Xanthosine Utilization in Salmonella enterica Serovar Typhimurium Is Recovered by a Single Aspartate-to-Glycine Substitution in Xanthosine Phosphorylase

Abstract

xapABR from Salmonella enterica was analyzed and compared with the corresponding Escherichia coli genes. xapB and xapR, but not xapA, encode functional proteins. An S. enterica XapA(Asp72Gly) mutant that restores the phosphorolytic activity was selected. The purified mutant enzyme has different kinetic constants than the E. coli enzyme but similar substrate specificity.

Escherichia coli and Salmonella enterica are both able to utilize exogenous purine and pyrimidine (deoxy)ribonucleosides as carbon and energy sources. Nucleosides taken up are metabolized predominantly by nucleoside phosphorylases (EC 2.4.2.1) that catalyze the reversible phosphorolytic cleavage of the N-glycosidic bond, forming d-(deoxy)ribose-1-phosphate and the corresponding base (for reviews, see references 8 and 13).

Four nucleoside phosphorylases of E. coli have been characterized: thymidine phosphorylase, which is specific for deoxyuridine and thymidine; uridine phosphorylase, which is specific for uridine; purine nucleoside phosphorylase, which is specific for purine (deoxy)ribonucleosides, except xanthosine; and xanthosine phosphorylase (XapA), which is specific for the 6-oxo-purine (deoxy)ribonucleosides (deoxy)inosine, (deoxy)guanosine, and xanthosine but not the 6-amino-purine nucleoside (deoxy)adenosine (1, 3, 7). In E. coli, the xap region is composed of the xapAB operon, where xapA encodes xanthosine phosphorylase and xapB encodes xanthosine permease, a proton nucleoside symporter that can transport 6-oxo-purine ribonucleosides, adenosine, cytidine, uridine, and thymidine (9, 11). The xapR gene, which is located downstream of xapAB and is expressed from two promoters, encodes a LysR-type transcriptional regulator that is required for activation of transcription of xapAB (6, 11). xapA and xapR mutants do not grow on xanthosine and have no detectable XapA activity, whereas xapB mutants grow very poorly on xanthosine and have reduced XapA activity due to insufficient uptake and induction (9, 11).

S. enterica contains thymidine phosphorylase, uridine phosphorylase, and purine nucleoside phosphorylase, all of which are very similar to those of E. coli (2, 5). However, S. enterica does not grow on xanthosine and no XapA activity can be measured after addition of xanthosine (3; G. Dandanell, unpublished observation). S. enterica was therefore believed to lack the xap genes. A comparative BLAST search in the NCBI GenBank database revealed a region in S. enterica (accession number AE008809.1) with very high similarity to the xap region in E. coli. This S. enterica region contains xapA-, xapB-, and xapR-like genes organized in the same way as those in E. coli, with similar intercistronic distances (herein, the subscripts Se and Ec are used to distinguish between genes from S. enterica and E. coli, respectively). The deduced amino acid sequences of xapA_Se, xapB_Se, and xapR_Se are 87%, 89%, and 81% identical to the corresponding E. coli sequences, respectively. −35 and −10 regions with high similarity to the mapped E. coli promoters are found upstream of xapAB_Se and xapR_Se, which contain nearly identical Shine-Dalgarno sequences.

