Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2006 Jun;26(11):4226–4239. doi: 10.1128/MCB.01959-05

A Conserved Myc Protein Domain, MBIV, Regulates DNA Binding, Apoptosis, Transformation, and G2 Arrest

Victoria H Cowling 1,2, Sanjay Chandriani 3, Michael L Whitfield 2, Michael D Cole 1,2,*
PMCID: PMC1489101  PMID: 16705173

Abstract

The myc family of oncogenes is well conserved throughout evolution. Here we present the characterization of a domain conserved in c-, N-, and L-Myc from fish to humans, N-Myc317-337, designated Myc box IV (MBIV). A deletion of this domain leads to a defect in Myc-induced apoptosis and in some transformation assays but not in cell proliferation. Unlike other Myc mutants, MycΔMBIV is not a simple loss-of-function mutant because it is hyperactive for G2 arrest in primary cells. Microarray analysis of genes regulated by N-MycΔMBIV reveals that it is weakened for transactivation and repression but not nearly as defective as N-MycΔMBII. Although the mutated region is not part of the previously defined DNA binding domain, we find that N-MycΔMBIV has a significantly lower affinity for DNA than the wild-type protein in vitro. Furthermore, chromatin immunoprecipitation shows reduced binding of N-MycΔMBIV to some target genes in vivo, which correlates with the defect in transactivation. Thus, this conserved domain has an unexpected role in Myc DNA binding activity. These data also provide a novel separation of Myc functions linked to the modulation of DNA binding activity.


Myc proteins drive a range of cellular responses, depending on the cellular context. Myc is an essential conduit for growth factors to induce proliferation, and ectopic expression of Myc can drive cells into cycle independently of growth factors (1, 17). Myc was first isolated as an oncogene, and supraphysiological expression of Myc drives tumorigenesis and cell transformation (11). The transformed phenotype is restricted by at least two other cellular responses to aberrant myc expression, apoptosis and growth arrest. In the absence of sufficient growth/survival factors, constitutive Myc expression induces apoptosis (2, 18), whereas some primary cells arrest in G2 phase in response to Myc overexpression (19). The molecular basis for these grossly different Myc activities remains unresolved.

Myc is a basic helix-loop-helix (bHLH)/leucine zipper transcription factor that operates as a heterodimer with Max. Myc transactivates in part by binding to the TRRAP complex, recruiting histone acetylase activity to cellular promoters (7, 22, 39, 40). There is also evidence that Myc activates genes using CBP and Skp2 as cofactors (30, 55, 56), and Myc may also promote transcriptional elongation through recruitment of the positive transcription elongation factor b (16). Whole-genome array analysis has revealed that Myc binds to a large fraction of cellular promoters, activating around 5 to 15% of genes weakly depending on the cellular context and experimental system (6, 12, 20, 24, 27, 33, 37, 46, 50, 57). Defining which genes are responsible for driving the different Myc phenotypes continues to be a challenge.

The Myc family members, c-Myc, N-Myc, and L-Myc, all function as oncogenes in different tumors and have a high degree of sequence conservation (11). c-Myc and N-Myc are particularly well conserved and have equivalent oncogenic activities (43). Furthermore, their coding regions can substitute for each other in mouse development (36). Myc proteins are also well conserved across species, which is reflected in the observation that the Drosophila myc gene, dmyc, can functionally substitute for mammalian c-Myc (49, 54). Characterization of the Myc protein has revealed several domains that are critical for different activities. The DNA binding domain was established by comparison to other bHLH proteins and found to be essential for gene activation (4, 5). In the N terminus, the prominent evolutionarily conserved domains are called Myc homology boxes (MBs). Of particular note is MBII, which is necessary for full transcriptional activation and repression. Mutation of this domain inhibits the binding of most Myc coactivators and also inhibits most Myc phenotypes (13, 18, 23, 43, 47, 53). In fact, the MBII deletion phenotype is so severe that MBII may be interpreted to be necessary for the integrity of the N terminus as a whole rather than as a distinct domain. The MBI domain has a more complex phenotype which is dependent on the extent of the mutation. MBI is a site of phosphorylation and is the only consistent site of Myc protein mutation found in some tumors (3, 35). MBI mutations can affect Myc protein turnover (26, 51), and larger deletions indicate that this domain is necessary for full activity in transformation assays (30, 53). Recent work has defined a third region of the Myc N terminus, MBIII, as a mediator of apoptosis, transformation, and tumorigenesis (28).

Here we report the first characterization of a conserved domain within the N-Myc protein, Myc317-337, designated MBIV. Deletions within this domain cause unique changes in the induction of apoptosis, transformation, and G2 arrest that are reflective of an unexpected defect in Myc DNA binding activity. These data suggest novel conformational and/or cofactor requirements that mediate Myc biological activity.

MATERIALS AND METHODS

Mutations, cell maintenance, transfection, and retroviral infection.

The mouse N-MycΔMBIV mutant was created using standard techniques and verified by sequencing. The mouse N-MycΔMBII mutant was previously described (43). Rat c-myc null fibroblasts (HO15.19 cells), human embryonic kidney 293 cells, human primary fibroblast BJ cells, RK3E cells, Rat-1a fibroblasts, rat embryo fibroblasts (REFs), mouse embryo fibroblasts (MEFs), and retroviral producer PhoeNX cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). PhoeNX cells were transfected by using Fugene (Roche) according to the manufacturer's instructions, and infections were performed using standard protocols. Cells were maintained in 150 μg/ml hygromycin (Calbiochem) to select for cells containing LXSH-based constructs and 0.5 mg/ml G418 (Sigma) to select for pcDNA3.1-based constructs.

Cell counts.

Cells (2 × 104) were plated in six-well plates. Cells were trypsinized each day and counted using a hemocytometer, with at least 100 cells being counted. Cell counts were normalized to cells counted on the first day after seeding for each cell line. The experiment was performed twice.

CFSE staining.

Cells (106) were trypsinized, resuspended in 1 ml of 0.1% FCS-phosphate-buffered saline containing 5 μM, 5 (and 6)-carboxyfluorescein diacetate (CFDA) succinimidyl ester (SE) (CFSE; Molecular Probes catalog no. of C1157), and incubated for 10 min at 37°C. Cells were washed three times in phosphate-buffered saline and plated onto three 10-cm-diameter plates. Cells were trypsinized on days 1, 2, and 3 and analyzed by fluorescence-activated cell sorter (FACS) using a FACScan. Mean fluorescence intensity values were measured, and differences between measurements on subsequent days were calculated.

Apoptosis.

Cells maintained in 0.1% serum for 24 h were ethanol fixed and incubated overnight in 8 μg/ml propidium iodide (PI; Sigma) and 40 μg/ml RNase H (Sigma). PI content was analyzed using FACScan.

Transformation and soft agar assays.

