organism is amenable to genetic analysis, mainly owing to its fully sequenced haploid genome (Eichinger et al, 2005). Many gene products have been implicated in various aspects of the phagocytic process in Dictyostelium on the basis of the analysis of targeted knockout mutants (Bracco et al, 2000) or of mutants identified in random genetic screenings (Cornillon et al, 2000; Fey et al, 2002; Gebbie et al, 2004). Nevertheless, the receptors controlling the adhesion of free-living Dictyostelium cells to their substrate and to phagocytic particles have not been unambiguously identified.

Here, we report the identification and characterization of a Dictyostelium adhesion molecule, named SibA, which presents several features also found in mammalian integrin β chains. These results may shed light on the origin of adhesion molecules in evolution.

Results and Discussion

SibA, a membrane protein involved in phagocytosis

To identify new genes involved in phagocytosis, we mutagenized Dictyostelium cells by random insertion of a plasmid, and selected a mutant defective for phagocytosis of fluorescent latex beads. On the basis of its resemblance to integrins (see below), the corresponding gene was named SIBA (Similar to Integrin Beta). In the sibA mutant, the mutagenic plasmid is inserted in the DDB0187447 gene (Fig 1A), resulting in the absence of the corresponding transcript (Fig 1B). The SibA protein (1,928 amino-acid residues) has a putative endoplasmic reticulum insertion signal sequence at its amino terminus (position 1–21) and a transmembrane domain towards its carboxyl terminus (position 1859–1881), suggesting that it is a type I transmembrane protein. Indeed, cell-surface biotinylation followed by immunoprecipitation confirmed that SibA is present at the cell surface (Fig 2A). Four genes encoding homologues of SibA are present in the Dictyostelium genome (DDB0187821, DDB0187822, DDB0219318, DDB0187788), and positioned, like SIBA, on chromosome V. The first three are adjacent and arranged in tandem, and the fourth is in close proximity, suggesting a recent expansion of this gene family. Consistent with this hypothesis, the overall structure of Sib proteins is almost identical.

Figure 1.

Figure 1

Structure of Sib proteins. (A) Organization of the SIBA gene. Exons are shown as numbered black boxes (I–IV). The position of the vector insertion site in sibA mutant cells is indicated (nucleotide 1235 of the coding sequence). Scale bar, 1 kb. (B) A 6-kb SIBA transcript was detected by northern blot in wild-type (WT) but not in sibA mutant cells. (C) Structure of the SibA protein, and of human integrin β. CRD, cystein-rich domain; D.d., Dictyostelium discoideum; H.s., Homo sapiens; IGL, immunoglobulin-like fold; R, repeated motif; SS, cleavable signal sequence; VWA, von Willebrand factor type A domain. (D) The cytoplasmic domain of Sib proteins contains a conserved motif also found in integrin β chains. (E) The transmembrane domain of Sib proteins contains a GxxxG motif also present in integrin β chains.

Figure 2.

Figure 2

Interaction of SibA with talin. (A) SibA is localized at the cell surface. The cell surface of wild-type (WT) and sibA cells was biotinylated. Biotinylated SibA was immunoprecipitated and then observed with avidin–horseradish peroxidase. (B) Fusion proteins of glutathione S-transferase (GST) with the cytosolic domain of each Sib protein were produced in bacteria, purified and immobilized on beads. The beads were incubated with Dictyostelium cell lysates, washed and the bound talin was shown by immunoblotting. A lysate from talin mutant cells was used as a control (third lane). The Dictyostelium lysate loaded on the gel (right lane) corresponds to 10% of the amount of lysate incubated with each GST fusion protein. (C) Mutating the membrane-proximal NPxY SibA motif (mut1; see Fig 1D) abolished the interaction with talin.

The extracellular domains of Sib proteins contain an immunoglobulin-like fold (E-set, CL-0159, positions 174–235), a cysteine-rich domain (positions 394–461) and a von Willebrand factor type A domain (VWA, positions 520–691; Fig 1C). These three domains are commonly found in the extracellular domains of secreted or membrane-bound proteins and in many instances have been implicated in cell–substrate adhesion. VWA domains are ubiquitous in cytoplasmic proteins, but are also specifically deployed in several metazoan extracellular proteins, with integrin β subunits as very early evolutionary representatives (Whittaker & Hynes, 2002). Although lacking several features characteristic of metazoan integrin β chains, the Sib VWA domains show particularly high homology to integrin β VWA domains (supplementary information 1 online).