Our goal with the present work was to compare the xap regions of S. enterica and E. coli and to elucidate why S. enterica does not utilize xanthosine. All attempts to clone the S. enterica xap region by functional complementation of E. coli xapA and xapR mutations failed and instead resulted in the cloning of rihC, which encodes a nucleoside hydrolase, RihC, with specificity for xanthosine (4). E. coli also contains rihC (10); however, in both bacteria the chromosomal copy of rihC is not expressed sufficiently to support growth on xanthosine, so E. coli relies on functional xapABR for growth and metabolism of xanthosine. We therefore cloned the genes following PCR. Primers were designed to amplify xapA_Se, xapB_Se, and xapR_Se individually and to combine them to form the wild-type xapABR_Se region, except for the restriction endonuclease sites introduced for cloning purposes (Fig. 1A). Each gene was amplified by PCR using chromosomal S. enterica DNA as the template and cloned into the low-copy-number vector pWSK29 downstream of the plasmid-borne lac promoter (12). This was necessary for expression of xapB_Se, which does not have a promoter. All xapA_Se constructs also included the potential xapAB_Se promoter. Transformants of strains GD1188 (F⁻ thr1 leuB6 rpsL galK lacY1 cytR deoD Δlac pro::Tn10 xapA::stoplink orf254::Km^r) (4), SØ6444 (F⁻ thr1 leuB6 rpsL galK lacY1 cytR deoD Δlac pro::Tn10 xapR::Km^r), and SØ6687 [araD139 Δ(lacZYA-argF)U169 strA thi codAB ΔnupC ΔnupG ΔxapB::Km^r] (9) were tested for growth on minimal plates with xanthosine as the sole carbon source (Table 1). When transformed with the vector plasmid pWSK29, none of the xap mutants grew on xanthosine. In a xapA mutant background, none of the plasmids pMRH25, pMRH39, or pMRH40, containing xapA_Se, xapAB_Se, or xapABR_Se, respectively, complemented xapA. In contrast, xapB_Se and xapR_Se complemented xapB_Ec and xapR_Ec, respectively. All three plasmids containing xapB_Se (pMRH39, pMRH40, and pMRH41) complemented xapB_Ec. Also, xapR_Se complemented a xapR_Ec mutation, both alone (pMRH25) and as the entire xapABR_Se (pMRH40). These results show that both xapB_Se and xapR_Se encode proteins with functions similar to those of XapB_Ec and XapR_Ec and that they complement E. coli mutations, whereas either xapA_Se is not expressed or the gene product is inactive.

FIG. 1.

(A) Schematic view of pMRH40. The restriction sites were introduced in noncoding and nonpromoter regions. (B) Amino acid alignment of E. coli (Ec) and S. enterica (Se) XapA. The central sequence shows identical amino acids, and + indicates conservative amino acids. Vertical arrows indicate the positions of the protein fusion points and Asp72.

TABLE 1.

Complementation analysis of S. enterica xapABR

Parent strain	Relevant parent E. coli genotype	Plasmida	S. enterica gene inserted in pWSK29b	Growth on XRc
SØ6436	Wild type	pWSK29		++
GD1188	xapA	pWSK29		−
GD1188	xapA	pMRH25	xapA	−
GD1188	xapA	pMRH39	xapAB	−
GD1188	xapA	pMRH40	xapABR	−
SØ6687	xapB	pWSK29		−
SØ6687	xapB	pMRH41	xapB	+
SØ6687	xapB	pMRH39	xapAB	+
SØ6687	xapB	pMRH40	xapABR	+
SØ6444	xapR	pWSK29		−
SØ6444	xapR	pMRH38	xapR	+
SØ6444	xapR	pMRH40	xapABR	+

^apMRH25 was constructed in two steps. First, xapA_Se was amplified using 5′- GTAAGAATTCTTTTCATAGCATATTTCCC and 5′-GCCGTGAGATCTAGCCCCAATACGGGGCCG and cloned into pSU18 digested with EcoRI and XmaI. Next, a 1,921-bp EcoRI fragment was isolated and inserted into pWSK29. pMRH38 was constructed in two steps. First, the xapR gene was amplified using 5′-GATTTTAGTCGACTGGCGAGAGGATGTTCGCC and 5′-GATATGGAAGCTTCGAACCTGTCGCAGGTTCGGG and ligated into pSU18 digested with SalI and HindIII. Next, a 1,291-bp EcoRI-HindIII DNA fragment was isolated and ligated into pWSK29 digested with EcoRI and HindIII. pMRH39 was constructed by amplifying xapB_Se using 5′-CCCCGTATTGGGGCTAGATCTCACGGCAAGG and 5′-AGATAATACCCCGGGTAAAACATTTGGTGC and ligated together with amplified xapA_Se from pMRH25 into pSU18 digested with EcoRI and XmaI. Finally, the 2,599-bp EcoRI-HindIII DNA fragment containing xapAB_Se DNA was ligated into pWSK29 digested with EcoRI-HindIII. pMRH40 was constructed by combining a 2,564-bp EcoRI-XmaI fragment (xapAB_Se) and a 1,112-bp XmaI-HindIII fragment (xapR_Se) into pWSK29 digested with EcoRI and HindIII. pMRH41 was constructed by deleting a 1,085-bp EcoRI and SnaBI fragment from pMRH39, followed by Klenow treatment and ligation.

^bAll inserts are downstream of the plasmid-borne lac promoter.

^c−, no growth; +, growth; ++, good growth (after 3 days of incubation at 37°C in the presence of 1 mg/ml xanthosine [XR]).