REFs were extracted from day-15 rat embryos. Two days after extraction, 70% confluent 10-cm-diameter plates were transfected with 1 μg human H-RasG12V and 1 μg CβF (vector), CβF N-MycWT, N-MycΔMBII, N-MycΔMBIV, and 0.1 μg pcDNA3.1 (G418 resistance). For each transfection, three plates were maintained for 10 days in DMEM-5% FCS, and one plate was selected with G418. After 10 days, foci were counted and normalized to G418-resistant colonies. Foci formed relative to N-MycWT were calculated. For soft agar, Rat-1a fibroblasts were infected with LXSH N-MycWT, N-MycΔMBII, N-MycΔMBIV, or vector control, and pools were drug selected with hygromycin. Cells were plated in soft agar in triplicate in six-well plates. The bottom layer consisted of 0.6% noble agar-DMEM-10% FCS, and the upper layer consisted of 1 × 104 cells suspended in 0.3% noble agar-DMEM-10% FCS. After 12 days, the number of foci larger than 50 μm was counted in five fields from each well. Foci formed relative to N-MycWT were calculated. For focus formation, 104 cells of the same Rat-1a lines above were mixed with 2 × 106 Rat-1a cells and plated. Cells were maintained for 10 days, fixed in methanol, and stained with 0.1% methylene blue. Foci were counted for cultures in triplicate. The RK3E transformation assay was performed as described previously (21). Briefly, viral supernatants from a 10-cm plate of PhoeNX cells were diluted and used to infect a 10-cm plate of RK3E cells with LXSH (vector) or the same vector with N-MycWT or N-MycΔMBIV. Cells were placed in selection to measure transfection efficiency or maintained for 3 weeks to allow focus formation. After 3 weeks, cells were fixed in methanol and stained with 0.1% methylene blue. Hygromycin-resistant colonies and foci were counted to determine the relative number of foci formed for two independent experiments.

Subcellular fractionation.

Myc null cells expressing N-MycWT, N-MycΔMBII, N-MycΔMBIV, and vector control were lysed by Dounce homogenization in hypotonic buffer. Nuclei and cytosol were separated by centrifugation at 1,600 × g. Nuclei were subsequently washed twice, and cytosol was clarified by further centrifugation at 6,000 × g. Nuclei were solubilized in F buffer containing 0.5% Triton. Protein content of the fractions was measured using the Bradford assay, and samples were normalized for protein content. Nuclear and cytosolic material from an equivalent amount of cells was immunoblotted for N-Myc, RNA polymerase II, and tubulin.

Coimmunoprecipitation.

Plates (with 10- or 15-cm diameters) of subconfluent cells were lysed in 1 or 2 ml of F buffer (52), and extracts were incubated overnight at 4°C with 20 μl anti-FLAG antibody-conjugated beads (Sigma) or 50 μl protein A/G beads with 1 μg of the relevant antibody. Beads were washed five times and resuspended in loading buffer. Immunoprecipitated protein was resolved on a sodium dodecyl sulfate-polyacrylamide gel, transferred to a polyvinylidene difluoride membrane, and blotted. Polyclonal anti-N-Myc antibodies and polyclonal anti-Max antibody were purchased from Santa Cruz Biotech.

G2 arrest.

Primary human fibroblast cells were transduced with retrovirus generated by transfecting packaging cells with LPCX, LPC-N-MycERTAM, LPC-N-MycΔMBII-ERTAM, or LPC-N-MycΔMBIV-ERTAM. Transduced cells were selected with 0.8 μg/ml puromycin. Resulting lines were not treated or treated for 48 h with 0.8 μM 4-hydroxytamoxifen (OHT). MEFs were transduced with retrovirus generated by transfecting packaging cells with LXSH, LXSH N-Myc, and LXSH N-MycΔMBIV. Cells were cultured in 0.5% FCS for 12 h. Cells were harvested for FACS analysis by trypsinization, fixed with ethanol, and then stained with propidium iodide using standard staining protocols. Samples were analyzed using the single laser FACScan. Resulting files were analyzed using FlowJo software.

EMSA.

Plates (10-cm diameter) of 293 cells were transfected with 1 μg Cβ S-Max and 1 μg Cβ S FLAG-N-Myc constructs for 2 days and lysed with 1 ml F buffer. Cell extract (2 μl) was mixed with 19 μl electrophoretic mobility shift assay (EMSA) buffer (20 mM Tris, pH 8.4, 50 mM KCl, 3 mM MgCl2, 1 mM dithiothreitol, 1 mM β-mercaptoethanol, 8% glycerol) and 1 μg salmon sperm DNA for 30 min at room temperature. Double-stranded, end-labeled probe (0.2 ng) (GATCCGTAAGACCACGTGGTCGTCAGGATC; bold type indicates the Myc/Max consensus binding site) was added for 30 min at room temperature. Complexes were identified by incubating 0.2 μg of the relevant polyclonal antibody with the reaction mixtures and assaying for a supershift or loss of band. Complexes were separated on 5% acrylamide 0.5× Tris-borate-EDTA-polyacrylamide gels run at 250 V at 4°C and visualized by phosphorimager. Bands were quantitated using ImageQuant software.

ChIP.

Chromatin immunoprecipitations (ChIPs) were carried out using an Upstate chromatin immunoprecipitation assay kit according to the manufacturer's instructions. PCR was carried out on resultant DNA samples using the following primer pairs: NME1, TGCTGAGAGGGAAAGGAGACAGG and TCAGCAAGCACCGCCGAAGTACC; NPM1, GGCCTACCTCACACTGTTGGAGG and TGAAGGTTGGCAAGAGTCGTAGAGC; CAD, CACTGGAACCAAGCAAACACC and AAGGTTGCTGCTGTGGAACTACC; HSP60, ACGAGACACTCACCATGACTTACG and TAGAAAGTGCTCCCCTTTTCTTC; RUVBL1, ACCCTTGCTGGCTAATGTGATCCT and AGATTGAGGAGGTGAAGAGCACCA; and p27, CGAAGCTTCAGTGATCAAGTGTACTGG and CCTTAAGAGCGCGCTCGCCAGC. IPs were carried out using polyclonal anti-N-Myc antibody (Santa Cruz) and monoclonal anti-CBP antibody (Lab Vision).

Microarrays.

Human BJ fibroblasts were stably transduced with hygromycin retrovirus constructs encoding LXSH N-MycWT, N-MycΔMBII, N-MycΔMBIV, or empty vector. Polyclonal cultures were expanded for the minimum time to reach two 15-cm dishes of subconfluent, log-phase cells. RNA was harvested by using an RNAeasy kit, and the RNA integrity and concentration were verified by gel electrophoresis. An independent culture of log-phase BJ cells was used to prepare a standard control RNA. The experimental and control RNAs were directly converted to cDNA with either Cy5- or Cy3-modified dCTP using an Agilent Technologies fluorescent direct label kit. Each Cy5-labeled experimental cDNA was mixed with a constant amount of control Cy3-labeled cDNA prepared from asynchronously growing, untransfected BJ fibroblasts and hybridized overnight to Agilent Human 1A version 2 oligonucleotide microarrays. Microarrays were washed and processed according to the supplier. Slides were scanned using a Genepix4000B (Axon Instruments). Only genes with a signal >20% above background and with at least 70% good data across the arrays were considered for further analysis. The data were centered to the average of the two vector-only arrays and filtered for average changes in signal for either N-MycWT or mutants that were above the threshold indicated. The microarray data for this study are fully accessible at https://genome.unc.edu.

RESULTS

The Myc family proteins have many conserved domains, some of which are conserved in the most distant Drosophila homolog, such as MBII and the DNA binding domain (25). Other domains within the Myc family are conserved only in vertebrates, such as amino acids 317 to 337 of murine N-Myc (Fig. 1). This segment of N-Myc is conserved in N-Myc, c-Myc, and L-Myc proteins from humans to zebra fish (Fig. 1). To study the function of this domain, it was deleted in murine N-Myc, and the mutant was introduced into a selection of cell systems to compare its activity to that of wild-type Myc. We designated this domain Myc homology box IV (MBIV). Throughout this paper, N-MycΔMBIV is also compared to the well-established loss-of-function deletion mutant N-MycΔMBII.