In addition, Sib extracellular domains contain four repeats of about 200 amino-acid residues (R1–R4; Fig 1C; supplementary Fig S2 online) also found in several surface or secreted bacterial proteins, in particular VCBS (IPR010221) and RTX (Lally et al, 1999) proteins. These bacterial proteins are involved in the interaction of bacteria with their substrate or with host cells, suggesting that these repeats could have a role in binding to certain substrates. We could not detect similar repeats in any eukaryotic protein other than Dictyostelium Sib proteins. Sib proteins thus represent hybrid structures associating bacterial-like repeats and metazoan-like features (an extracellular VWA domain), suggesting that these bacterial repeats might have been acquired from bacterial genomes by horizontal transfer.

The Sib transmembrane and cytosolic domains are particularly conserved among Sib proteins. The transmembrane domain is unusually rich in glycine residues, forming notably a GxxxG motif (Fig 1E). A GxxxG membrane motif is important for the oligomerization of several homo- and hetero-oligomeric membrane complexes (Cosson & Bonifacino, 1992; Russ & Engelman, 2000) and is a key feature of integrins' structure (Schneider & Engelman, 2004). The cytosolic domain contains two highly conserved NPxY motifs separated by eight amino-acid residues (Fig 1D), a motif also found in integrin β chains.

The cytosolic domain of Sib proteins interacts with talin

The conserved cytoplasmic domain of integrin β chains mediates interactions with several cytosolic proteins. One of these, talin, has a crucial role in integrin-mediated adhesion (Calderwood, 2004). However, integrin β cytosolic domains contain a tryptophan residue crucial for this interaction, which is not conserved in Sib proteins. To test the ability of the SibA cytosolic domain to interact with talin, we expressed a fusion protein of glutathione S-transferase (GST) with the cytosolic domain of SibA in bacteria, purified it and immobilized it on Sepharose beads and then incubated the beads with a Dictyostelium cellular lysate. Talin bound to GST–SibA, but not to GST alone (Fig 2B). As expected, no signal was detected when a lysate from talin knockout cells was used. In addition, talin also bound to GST–SibB, GST–SibC, GST–SibD and GST–SibE (Fig 2). Mutational analysis showed that the membrane-proximal NPxY motif (mutated in mut1) is essential for binding to talin, whereas the membrane-distal motif (mut2) is dispensable (Fig 2C). A similar finding was previously reported for integrin β chains (Calderwood, 2004).

Cellular adhesion of sibA mutant cells is defective

In several phagocytosis mutants characterized so far (Fey et al, 2002; Gebbie et al, 2004), the phagocytosis defect is caused by a defect in cellular adhesion to particles. For sibA mutant cells, phagocytosis of latex beads was altered (Fig 3A), but macropinocytosis, which was determined by measuring the uptake of fluid phase, was unaffected (Fig 3B). In addition, sibA mutant cells phagocytosed Klebsiella bacteria almost normally (Fig 3B), indicating that the machinery responsible for engulfment of particles was still functional and suggesting that the primary cause of the phagocytosis defect in sibA cells might be a specific defect in cell adhesion. To confirm this hypothesis, we measured the ability of sibA cells to establish a tight contact with their substrate. Cells were incubated on a glass substrate, and their zone of contact with the glass was visualized and measured by interference reflection microscopy (IRM; Fig 3C). The contact area was markedly smaller for sibA cells (average 14 μm2) than for wild-type cells (41 μm2; Fig 3D), suggesting that sibA mutant cells adhered less readily to their substrate.

Figure 3.

Figure 3

sibA mutant cells show specific adhesion defects. (A) sibA mutant cells phagocytose latex beads poorly. Wild-type (WT, black curve) or sibA cells (grey curve) were incubated for 20 min in the presence (or absence: white curve) of fluorescent latex beads. The amount of internalized fluorescence was determined with a fluorescence-activated cell sorter. The average number of beads incorporated per cell is indicated above each curve. (B) Cells were incubated with fluorescent latex beads, Klebsiella bacteria (K.p.) or dextran for 20 min. The internalization in sibA cells is expressed as a percentage of WT internalization. The mean and s.e.m. of at least five experiments are indicated. (C) The attachment of sibA mutant cells to a glass substrate is defective. WT and sibA cells attached to glass coverslips were observed by phase-contrast microscopy (Phase) and by IRM (interference reflection microscopy). (D) The areas of 100 individual cells in contact with the coverslip were measured. (E) The actin cytoskeleton is unaffected in sibA cells. WT, sibA or phg2 cells were fixed and stained with phalloidin. As described (Gebbie et al, 2004), abnormal actin aggregates form in phg2 mutant cells. Scale bar, 10 μm.