To eliminate the possibility that xapA_Se is not expressed sufficiently from its own promoter, it was inserted after the strong xapAB_Ec promoter in the expression vector pGD271, which highly overexpresses xapA_Ec, by replacing the coding region of xapA_Ec with the coding region of xapA_Se. As shown in Fig. 2, no xanthosine phosphorylase activity could be detected (compare pGD271 and pGD275), and no protein bands corresponding to XapA_Se were seen on sodium dodecyl sulfate-polyacrylamide gels (data not shown). To identify amino acid residues in xapA_Se responsible for the lack of activity, we constructed a series of chimeric protein fusions between xapA_Ec and xapA_Se at amino acid positions 6, 33, 122, and 218 (Fig. 1B). The plasmid-borne fusions were transformed into strain GD1188(xapA) and tested for growth on xanthosine as the sole carbon source (Fig. 2). Three of these plasmids (pMRH27, pMRH35, and pJJ2) carry gene fusions that complement xapA_Se, indicating that residues between 33 and 122 of S. enterica caused the lack of activity. We also measured xanthosine phosphorylase activity in crude extracts of cells grown in the presence of xanthosine. The activities correlate well with the ability to grow on xanthosine. In GD1188(pGD271), which was used to produce XapA_Ec, a high xanthosine phosphorylase activity was determined (435 U/optical density at 436 nm [OD₄₃₆]). Gene fusions carrying the S. enterica sequence between amino acid positions 33 and 122 (pMRH25, pMRH26, pGD275, pJJ1, and pJJ3) showed no activity, while gene fusions carrying the corresponding E. coli sequence resulted in 7 to 8 U/OD₄₃₆ for pWSK29 derivatives (pMRH27 and pMRH35) and 60 U/OD₄₃₆ for the pBR322 derivative pJJ2.

FIG. 2.

Protein fusion analysis of XapA. Open bars and thin lines indicate E. coli DNA, whereas filled bars and bold lines indicate S. enterica DNA inserted into pWSK29 or pGD272 upstream of xapR9 that causes constitutive expression. Numbers indicate the amino acid positions of the protein fusions and the Asp72Gly mutation. Growth on xanthosine was monitored after 3 days of incubation at 37°C in the presence of 1 mg/ml xanthosine. −, no growth; +, growth; ++, good growth (based on colony size). XapA units are nanomoles inosine converted per minute at 25°C and represent the averages of three to five independent experiments. pGD271 is a derivative of pGD265 (1) where a unique NdeI site was introduced in the start codon of xapA by use of the QuickChange (Strategene) protocol. In pGD272, the xapA gene is replaced by a polylinker containing unique NdeI, KpnI, SmaI, BamHI, HindIII, and NcoI sites for use as an expression vector. pGD275 is a pGD272 derivative that carries the xapA_Se coding region amplified with primers 5′-GAACAAGGAAACATATGCCTCACGCTCTTTTTTC and 5′-GCCGTGAGATCTAGCCCCAATACGGGGCCG. pJJ1 was constructed by amplifying xapA_Se using primers 5′-CAGAAAAAGGATACATATGTCTCAGGTTCAATTTTC and 5′-GCCGTGAGATCTAGCCCCAATACGGGGCCG. pJJ2 and pJJ3 were constructed in two steps. First, a unique BamHI site was introduced to both xapA_Ec and xapA_Se by use of the QuickChange (Strategene) protocol with 5′-CGAGTGGCGTTTATTTTAGGATCCGGGTTCGGTGCGCTGGC and its complementary primer. Then, both plasmids were digested with BamHI and NcoI and DNA fragments were isolated, swapped, and ligated, resulting in pJJ2 and pJJ3. pJJ4 and pJJ5 were constructed by introducing an Asp72Gly (A345G) mutation in pGD275 and pMRH26, respectively, using the QuickChange (Strategene) protocol with 5′-GCTGGTGAACTGGTGCTCGGCCATCTGGCGGGGGTTCC and its complementary primer. All constructions involving PCR were verified by DNA sequencing.