FIG. 1.

FIG. 1.

Diagram of the murine N-Myc deletion mutant, N-MycΔMBIV, used in this study. The positions of Myc box I (MBI), MBII, MBIII, basic region, helix-loop-helix (HLH), and leucine zip (LZ) are also indicated. The lower panel shows an alignment of c-Myc, N-Myc, and L-Myc from a variety of species in the vicinity of the murine N-MycΔMBIV domain. Amino acids highlighted in black are the same, and those in gray are similar.

N-MycΔMBIV is normal for induction of proliferation but defective for apoptosis.

Accelerated rates of cell proliferation and apoptosis are well-characterized responses to Myc expression. The myc null fibroblast cell line HO15.19 was used to investigate the ability of N-MycΔMBIV to induce proliferation and apoptosis without the complication of endogenous c-Myc (38). N-MycWT and mutants were introduced into myc null fibroblasts by retroviral infection, and pools were selected. Equivalent amounts of N-MycΔMBIV protein and N-MycWT protein were expressed, demonstrating that this mutation does not affect protein synthesis or turnover rate (Fig. 2A). Like N-MycWT, N-MycΔMBIV was found to be nuclear by subcellular fractionation, demonstrating that the deletion does not modulate the normal localization of N-Myc (Fig. 2A).

FIG. 2.

FIG. 2.

N-MycΔMBIV is normal for cell proliferation. (A) myc null fibroblasts HO15.19 were infected with retroviruses expressing FLAG-N-MycWT, FLAG-N-MycΔMBII, and FLAG-N-MycΔMBIV, and pools were selected. Myc protein was immunoprecipitated from equivalent amounts of cell extracts using anti-FLAG antibody. Protein was detected by Western blotting using a polyclonal anti-N-Myc antibody. Cells were also separated into nuclear and cytosolic fractions. Material from an equivalent amount of cells was immunoblotted for N-Myc, RNA polymerase II, and tubulin. (B) The proliferation rate of log-phase cells growing in 10% FCS was measured by cell counts after 2 × 104 cells were seeded in six-well plates. Cells were trypsinized and counted each day. Cell counts were normalized to cells counted on the first day after plating. The experiment was repeated twice, and error bars show the standard deviation from the mean. At day 5, both N-MycWT and N-MycΔMBIV were found to be statistically different from vector, with P values of 0.006 and 0.01, respectively. N-MycWT and N-MycΔMBIV were found to be statistically indistinguishable, with a P value of 0.13. (C) The proliferation rate of log-phase cells growing in 10% FCS was measured by CFSE staining. The same cells used in panel B were stained with CFSE, a cell-permeable inert dye. FACS analysis was used to measure the CFSE concentration per cell on day 1, day 2, and day 3, indicated by the number above the peaks. (D) Mean CFSE loss per day was calculated for an experiment lasting 3 days and performed twice. Error bars show the standard deviation. CFSE loss is proportional to cell proliferation because the dye is diluted as the cells divide. A t test was performed on these data. Both N-MycWT and N-MycΔMBIV values were found to be statistically different from vector values, with P values of 0.007 and 0.009, respectively. N-MycWT and N-MycΔMBIV values were found to be statistically indistinguishable, with a P value of 0.9.

The cell proliferation rate was measured by two methods. First, cell counts were made on sequential days (Fig. 2B). Myc null fibroblasts were found to proliferate with a doubling time of 45 h, and myc null fibroblasts reconstituted with N-MycWT had a doubling time of 23 h, in line with previously published data (32, 38). N-MycΔMBIV-expressing cells also had the same 23-h doubling time as N-MycWT. N-MycΔMBII-expressing cells were partially defective for proliferation, having a doubling time of about 30 h, consistent with previous results with c-Myc (10). The proliferation rate was independently measured by CFSE cell staining. At the start of the assay, cells were stained with this inert, fluorescent dye, and FACS analysis was used to measure cell fluorescence on three subsequent days. Proliferation is proportional to the rate of fluorescence loss, because the CFSE is diluted as the cells divide (44, 45). The mean CFSE loss per day was 1.9-fold for the vector control cells (Fig. 2C and D). This value is higher than the dilution expected for a 45-h doubling time, because some dye is also lost by leakage and bleaching. N-MycWT- and N-MycΔMBII-expressing cells had daily CFSE losses of 2.8-fold and 2.3-fold, respectively, correlating with their doubling times of 23 h and 30 h, respectively (43). N-MycΔMBIV-expressing cells had a daily CFSE loss of 2.8-fold (Fig. 2C and D), and therefore this mutant induces a proliferation rate indistinguishable from N-MycWT-expressing cells in two independent assays. Loss of CSFE staining was uniform across the cell population, indicating that all cells proliferate at the same rate and that there are no growth-arrested cells in the population.

The ability of N-MycΔMBIV to induce apoptosis following serum deprivation was also measured. Apoptosis was quantitated by measuring the proportion of cells with sub-G1 DNA content by PI staining and FACS analysis (Fig. 3). After 24 h of serum deprivation, 22% of MycWT cells had a sub-G1 DNA content, whereas vector control and N-MycΔMBII cells were largely resistant to apoptosis, with values of 3.6% and 6.1%, respectively. Interestingly, the N-MycΔMBIV cells were also resistant to apoptosis induced by serum deprivation, with only 7.2% cells having sub-G1 DNA content.

FIG. 3.

FIG. 3.

N-MycΔMBIV is defective for serum deprivation-induced apoptosis. myc null fibroblasts expressing FLAG-N-MycWT, FLAG-N-MycΔMBII, and FLAG-N-MycΔMBIV were maintained in 0.1% FCS for 24 h. (A) Cells were fixed and PI stained, and FACS analysis was used to measure the number of cells with sub-G1 DNA content. (B) The experiment was performed twice, and the mean number of cells with sub-G1 DNA content was calculated. Error bars show the standard deviation.

N-MycΔMBIV is defective for some transformation assays.

Exogenous Myc expression in primed cell systems can induce cell transformation. Since each transformation assay models subtly different aspects of tumorigenesis, we used four different well-established Myc transformation assays to determine the ability of N-MycΔMBIV to induce cell transformation: the REF-based Ras/Myc focus formation assay, the Rat-1a soft agar assay, the Rat-1a focus formation assay, and the RK3E focus formation assay.

In the REF-based Ras/Myc focus formation assay, rat embryo fibroblasts are transfected with H-rasG12V and myc. Cooperation between these oncogenes results in foci on the cell monolayer (31). We transfected REFs with H-rasG12V and either vector control, N-mycWT, N-mycΔMBII, or N-mycΔMBIV. After 10 days, foci were counted and normalized for transfection efficiency (Fig. 4A). N-mycWT and N-mycΔMBIV induced equivalent numbers of foci, whereas N-mycΔMBII was defective, as previously reported (43).

FIG. 4.

FIG. 4.