We then directly measured the adhesion of mutant cells to their substrate. Cells attached to a glass substrate were subjected to a flow of medium, and the speed of the flow necessary to detach 50% of the cells was determined. The strength necessary to detach the cells can be extrapolated and represents the strength of the cellular adhesion to the substrate (Decave et al, 2002). The adhesion of sibA mutant cells (0.1±0.05 Pa) was significantly weaker than that of wild-type cells (0.6±0.05 Pa), indicating that SibA is necessary for efficient cell–substrate adhesion.

Defects in cellular adhesion can be associated with alterations of the actin cytoskeleton, resulting in a range of anomalies in cell shape and migration, or in cytokinesis (Gebbie et al, 2004). No alteration in the organization of the cytoskeleton was seen in sibA cells (Fig 3E). Motility of sibA cells (2.7±0.2 μm/min) was also identical to that of wild-type cells (3.1±0.2 μm/min). Finally, only a small proportion of sibA cells were multinucleate (5.9±0.4%), indicating that there was no significant defect in cytokinesis. Thus, besides their defect in cellular adhesion, sibA mutant cells did not show any important alteration in the organization and function of the actin cytoskeleton.

Social amoebae, such as Dictyostelium, undergo multicellular development in nutrient-free medium. Here, we observed that sibA mutant cells undergo normal development, with the formation of tight aggregates after 6 h of starvation, and of fruiting bodies after 24 h (Fig 4). This indicates that SibA does not have an essential role in the cell-to-cell interactions that allow multicellular development. Analysis of messenger RNA levels by real-time PCR indicated that SibA, SibB, SibC and SibE are expressed in vegetative as well as in starved cells (S.C., unpublished data), suggesting that for certain cellular processes SibB, SibC and SibE may compensate for the lack of SibA.

Figure 4.

Figure 4

Development of sibA mutant cells is normal. Wild-type (WT) or sibA cells were starved to induce development. Cellular aggregates were observed after 6 h and fruiting bodies after 24 h. Scale bar, 0.5 mm.

Similarity between β integrins and Sib proteins

In summary, several features found in Dictyostelium Sib proteins are also present in metazoan integrin β chains. First, like integrin β chains, the extracellular domains of Sib proteins contain a VWA domain. Second, the transmembrane and cytosolic domains of Sib proteins are very similar to those found in integrin β chains. In metazoan proteins, this specific configuration (a transmembrane domain containing a GxxxG motif and two conserved cytosolic NPxY motifs) is present only in integrin β chains. Third, like integrin β chains, the cytosolic domain of Sib proteins binds to talin. Finally, loss of SibA causes a specific alteration in cellular adhesion.

There are, however, clear differences between Sib proteins and metazoan β integrins: several domains typical of metazoan integrins are not found in Sib proteins (Psi domain, repeated EGF-like cystein-rich domains), and we have not identified a Sib-associated subunit that would represent the equivalent of α integrins. Several features found in Sib proteins (for example, Sib bacterial-like repeats) are also absent from β integrins. Thus, a phylogenetic relationship between Sib proteins and β integrins remains highly speculative (see below).

Irrespective of their putative phylogenetic relationship, our observations suggest a certain degree of functional similarity in the way in which integrin β chains and Sib proteins connect the extracellular space with the cytosolic machinery. This reinforces the notion that cellular adhesion mechanisms are similar in Dictyostelium and in mammalian cells, and that observations in the Dictyostelium model system can be extrapolated meaningfully to mammalian cells. A more detailed analysis of the structure and function of Sib proteins will be necessary to determine further the extent of the similarity between β integrins and Sib proteins.

Speculation

Metazoan integrin β chains and Dictyostelium Sib proteins could be the products of convergent evolution. However, in view of the similarities demonstrated in this study, we speculate that they might stem from the same ancestral integrin β-like protein. This ancestral β integrin would represent one of the first evolutionary attempts to use VWA domains in extracellular domains, as proposed previously (Whittaker & Hynes, 2002). This hypothesis would place the appearance of β integrins long before the appearance of Metazoa, as recent analysis of the Dictyostelium genome indicated that Dictyostelium diverged from the line leading to animals after the plant–animal split, but before the divergence of fungi (Eichinger et al, 2005). The higher rate of evolutionary change along the fungal lineage may explain why, so far, no fungal integrin β-related molecules have been identified.