We used strain GD1188 containing pJJ1 to select mutants able to grow on xanthosine. Cells (10⁹) were spread on minimal plates with xanthosine as the sole carbon source. After 3 days of incubation, approximately 50 colonies appeared. Twelve candidates were purified, and plasmid DNA was isolated and retransformed to assure that the phenotype was plasmid borne. The DNA was sequenced, and all 12 mutants were found to carry the same mutation, a single nucleotide change (A345G) that caused an Asp72Gly alteration (Fig. 1B). The position of this mutation correlates with the finding that gene fusions with the E. coli sequence between amino acids 33 and 122 were active. When the amino acid sequence of XapA_Se is compared with those of other known purine nucleoside phosphorylases, including xanthosine phosphorylases, a glycine at position 72 is found to be conserved in all cases, suggesting that the inability of S. enterica to utilize xanthosine might have been caused by a Gly72Asp mutation.

To show that the Asp72Gly alteration also rescues activity in XapA_Se with its own promoter, the mutation was introduced into pMRH26 (Fig. 2). The resulting plasmid, pJJ5, supports growth on xanthosine and has xanthosine phosphorylase activity slightly lower than that of the other fusion proteins (4.0 U/OD₄₃₆). When GD1188(pJJ5) was grown in the absence of xanthosine, no activity could be detected (data not shown). This shows that the xapA_Se promoter is functional and that it depends completely on xanthosine for expression, as has been found with the xapA_Ec promoter (11).

In order to purify and characterize the mutant S. enterica enzyme, we introduced the A345G change into pGD275, where the wild-type xapA_Se gene is expressed from the strong xapAB_Ec promoter (pJJ4). In the GD1188(pJJ4) extract, a xanthosine phosphorylase activity of 135 U/OD₄₃₆ was measured, approximately one-third of that of xapA_Ec in pGD271 (Fig. 2).

The XapA_Se(Asp72Gly) enzyme was purified from 500 ml of overnight LB broth culture of GD1525 [BL21(DE3) deoD zjj::Tn10 Δxap(ABR)::Km^r/pJJ4] (1) supplemented with ampicillin (150 mg/liter) essentially as described for the XapA_Ec purification (1), except that the ammonium sulfate (45%)-precipitated enzyme was applied to a phenyl-Sepharose column (Pharmacia) in 50 mM Tris-HCl, 250 mM (NH₄)₂SO₄, 5 mM mercaptoethanol, pH 7.5, and eluted with 100 ml of a linear gradient to 5 mM potassium phosphate, 5% glycerol, pH 7.4, prior to MonoQ (Pharmacia) anion-exchange chromatography. The enzyme was estimated as approximately 98% pure by electrophoresis in sodium dodecyl sulfate-polyacrylamide gels.

In kinetic analysis, the purified XapA_Se(Asp72Gly) enzyme showed normal Michaelis-Menten kinetics with all substrates, and K_m and V_max were calculated and compared with the kinetic constants of XapA_Ec (XapA_Ec data are indicated in parentheses in Table 2). As shown, the substrate specificity of XapA_Se(Asp72Gly) was similar to that of XapA_Ec. However, both K_m and V_max differed significantly, with inosine as the substrate showing the largest difference. K_m was 2.8-fold lower and V_max was 4-fold higher, making the catalytic efficiency (k_cat/K_m) of XapA_Se(Asp72Gly) 12-fold higher than that of XapA_Ec. In contrast, the catalytic efficiency with xanthosine and guanosine was nearly identical for the two enzymes. K_m of XapA_Se(Asp72Gly) for xanthosine and guanosine was two- to threefold higher than that of XapA_Ec, but this was compensated for by a higher V_max. As found previously for XapA_Ec, XapA_Se does not use adenosine as a substrate. The large difference in catalytic efficiency for inosine is difficult to explain from the difference in the amino acid sequences (87.4% identity) since all residues involved in the active site in XapA_Ec determined from the three-dimensional structure are conserved in XapA_Se (1). Both Gly72 and the four other nonconserved differences in the position 33 to 122 region are distant from the active site (>12 Å from the phosphate binding site and >17 Å from the nucleobase binding site). Gly72 is part of a surface-exposed β-sheet, and the change to aspartate in native XapA_Se probably disturbs the structure of this β-sheet.

TABLE 2.