N-MycΔMBIV is defective in some cell transformation assays. (A) REFs isolated from 15-day rat embryos were transfected with H-RasG12V and N-MycWT, N-MycΔMBII, or N-MycΔMBIV. At day 10, foci were counted from three independent plates and normalized for transfection efficiency. The graph shows foci formed relative to N-MycWT (set as 100), and error bars indicate standard error. (B) Rat-1a fibroblasts expressing N-MycWT, N-MycΔMBII, and N-MycΔMBIV were plated in soft agar for 12 days. Colonies larger than 50 μm were counted from five fields for each of three wells. The graph shows colonies formed relative to N-MycWT, and error bars indicate the standard error. (C) Representative phase-contrast micrographs of soft agar colonies. (D) RK3E cells were infected with N-MycWT or N-MycΔMBIV. Parallel plates were maintained for 3 weeks, and cells were stained with methylene blue. At day 18, foci were counted from two independent plates and normalized for transfection efficiency. The graph shows foci formed relative to N-MycWT (set as 100), and error bars indicate standard error for two independent experiments. (E) Rat-1a fibroblasts (104) expressing N-MycWT, N-MycΔMBII, and N-MycΔMBIV were mixed with 2 × 106 Rat-1a cells and plated in 10-cm plates. Cultures were maintained in triplicate for 10 days, and cells were stained with methylene blue. The graph shows foci formed relative to N-MycWT (set as 100), and error bars show the standard deviation. (F) Photograph showing representative stained plates.

In the soft agar assay, Rat-1a fibroblasts are cultured in suspension in soft agar, and fibroblasts expressing exogenous Myc are able to grow into colonies while vector control cells are not (53). We infected Rat-1a fibroblasts with N-mycWT, N-mycΔMBII, N-mycΔMBIV, or vector control and drug selected stable cell lines. Again, we found that expression levels of these proteins were comparable (not shown). When plated in soft agar, N-mycWT and N-mycΔMBIV induced equivalent numbers of colonies larger than 50 μm, whereas N-mycΔMBII was defective (Fig. 4B). There were also no qualitative or kinetic differences between the appearances of the N-mycWT- and N-mycΔMBIV-induced colonies (Fig. 4C).

Rat-1a cells can also be used for a focus formation assay. At confluence, Rat-1a cells form a tight monolayer, and expression of exogenous Myc allows cells to pile up into foci. We used the same cells as for the soft agar assay and assayed for focus formation when cells expressing N-Myc were plated at low density in a field of nontransformed cells (see Materials and Methods). Surprisingly, we found that N-MycWT-expressing cells formed foci, whereas N-MycΔMBIV-expressing cells did not (Fig. 4E and F). This was unexpected, since N-mycΔMBIV was fully active in focus formation in cooperation with H-rasG12V and in soft agar colonies.

In the rat RK3E cell transformation assay, exogenous Myc expression induces E1A-immortalized rat kidney cells to grow in well-defined foci on a monolayer (21). RK3E cells were infected with retroviral vectors expressing either nothing, N-MycWT, or N-MycΔMBIV. As with the myc null fibroblasts, the expression levels of N-MycWT and N-MycΔMBIV were comparable (not shown). Parallel cultures of RK3E cells were either left to grow to confluence and maintained for 3 weeks to allow focus formation or selected for the hygromycin resistance gene on the expression vector to assay for infection efficiency. Cells expressing N-MycWT but not the vector control became transformed, piling up into foci. Expression of N-MycΔMBIV also resulted in focus formation but with only 40% of the efficiency of N-MycWT (Fig. 4D). These data, while not as dramatic as the defect for Rat-1a focus formation, are consistent with a defect for N-MycΔMBIV in Myc-dependent focus formation in monolayer culture in the absence of an H-rasG12V oncogene.

In summary, N-MycΔMBIV has activity equivalent to N-MycWT in the REF focus and Rat-1a soft agar assays but is defective in the Rat-1a and RK3E focus assays. The differential activities of N-MycΔMBIV in the latter assays suggest that this mutant can transform cells but is defective for some activities demanded by more stringent assays.

MycΔMBIV is hyperactive for G2 arrest.

Myc is well established as driving proliferation in many cell systems; however, in primary cells, expression of Myc can induce a G2 growth arrest (19). To assess the impact of our Myc mutants on G2 arrest, we created estrogen receptor (ER) fusion proteins for each and stably introduced them into human BJ fibroblasts. In estrogen receptor fusions, MycER is inactive until the addition of the ligand OHT (17, 34). After 48 h of tamoxifen addition, the proportion of cells in each phase of the cell cycle was measured by PI staining and FACS analysis (Fig. 5A, two representative experiments). As previously reported, MycWT induces a readily measurable G2 arrest that is dependent on activation of the MycWT-ER protein by tamoxifen in this system. Also consistent with previous reports, the MycΔMBII mutant fails to induce a G2 arrest. Surprisingly, the MycΔMBIV mutant was considerably more active at inducing a G2 arrest than MycWT. Comparable stimulation of G2 arrest was observed in three independent experiments.

FIG. 5.

FIG. 5.

MycΔMBIV is hyperactive for G2 arrest. (A) BJ fibroblasts were infected with retroviruses expressing N-MycWT-ER, N-MycΔMBII-ER, N-MycΔMBIV-ER, or empty vector, and polyclonal cultures were selected. Cells were treated with tamoxifen (OHT) for 48 h or left untreated. Two representative experiments are shown. (B) Mouse embryonic fibroblasts were infected with retroviruses expressing N-MycWT (middle panel), N-MycΔMBIV (right panel), or empty vector (left panel), and polyclonal cultures were selected. Cells were cultured in 0.5% serum for 12 h. Cells were fixed and stained with PI, and the DNA content was determined by FACS analysis. The FACS profiles are shown, and the fraction of cells in each phase of the cell cycle is listed in the table insets.

We also investigated Myc-induced G2 accumulation in mouse embryonic fibroblasts. MEFs were infected with N-mycWT, N-mycΔMBIV, and control vectors. Log-phase cells grown in 10% FCS had equivalent FACS profiles (not shown). After 12 h of serum starvation, N-MycWT-expressing cells had a small but reproducible increase in the proportion of cells in G2. Consistent with the observation in human fibroblasts, N-MycΔMBIV-expressing cells had reproducibly more cells in G2 than MycWT (Fig. 5B).

N-MycΔMBIV is partially defective for transactivation and repression.

N-MycΔMBIV is normal for induction of cell proliferation, defective for induction of apoptosis and in some transformation assays, and hyperactive for G2 arrest. We wanted to understand the modulation of these cell phenotypes in terms of Myc target gene activation and repression. Myc is a transcription factor, and previous studies have shown that the expression of Myc activates and represses a large number of genes by both direct and indirect mechanisms (14, 58).

To compare the differential effects of N-MycWT, N-MycΔMBIV, and N-MycΔMBII on gene regulation, we extracted RNA from human BJ fibroblasts stably expressing these proteins and analyzed them by hybridization to Agilent Technologies 21K Oligo microarray (representing 15,463 unique unigene clusters). Equivalent Myc protein expression in these cell lines was established by Western blotting (Fig. 6A). Duplicates of each sample were hybridized, and the number of genes with a minimum change (n-fold) above several arbitrarily defined thresholds was calculated for each cell line (Fig. 6B and C). Genes were considered to be Myc responsive if they were activated or repressed by 1.5-fold or more compared to the vector control in the average of two arrays.

FIG. 6.

FIG. 6.