Methods

Cell culture and mutagenesis. Cells were cultured at 21°C in HL5 medium (Cornillon et al, 1998). To initiate multicellular development, cells were plated on 1% agarose Petri dishes in nutrient-free medium (5 mM Na2HPO4, 5 mM KH2PO4, 1 mM CaCl2, 2 mM MgCl2, pH 6.5; Sussman, 1987).

The sibA mutant was isolated following a procedure described previously (Cornillon et al, 2000). The plasmid rescued from the original mutant was used to inactivate the SIBA gene by homologous recombination in a DH1-10 wild-type strain (Caterina et al, 1994; Cornillon et al, 2000), and these sibA knockout cells were used for further characterization. Reverse transcription of RNA from wild-type cells followed by PCR amplification (Access Quick™ RT–PCR system, Promega, Madison, WI, USA) and sequencing showed that the 5′ coding sequence of SIBA differed from the coding sequence predicted by the genome sequencing centre, with two short exons instead of one. For northern blot analysis, a SIBA probe was obtained by PCR amplification of the genomic DNA using the primers CCAACTCCAGGTTCATCTGG and GCACCATCAGCAAAAGCTCC. The probe was radiolabelled and northern blot was carried out as described (Cornillon et al, 1998). The SIBA sequence can be found at www.dictybase.org (DDB0187447). Analysis of protein sequences was carried out with SMART (Schultz et al, 1998), Blast (Altschul et al, 1990) and MULTALIN (Corpet, 1988) programs.

Cellular assays. Phagocytosis and fluid-phase uptake were measured by incubating cells for 20 min at 21°C in HL5 containing 0.5-μm-diameter Fluoresbrite YG carboxylate microspheres (Polysciences, Warrington, PA, USA), fluorescently labelled Klebsiella (Cornillon et al, 2000) or 10 μg/ml Alexa647-labelled dextran (Molecular Probes, Eugene, OR, USA). The internalized fluorescence was measured in a fluorescence-activated cell sorter after two washes with HL5 containing 0.1% sodium azide (Cornillon et al, 2000). Velocity measurements and staining of nuclei and of the actin cytoskeleton were also performed as described (Gebbie et al, 2004).

To examine cell–substrate adhesion, cells were incubated for 4 h in HL5 on a glass coverslip, then observed by phase-contrast microscopy and IRM (Verschueren, 1985), using an Axiovert 100 M microscope (Carl Zeiss AG) coupled to a Hamamatsu Photonics camera, Openlab 3.0.6 software; contact surfaces were determined using the MetaMorph Offline software.

Biochemical methods. To express GST–Sib fusion proteins, the sequence coding for each Sib cytosolic domain was cloned into the bacterial expression vector pGEX-3X. The expression and purification of GST fusion proteins on glutathione–Sepharose beads was carried out as described (Smith & Johnson, 1988). D. discoideum cells (5 × 106) were lysed in 1 ml of PBS containing 1% Triton X-100 and protease inhibitors (Ravanel et al, 2001). Lysates were cleared by centrifugation (15 min, 10,000g, 4°C), and supernatants preincubated twice with glutathione–Sepharose beads before incubation for 16 h at 4°C with GST fusion proteins immobilized on Sepharose beads. Beads were washed five times in lysis buffer and once in PBS, and bound proteins were separated by SDS–polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. Talin was observed as described (Gebbie et al, 2004), with monoclonal anti-talin antibodies (169.477.5; Kreitmeier et al, 1995).

To immunoprecipitate surface SibA, 6 × 106 cells were biotinylated, lysed and immunoprecipitated with a rabbit anti-SibA polyclonal antibody raised against the cytoplasmic domain of SibA. Biotinylated SibA was shown with horseradish peroxidase-coupled avidin as described (Ravanel et al, 2001). Supplementary information is available at EMBO reports online (http://www.emboreports.org).

Supplementary Material

Supplementary Information

7400701-s1.pdf (99.4KB, pdf)

Acknowledgments

We thank V. Mercanti and R. Froquet for helpful discussions and for critical reading of the manuscript. This work was supported by grants from the Fonds National Suisse de la Recherche Scientifique and the 3R Foundation (to P.C.); from the Human Frontier Science Program (to S.J.C.); from the Ministère de la Recherche (to S.K.) and the CNRS (to F.B.); and from the Association pour la Recherche contre le Cancer (to F.L.).