Kinetic analysis of XapA_Se(Asp72Gly)^a

Substrate	Km (μM)	Vmax (μmol min−1 mg−1)	kcat (s−1)	kcat/Km (s−1 mM−1)
Inosine	348 ± 20 (963)	52.7 ± 0.8 (12)	25.8 ± 0.2 (6.0)	74.1 (6.2)
Xanthosine	222 ± 15 (72)	28.2 ± 0.5 (8.8)	13.7 ± 0.2 (4.4)	62.2 (61.0)
Guanosine	273 ± 24 (155)	22.9 ± 0.9 (14.3)	11.2 ± 0.4 (7.1)	41.0 (45.7)

^aNumbers in parentheses are the values for XapA_Ec, taken from reference 1. Phosphorylase activities were measured in 50 mM ammonium acetate buffer, 20 mM potassium phosphate, pH 7.1, at 25°C using 2- or 10-mm-path-length cuvettes with a Zeiss Specord S10 spectrophotometer as described previously for RihC hydrolase activity, except for the difference in buffer composition (4). Protein content was determined spectrophotometrically at 280 nm. A solution of 1 mg ml⁻¹ of XapA_Se(Asp72Gly) gave an A₂₈₀ of 0.326 cm⁻¹. Kinetic constants were determined by measuring the initial velocities at 11 different substrate concentrations ranging from 0.25 to 2 mM (xanthosine), 0.05 to 0.75 mM (guanosine), and 0.1 to 3 mM (inosine). The program Ultrafit 3.0 (Biosoft) was used to fit the experimental data to Michaelis-Menten kinetics.

The substrate specificity of XapB_Se was determined by plating SØ6687 [araD139 Δ(lacZYA-argF)U169 strA thi codAB ΔnupC ΔnupG ΔxapB::Km^r] (9) containing pMRH41 on minimal medium supplemented with different ribonucleosides and deoxyribonucleosides as the carbon source. We found that cells harboring XapB_Se grew on xanthosine, (deoxy)inosine, (deoxy)guanosine, (deoxy)adenosine, (deoxy)cytidine, and thymidine, while no growth was observed on (deoxy)uridine. This result is similar to that found for cells harboring XapB_Ec, except that cells harboring XapB_Ec did not grow on guanosine (9). However, when we transferred xapB_Ec from the vector pSU18 previously used into pWSK29, XapB_Ec supported growth on (deoxy)guanosine similar to that found for XapB_Se (data not shown). We found that pSU18 and some of its derivates often cause growth inhibition of E. coli cells when grown in minimal medium, which is probably the reason for the discrepancy found here (data not shown).

XapR_Ec and XapR_Se differ at 57 amino acid positions. Two positions (203 and 205) are particularly interesting because XapR_Ec mutants at these positions result in altered induction specificity (6). In XapR_Ec, the Pro203Arg, Pro203Thr, and Tyr205Asp mutants each broaden the induction specificity and Tyr205Asp causes constitutive XapA expression. It was therefore interesting to see if XapR_Se carrying a serine at position 203 and a histidine at position 205 has different induction specificity than XapR_Ec. SØ6444(pMRH38) was streaked on minimal plates containing xanthosine, guanosine, adenosine, inosine, deoxyguanosine, deoxyadenosine, or deoxyinosine as the carbon source. Growth was observed only on xanthosine and deoxyinosine, indicating that these are the only nucleosides that can act as inducers and that the amino acid differences at positions 203 and 205 do not change the specificity. Previously, we found that a different E. coli wild-type strain (SØ1053) could grow only on xanthosine, while induction by deoxyinosine was too weak to support growth on the deoxynucleoside (6). However, SØ6436, which is the parent strain (xap⁺) of SØ6444, also grows on deoxyinosine. The most likely explanation for this difference is that deoxyinosine is taken up more efficiently by the NupG permease in SØ6436 than in SØ1053. We conclude that both xanthosine and deoxyinosine can act as inducers of both XapR_Se and XapR_Ec.

Conclusion.

The inability of S. enterica to utilize xanthosine has led to the assumption that S. enterica, in contrast to E. coli, lacks the xap genes (3). Here, we show that S. enterica indeed has functional xapB and xapR genes but carries a nonfunctional xapA gene. A single amino acid change (Asp72Gly) in XapA_Se fully restores the enzymatic activity, with catalytic efficiencies similar to those of XapA_Ec for xanthosine and guanosine but more catalytically efficient for inosine. The strong similarity of the xap region in E. coli and that in S. enterica regarding the promoter, the coding regions, and the organization of the genes strongly indicates that S. enterica has picked up a Gly72Asp mutation in the absence of any selective pressure for metabolizing xanthosine. This is strengthened by the observation that all known xapA homologues encode a glycine at position 72 as in E. coli, including all Salmonella strains, other than S. enterica, that carry xap homologues. Often, comparative studies of genome sequences using bioinformatics are used to deduce biochemical pathways. However, our study of XapA_Se emphasizes the importance of biochemical analyses in comparative studies.