Microarray analysis of N-Myc-induced gene expression. (A) Human fibroblasts (BJ) were infected with retroviruses expressing FLAG-N-MycWT, FLAG-N-MycΔMBII, and FLAG-N-MycΔMBIV, and pools were selected. Protein was detected by Western blotting using a polyclonal anti-N-Myc antibody and antitubulin antibody. (B) Graph of the number of genes activated or repressed by N-MycWT, N-MycΔMBIV, or N-MycΔMBII in human BJ fibroblasts at the cutoffs (n-fold) indicated. (C) Cluster analysis of genes activated or repressed 1.5-fold by N-Myc. The signals from duplicate arrays were averaged and normalized to the vector control. Genes were filtered for an average response 1.5-fold or greater for N-MycWT, N-MycΔMBII, or N-MycΔMBIV. The resulting data set was then clustered using Cluster 3.0. Each row represents a specific gene, and adjacent columns derive from duplicate arrays.

We found that the cells expressing N-MycWT showed increased expression of ∼1,500 genes >1.5-fold and ∼390 genes >2-fold. Among the activated genes were many previously described direct Myc targets (www.myc-cancer-gene.org), including ornithine decarboxylase, prothymosin, and nucleolin (see Table S1 in the supplemental material). We also found that many ribosomal protein genes (47 different genes) and genes encoding mitochondrial ribosomal proteins (20 different genes) were upregulated (6). N-MycΔMBIV upregulated significantly fewer genes than MycWT (Fig. 6B), i.e., 1,000 genes >1.5-fold and 160 genes >2-fold.

Repression by Myc proteins paralleled activation, with the cells expressing N-MycWT showing decreased expression of a larger number of genes (∼1,050 genes >1.5-fold and ∼260 genes >2-fold) than the cells expressing N-MycΔMBIV (∼500 genes >1.5-fold and ∼100 genes >2-fold). Thus, N-MycΔMBIV appears to be equally defective for gene activation and repression. N-MycΔMBIV did not appear to regulate a different set of genes than N-MycWT, because on average 70 to 80% of N-MycΔMBIV-regulated genes were also regulated by N-MycWT. This degree of overlap within this experimental system strongly indicates that N-MycΔMBIV regulates mainly a subset of the N-MycWT-regulated genes.

We were interested to know if we could account for the phenotypes of the N-MycΔMBIV and N-MycΔMBII mutants by examining the gene families they regulate. Sorting of the activated and repressed genes for N-MycWT and N-MycΔMBIV into functional categories by GO::TermFinder analysis did not reveal any significant differences between the functions of the regulated genes on a global scale (9). N-MycWT did not regulate additional gene families compared to N-MycΔMBIV; it simply regulated a larger number of genes in each family (data not shown).

Clustering of the regulated genes for the arrays revealed the profile of gene activation and repression for each N-Myc protein (Fig. 6C). Consistent with the overall number of genes that are activated and repressed, the general profiles are very similar between N-MycWT and N-MycΔMBIV. However, blocks of genes that were activated or repressed only by N-MycWT and not by N-MycΔMBIV are evident (see Tables S1 and S2 in the supplemental material). We infer that the genes that differ between N-MycWT and N-MycΔMBIV are likely candidates to play a role in apoptosis, transformation, and G2 arrest. A list of genes that are differentially regulated by N-MycWT and N-MycΔMBIV and that also have a potential role in cell growth and differentiation is shown in Table 1. Noteworthy genes include the established Myc target genes that mediate transformation: CDCA7 (JPO1) (48), which is activated by N-MycWT but more weakly by N-MycΔMBIV, and MTA1 (59), which is activated more strongly by N-MycΔMBIV. SHMT2, which mediates part of the proliferative activity of Myc (42), is activated by both N-MycWT and N-MycΔMBIV. Analysis to date has not revealed any one particular gene from this list to be responsible for the phenotypes of N-MycΔMBIV, and it may be that the coordinate regulation of a combination of these genes is necessary for each phenotype.

TABLE 1.

Candidate genes that are differentially activated or repressed by N-MycWT and N-MycΔMBIV

Gene activation and name Function Accession no.
Activated genes
    Bit1 Bcl-2 inhibitor of transcription NM_016077
    MAP3K14 Mitogen-activated protein kinase kinase kinase 14 NM_003954
    BCOR BCL6 corepressor NM_017745
    DMC1 Dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) NM_007068
    BCL11B B-cell leukemia/lymphoma 11B (zinc finger protein) NM_022898
    CIDEA Cell death-inducing DFFA-like effector a BC031896
    ETV4 Ets variant gene 4 (E1A enhancer binding protein, E1AF) NM_001986
    TIMM22 Translocase of inner mitochondrial membrane 22 homolog (yeast) NM_013337
    DUSP4 Dual specificity phosphatase 4 NM_001394
    PIM1 Pim-1 oncogene NM_002648
    MAP4K1 Mitogen-activated protein kinase kinase kinase kinase 1 U66464
    T3JAM TRAF3-interacting Jun N-terminal kinase-activating modulator NM_025228
    CDCA7/JPO1 Cell division cycle-associated 7 NM_031942
    MTA1 Metastasis-associated 1 U35113
Repressed genes
    AIM1L Absent in melanoma 1-like NM_017977
    TDE1 Tumor differentially expressed 1 NM_006811
    DUSP15 Dual specificity phosphatase-like 15 NM_080611
    SOCS5 Suppressor of cytokine signaling 5 NM_144949
    GDDR Downregulated in gastric cancer AF494509
    DKK1 Dickkopf homolog 1 (Xenopus laevis) NM_012242
    NEK7 NIMA (never in mitosis gene a)-related kinase 7 NM_133494
    TRADD TNFRSF1A-associated via death domain NM_153425
    DLC1 Deleted in liver cancer 1 NM_024767

The profile for N-MycΔMBII was very different from that of the other N-Myc proteins, indicating a general defect in both activation and repression of cellular genes. N-MycΔMBII activated only 167 genes >1.5-fold and 16 genes >2-fold. Repression was similarly defective, with only 212 genes repressed >1.5-fold and 21 genes repressed >2-fold. These values range from 5 to 20% of the number of N-MycWT-regulated genes. The vast majority of genes activated or repressed by N-MycWT and N-MycΔMBIV were only weakly activated or repressed by N-MycΔMBII. However, from a careful inspection of the profiles it is important to note that most of the genes that were regulated by N-MycWT were also regulated to a limited degree by N-MycΔMBII compared to the vector control, except that the extent of activation or repression was severely blunted and no longer passed the threshold of significance criteria. Even genes that continue to pass the threshold cutoff were almost always activated or repressed to a lesser extent than by MycWT (see Table S3 in the supplemental material).

N-MycΔMBIV is defective for DNA binding in vitro.

The microarray gene activation profile indicated that a differential effect on cellular gene regulation was the basis for the distinct phenotype of the N-MycΔMBIV mutant. In particular, N-MycΔMBIV was deficient in both activating and repressing approximately 40% of the genes that were responsive to N-MycWT. These data suggested that N-MycΔMBIV might have an altered interaction with chromosomal binding sites and/or nuclear cofactors. To explore these possibilities, we assessed the ability of this mutant to bind to DNA and to recruit nuclear factors.