References

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410 [DOI] [PubMed] [Google Scholar]
  2. Bracco E, Pergolizzi B, Peracino B, Ponte E, Balbo A, Mai A, Ceccarelli A, Bozzaro S (2000) Cell–cell signaling and adhesion in phagocytosis and early development of Dictyostelium. Int J Dev Biol 44: 733–742 [PubMed] [Google Scholar]
  3. Calderwood DA (2004) Talin controls integrin activation. Biochem Soc Trans 32: 434–437 [DOI] [PubMed] [Google Scholar]
  4. Caterina MJ, Milne JL, Devreotes PN (1994) Mutation of the third intracellular loop of the cAMP receptor, cAR1, of Dictyostelium yields mutants impaired in multiple signaling pathways. J Biol Chem 269: 1523–1532 [PubMed] [Google Scholar]
  5. Cornillon S, Olie RA, Golstein P (1998) An insertional mutagenesis approach to Dictyostelium cell death. Cell Death Differ 5: 416–425 [DOI] [PubMed] [Google Scholar]
  6. Cornillon S, Pech E, Benghezal M, Ravanel K, Gaynor E, Letourneur F, Bruckert F, Cosson P (2000) Phg1p is a nine-transmembrane protein superfamily member involved in Dictyostelium adhesion and phagocytosis. J Biol Chem 275: 34287–34292 [DOI] [PubMed] [Google Scholar]
  7. Corpet F (1988) Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16: 10881–10890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cosson P, Bonifacino JS (1992) Role of transmembrane domain interactions in the assembly of class II MHC molecules. Science 258: 659–662 [DOI] [PubMed] [Google Scholar]
  9. Decave E, Garrivier D, Brechet Y, Bruckert F, Fourcade B (2002) Peeling process in living cell movement under shear flow. Phys Rev Lett 89: 108101. [DOI] [PubMed] [Google Scholar]
  10. Eichinger L et al. (2005) The genome of the social amoeba Dictyostelium discoideum. Nature 435: 43–57 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fey P, Stephens S, Titus MA, Chisholm RL (2002) SadA, a novel adhesion receptor in Dictyostelium. J Cell Biol 159: 1109–1119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gebbie L et al. (2004) Phg2, a kinase involved in adhesion and focal site modeling in Dictyostelium. Mol Biol Cell 15: 3915–3925 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kreitmeier M, Gerisch G, Heizer C, Muller-Taubenberger A (1995) A talin homologue of Dictyostelium rapidly assembles at the leading edge of cells in response to chemoattractant. J Cell Biol 129: 179–188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lally ET, Hill RB, Kieba IR, Korostoff J (1999) The interaction between RTX toxins and target cells. Trends Microbiol 7: 356–361 [DOI] [PubMed] [Google Scholar]
  15. Ravanel K, de Chassey B, Cornillon S, Benghezal M, Zulianello L, Gebbie L, Letourneur F, Cosson P (2001) Membrane sorting in the endocytic and phagocytic pathway of Dictyostelium discoideum. Eur J Cell Biol 80: 754–764 [DOI] [PubMed] [Google Scholar]
  16. Russ WP, Engelman DM (2000) The GxxxG motif: a framework for transmembrane helix–helix association. J Mol Biol 296: 911–919 [DOI] [PubMed] [Google Scholar]
  17. Schneider D, Engelman DM (2004) Involvement of transmembrane domain interactions in signal transduction by alpha/beta integrins. J Biol Chem 279: 9840–9846 [DOI] [PubMed] [Google Scholar]
  18. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci USA 95: 5857–5864 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Schwartz MA (2001) Integrin signaling revisited. Trends Cell Biol 11: 466–470 [DOI] [PubMed] [Google Scholar]
  20. Smith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67: 31–40 [DOI] [PubMed] [Google Scholar]
  21. Sussman M (1987) Cultivation and synchronous morphogenesis of Dictyostelium under controlled experimental conditions. Methods Cell Biol 28: 9–29 [DOI] [PubMed] [Google Scholar]
  22. Verschueren H (1985) Interference reflection microscopy in cell biology: methodology and applications. J Cell Sci 75: 279–301 [DOI] [PubMed] [Google Scholar]
  23. Whittaker CA, Hynes RO (2002) Distribution and evolution of von Willebrand/integrin A domains: widely dispersed domains with roles in cell adhesion and elsewhere. Mol Biol Cell 13: 3369–3387 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information

7400701-s1.pdf (99.4KB, pdf)

Articles from EMBO Reports are provided here courtesy of Nature Publishing Group

RESOURCES