The most direct mechanism by which Myc is known to transactivate gene expression is by binding to the TRRAP complex, thereby recruiting histone acetyltransferase activity to promoters (39, 40). We first investigated whether N-MycΔMBIV could bind to TRRAP by coimmunoprecipitation. As previously published, TRRAP can be coimmunoprecipitated with N-MycWT but not N-MycΔMBII using an anti-Myc antibody (Fig. 7A). There was no detectable difference in TRRAP binding between N-MycΔMBIV and N-MycWT, consistent with previous mapping of the TRRAP binding domain to the MBI and MBII regions, which are identical in these proteins.

FIG. 7.

FIG. 7.

N-MycΔMBIV is defective for DNA binding. 293 cells were transfected with FLAG-N-MycWT, FLAG-N-MycΔMBII, and FLAG-N-MycΔMBIV. (A) Immunoprecipitation was carried out using an anti-FLAG antibody. Precipitated protein was detected by Western blotting using an anti-TRRAP antibody in the upper panel and an anti-N-Myc antibody in the lower panel. (B) Experiments were as described for panel A except precipitated protein was detected by anti-N-Myc antibody in the middle panel and anti-Max antibody in the lower panel. (C) EMSA was performed using the same cell extracts and 32P-labeled CACGTG as a probe. The right panel shows EMSA with anti-FLAG supershift (arrow indicates supershifted bands). Bands were visualized by phosphorimager. (D) The EMSA bands were quantitated, and average N-Myc/Max band intensity was calculated. Error bars show the standard deviation from three independent experiments.

Although N-MycΔMBIV is not part of the minimal functional DNA binding domain, it maps closest to this domain along the linear sequence. We therefore assessed whether Max binding and/or DNA binding was compromised in the N-MycΔMBIV mutant. We assayed for Myc-Max binding by coimmunoprecipitation. N-MycWT, N-MycΔMBII, and N-MycΔMBIV were expressed at comparable levels (Fig. 7B, upper panel), and immunoprecipitation of N-Myc led to coprecipitation of comparable levels of Max protein (Fig. 7B, lower panel). We next analyzed the DNA binding affinity of N-Myc/Max complexes by EMSA using the Myc binding site GACCACGTGGAC (bold indicates the Myc/Max consensus binding site) as a probe (Fig. 7C). N-MycWT and N-MycΔMBII formed Myc/Max complexes on GACCACGTGGAC with similar intensities, whereas the N-MycΔMBIV/Max band was reproducibly much weaker. Incubation of the EMSA reactions with anti-FLAG antibody supershifted the Myc/Max complexes, confirming their identity. Quantitation of three independent experiments revealed that N-MycΔMBIV DNA binding was reduced to only 20% of the affinity of N-MycWT (Fig. 7D). This reduced DNA binding activity is most likely the cause of the defect in gene activation and repression by the N-MycΔMBIV mutant.

N-MycΔMBIV displays defects in DNA binding to some Myc targets.

To establish that N-MycΔMBIV is defective for DNA binding in vivo as well as in vitro, we measured N-MycWT and N-MycΔMBIV binding to the promoters of a group of Myc-regulated genes by using ChIP (8). We measured Myc binding to two genes equivalently upregulated by N-MycWT and N-MycΔMBIV (NME1 and NPM1) and three genes with reduced activation by N-MycΔMBIV (CAD, HSP60, and RUVBL1) (Fig. 8A). We also measured Myc binding to Myc-repressed gene p27.

FIG. 8.

FIG. 8.

N-MycΔMBIV is defective for DNA binding in vivo. (A) Relative expression levels of Myc target genes NME1, NPM1, CAD, HSP60, and RUVBL1. Values were extracted from array data (Fig. 6), and error bars show standard deviation. (B) ChIP was performed on myc null fibroblasts expressing N-MycWT and N-MycΔMBIV or vector control using anti-N-Myc antibody or antibody control. PCR was performed using primers specific for NME1, NPM1, CAD, HSP60, RUVBL1, and p27 promoters, as indicated, on DNA precipitated with anti-N-Myc antibody (upper panel) or control antibody (middle panel) and on 1% of the IP input material (lower panel). PCR signal was quantitated by incorporation of a labeled primer. Quantitated PCR bands were normalized first to input PCR and then to vector control cells. Error bars show the standard deviation.

A polyclonal anti-N-Myc antibody was used to immunoprecipitate N-Myc from myc null cells expressing N-MycWT, N-MycΔMBIV, or vector control. We confirmed that this antibody was able to immunoprecipitate both N-Myc proteins equivalently (data not shown). The resultant coprecipitated DNA or DNA from 1% of the IP input material was used as a template for PCR using primers directed to the promoter E-boxes of the Myc-upregulated genes (Fig. 8B). The promoter of a Myc-repressed gene (p27) was also included, because although repressed genes do not have Myc consensus binding sites, some have been found to weakly bind to Myc (37). For the genes expressed equivalently in response to both N-MycWT and N-MycΔMBIV, NME1 and NPM1, Myc binding was found to be equivalent. For the genes with reduced expression in response to MycΔMBIV (CAD, HSP60, and RUVBL1), N-MycΔMBIV bound more weakly than N-MycWT, despite both Myc proteins being expressed at similar levels (Fig. 2A). N-MycΔMBIV also bound more weakly than N-MycWT to the p27 promoter. Quantitation of the PCRs, followed by normalization against input material, showed that the CAD promoter had the most differential Myc binding, with N-MycWT binding >5-fold over background, compared to N-MycΔMBIV, which bound only 2-fold over background (Fig. 8B, lower panel). We infer that subtle differences in the individual promoters govern the relative binding of N-MycWT and N-MycΔMBIV.

CBP is a c-Myc cofactor which binds to the c-Myc C terminus and is recruited to c-Myc target genes (55). Since N-MycΔMBIV is defective for DNA binding and the deletion maps near where CBP was reported to bind to c-Myc, we wanted to determine whether CBP recruitment to target genes is reduced by this mutant. ChIP was performed using the same cell lines as above, and complexes were immunoprecipitated using an anti-CBP antibody. When PCR was performed on the CBP-coprecipitated promoters, N-MycWT and N-MycΔMBIV were found to stimulate recruitment of CBP to Myc-regulated gene promoters by equivalent amounts (see Fig. S1 in the supplemental material). Therefore, N-MycΔMBIV is not defective for gene activation because it is defective for CBP recruitment.

DISCUSSION

In this paper, we characterize a previously unstudied domain of Myc that is highly conserved in evolution and which we designate MBIV. Myc protein lacking MBIV is defective for induction of apoptosis and in some transformation assays but is hyperactive for G2 arrest. Although this domain is not part of the previously described minimal DNA binding domain of Myc, we show here that it is required for maximal DNA binding and gene expression. MBIV is well conserved in c-Myc, N-Myc, and L-Myc and across all vertebrates. In particular, the sequence QHNYAA is invariant in all three Myc proteins from humans to fish, implying an important function for the domain. The primary sequence does not readily indicate its function, being a mixture of amino acids from different classes.

The MBIV domain is necessary for maximal DNA binding.

Since the structure has not been solved for any of the full-length Myc proteins, little can be said about the secondary structure or the position of the MBIV domain in the tertiary structure. Following the observation that c-Myc was a DNA binding protein, the minimal DNA binding domain was deduced from comparison with other bHLH proteins (4, 5). The crystal structure of the Myc/Max DNA binding domains in association with a consensus DNA sequence is known, but the MBIV region was not included (41). Here we demonstrate that although MBIV lies outside this minimal DNA binding domain, it is necessary for full Myc DNA binding activity within the intact protein. The only known protein with a direct role in Myc DNA binding activity is Max, but we find that Max dimerization is unaffected by the MBIV deletion. Since MBIV lies just upstream of the bHLH domain in the primary amino acid sequence, we suggest that this segment may lie close to the DNA binding domain in the tertiary structure. Deletion of MBIV may alter the structure of the DNA binding domain, or it could change the affinity of Myc for a nuclear cofactor that coordinates with Myc to regulate DNA binding. This putative altered structure or cofactor must exist in the nuclear lysates used for EMSA experiments, since these show reduced DNA binding activity for the mutant (Fig. 7). A nonspecific DNA binding sequence was described for c-Myc, but this sequence is not well conserved in N-Myc and does not map to the conserved MBIV domain (15). Furthermore, the N-MycΔMBIV mutant is localized to the nucleus with the same efficiency as N-MycWT (Fig. 2A). Consistent with a weakened affinity for DNA, N-MycΔMBIV was found to activate and repress significantly fewer genes than N-MycWT. Curiously, despite this markedly weakened DNA binding ability, N-MycΔMBIV retains wild-type activity for cooperation with H-RasG12V and rescue of the proliferation defect in myc null cells. Therefore, a high affinity for DNA is not well correlated with Myc biological activity. Further investigation will be required to determine if there is any distinguishing feature of the promoters of the genes that are not activated or repressed by N-MycΔMBIV.

MBIV is required for apoptosis and some transformation assays.

Microarray analysis showed that N-MycΔMBIV upregulated and repressed about 60% as many genes as N-MycWT. Despite the large aberration in gene expression, cell proliferation was found to be unaffected by this mutation. Either Myc may induce proliferation by redundant pathways or the major proliferative genes may fall mainly within the gene set that is regulated equivalently between N-MycWT and N-MycΔMBIV.

Some transformation assays and apoptosis are defective in cells expressing N-MycΔMBIV and therefore appear to require a more robust Myc target gene response. Either the full complement of Myc target genes required to trigger these pathways is lacking or the genes governing these pathways are not being activated or repressed efficiently enough by N-MycΔMBIV. The N-Myc MBIV domain contrasts with a recently characterized nearby domain, MBIII (28). A Myc MBIII deletion increases apoptosis but decreases transformation. We are currently testing individual genes which are upregulated or downregulated by N-MycWT but not N-MycΔMBIV for the ability to contribute to apoptosis or transformation. However, the coordinated expression of a number of genes may be required to drive these phenotypes.

MycΔMBIV is not a general Myc loss-of-function mutant.

Unlike MycΔMBII, which has been demonstrated here and elsewhere to have a loss of function for almost all Myc phenotypes (18, 19, 23, 29, 53), MycΔMBIV exhibits a gain of function for inducing G2 arrest in primary fibroblasts. No genes appear to be activated or repressed by MycΔMBIV above the levels seen for a MycWT, and therefore the superinduction of a G2 arrest does not appear to be due to simple hyperactivation or repression of a Myc target gene(s). This suggests that the most likely explanation for the exaggerated G2 arrest phenotype is that Myc regulates genes which both drive and oppose G2 arrest. In the case of MycΔMBIV, the genes which oppose G2 arrest may be muted, leaving the genes that drive G2 arrest to dominate.

Myc can induce a complex set of phenotypes in many different cell backgrounds. It remains unclear if the distinct phenotypes are a response to different target genes or a cell context-dependent response to a common target gene set. In the present study, we show that mutation of an evolutionarily conserved Myc domain results in the loss of a subset of target genes which correlates with enhancement and inhibition of different Myc phenotypes. This is in contrast with previously described Myc mutations, which either have no effect on or inhibit Myc phenotypes. The fact that this mutant can reduce Myc-induced apoptosis and transformation but enhance Myc-induced G2 arrest argues that the distinct target genes are involved in different phenotypes. Further analysis may allow the identification of the specific gene or genes involved in transformation or apoptosis.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank Iulia Kotenko and Ruth Kilburn for technical assistance and Steve Fiering for providing valuable resources. We also thank the members of the Cole lab for input into the manuscript.

This work was supported by a grant from the National Cancer Institute to M.D.C. M.L.W. was supported by Howard Hughes Medical Institute Biomedical Research Support Award 76200-560801 to Dartmouth College, American Cancer Society Institutional Award IRG-82-003-17 to the Norris Cotton Cancer Center, and a grant from the V Foundation for Cancer Research. M.L.W. is a V Scholar of the V Foundation for Cancer Research.

Footnotes

Supplemental material for this article may be found at http://mcb.asm.org/.

REFERENCES

  • 1.Armelin, H. A., M. C. Armelin, K. Kelly, T. Stewart, P. Leder, B. H. Cochran, and C. D. Stiles. 1984. Functional role for c-myc in mitogenic response to platelet-derived growth factor. Nature 310:655-660. [DOI] [PubMed] [Google Scholar]
  • 2.Askew, D. S., R. A. Ashmun, B. C. Simmons, and J. L. Cleveland. 1991. Constitutive c-myc expression in an IL-3-dependent myeloid cell line suppresses cell cycle arrest and accelerates apoptosis. Oncogene 6:1915-1922. [PubMed] [Google Scholar]
  • 3.Bhatia, K., K. Huppi, G. Spangler, D. Siwarski, R. Iyer, and I. Magrath. 1993. Point mutations in the c-Myc transactivation domain are common in Burkitt's lymphoma and mouse plasmacytomas. Nat. Genet. 5:56-61. [DOI] [PubMed] [Google Scholar]
  • 4.Blackwell, T. K., L. Kretzner, E. M. Blackwood, R. N. Eisenman, and H. Weintraub. 1990. Sequence-specific DNA binding by the c-Myc protein. Science 250:1149-1151. [DOI] [PubMed] [Google Scholar]
  • 5.Blackwood, E. M., and R. N. Eisenman. 1991. Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science 251:1211-1217. [DOI] [PubMed] [Google Scholar]
  • 6.Boon, K., H. N. Caron, R. van Asperen, L. Valentijn, M. C. Hermus, P. van Sluis, I. Roobeek, I. Weis, P. A. Voute, M. Schwab, and R. Versteeg. 2001. N-myc enhances the expression of a large set of genes functioning in ribosome biogenesis and protein synthesis. EMBO J. 20:1383-1393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bouchard, C., O. Dittrich, A. Kiemaier, K. Dohmann, A. Menkel, M. Eilers, and B. Luscher. 2001. Regulation of cyclin D2 gene expression by the Myc/Max/Mad network: Myc-dependent TRRAP recruitment and histone acetylation at the cyclin D2 promoter. Genes Dev. 15:2042-2047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Boyd, K. E., and P. J. Farnham. 1997. Myc versus USF: discrimination at the cad gene is determined by core promoter elements. Mol. Cell. Biol. 17:2529-2537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Boyle, E. I., S. Weng, J. Gollub, H. Jin, D. Botstein, J. M. Cherry, and G. Sherlock. 2004. GO::TermFinder—open source software for accessing gene ontology information and finding significantly enriched gene ontology terms associated with a list of genes. Bioinformatics 20:3710-3715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bush, A., M. Mateyak, K. Dugan, A. Obaya, S. Adachi, J. Sedivy, and M. Cole. 1998. c-myc null cells misregulate cad and gadd45 but not other proposed c-Myc targets. Genes Dev. 12:3797-3802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cole, M. D. 1986. The myc oncogene: its role in transformation and differentiation. Annu. Rev. Genet. 20:361-385. [DOI] [PubMed] [Google Scholar]
  • 12.Coller, H. A., C. Grandori, P. Tamayo, T. Colbert, E. S. Lander, R. N. Eisenman, and T. R. Golub. 2000. Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion. Proc. Natl. Acad. Sci. USA 97:3260-3265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Conzen, S. D., K. Gottlob, E. S. Kandel, P. Khanduri, A. J. Wagner, M. O'Leary, and N. Hay. 2000. Induction of cell cycle progression and acceleration of apoptosis are two separable functions of c-Myc: transrepression correlates with acceleration of apoptosis. Mol. Cell. Biol. 20:6008-6018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dang, C. V. 1999. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol. Cell. Biol. 19:1-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dang, C. V., H. van Dam, M. Buckmire, and W. M. F. Lee. 1989. DNA-binding domain of human c-Myc produced in Escherichia coli. Mol. Cell. Biol. 9:2477-2486. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Eberhardy, S. R., and P. J. Farnham. 2002. Myc recruits P-TEFb to mediate the final step in the transcriptional activation of the cad promoter. J. Biol. Chem. 277:40156-40162. [DOI] [PubMed] [Google Scholar]
  • 17.Eilers, M., D. Picard, K. R. Yamamoto, and J. M. Bishop. 1989. Chimaeras of myc oncoprotein and steroid receptors cause hormone-dependent transformation of cells. Nature 340:66-68. [DOI] [PubMed] [Google Scholar]
  • 18.Evan, G. I., A. H. Wyllie, C. S. Gilbert, T. D. Littlewood, H. Land, M. Brooks, C. M. Waters, L. Z. Penn, and D. C. Hancock. 1992. Induction of apoptosis in fibroblasts by c-myc protein. Cell 69:119-128. [DOI] [PubMed] [Google Scholar]
  • 19.Felsher, D. W., A. Zetterberg, J. Zhu, T. Tlsty, and J. M. Bishop. 2000. Overexpression of MYC causes p53-dependent G2 arrest of normal fibroblasts. Proc. Natl. Acad. Sci. USA 97:10544-10548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fernandez, P. C., S. R. Frank, L. Wang, M. Schroeder, S. Liu, J. Greene, A. Cocito, and B. Amati. 2003. Genomic targets of the human c-Myc protein. Genes Dev. 17:1115-1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Foster, K. W., S. Ren, I. D. Louro, S. M. Lobo-Ruppert, P. McKie-Bell, W. Grizzle, M. R. Hayes, T. R. Broker, L. T. Chow, and J. M. Ruppert. 1999. Oncogene expression cloning by retroviral transduction of adenovirus E1A-immortalized rat kidney RK3E cells: transformation of a host with epithelial features by c-MYC and the zinc finger protein GKLF. Cell Growth Differ. 10:423-434. [PubMed] [Google Scholar]
  • 22.Frank, S. R., M. Schroeder, P. Fernandez, S. Taubert, and B. Amati. 2001. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev. 15:2069-2082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Freytag, S. O., C. V. Dang, and W. M. F. Lee. 1990. Definition of the activities and properties of c-myc required to inhibit cell differentiation. Cell Growth Differ. 1:339-343. [PubMed] [Google Scholar]
  • 24.Frye, M., C. Gardner, E. R. Li, I. Arnold, and F. M. Watt. 2003. Evidence that Myc activation depletes the epidermal stem cell compartment by modulating adhesive interactions with the local microenvironment. Development 130:2793-2808. [DOI] [PubMed] [Google Scholar]
  • 25.Gallant, P., Y. Shiio, P. F. Cheng, S. M. Parkhurst, and R. N. Eisenman. 1996. Myc and Max homologs in Drosophila. Science 274:1523-1527. [DOI] [PubMed] [Google Scholar]
  • 26.Gregory, M. A., and S. R. Hann. 2000. c-Myc proteolysis by the ubiquitin-proteasome pathway: stabilization of c-Myc in Burkitt's lymphoma cells. Mol. Cell. Biol. 20:2423-2435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Guo, Q. M., R. L. Malek, S. Kim, C. Chiao, M. He, M. Ruffy, K. Sanka, N. H. Lee, C. V. Dang, and E. T. Liu. 2000. Identification of c-myc responsive genes using rat cDNA microarray. Cancer Res. 60:5922-5928. [PubMed] [Google Scholar]
  • 28.Herbst, A., M. T. Hemann, K. A. Tworkowski, S. E. Salghetti, S. W. Lowe, and W. P. Tansey. 2005. A conserved element in Myc that negatively regulates its proapoptotic activity. EMBO Rep. 6:177-183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kenney, A. M., M. D. Cole, and D. H. Rowitch. 2003. Nmyc upregulation by sonic hedgehog signaling promotes proliferation in developing cerebellar granule neuron precursors. Development 130:15-28. [DOI] [PubMed] [Google Scholar]
  • 30.Kim, S. Y., A. Herbst, K. A. Tworkowski, S. E. Salghetti, and W. P. Tansey. 2003. Skp2 regulates Myc protein stability and activity. Mol. Cell 11:1177-1188. [DOI] [PubMed] [Google Scholar]
  • 31.Land, H., L. F. Parada, and R. A. Weinberg. 1983. Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature 304:596-602. [DOI] [PubMed] [Google Scholar]
  • 32.Landay, M., S. K. Oster, F. Khosravi, L. E. Grove, X. Yin, J. Sedivy, L. Z. Penn, and E. V. Prochownik. 2000. Promotion of growth and apoptosis in c-myc nullizygous fibroblasts by other members of the myc oncoprotein family. Cell Death Differ. 7:697-705. [DOI] [PubMed] [Google Scholar]
  • 33.Li, Z., S. Van Calcar, C. Qu, W. K. Cavenee, M. Q. Zhang, and B. Ren. 2003. A global transcriptional regulatory role for c-Myc in Burkitt's lymphoma cells. Proc. Natl. Acad. Sci. USA 100:8164-8169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Littlewood, T. D., D. C. Hancock, P. S. Danielian, M. G. Parker, and G. I. Evan. 1995. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 23:1686-1690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lutterbach, B., and S. R. Hann. 1994. Hierarchical phosphorylation at N-terminal transformation-sensitive sites in c-Myc protein is regulated by mitogens and in mitosis. Mol. Cell. Biol. 14:5510-5522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Malynn, B. A., I. M. de Alboran, R. C. O'Hagan, R. Bronson, L. Davidson, R. A. DePinho, and F. W. Alt. 2000. N-myc can functionally replace c-myc in murine development, cellular growth, and differentiation. Genes Dev. 14:1390-1399. [PMC free article] [PubMed] [Google Scholar]
  • 37.Mao, D. Y., J. D. Watson, P. S. Yan, D. Barsyte-Lovejoy, F. Khosravi, W. W. Wong, P. J. Farnham, T. H. Huang, and L. Z. Penn. 2003. Analysis of Myc bound loci identified by CpG island arrays shows that Max is essential for Myc-dependent repression. Curr. Biol. 13:882-886. [DOI] [PubMed] [Google Scholar]
  • 38.Mateyak, M. K., A. J. Obaya, S. Adachi, and J. M. Sedivy. 1997. Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth Differ. 8:1039-1048. [PubMed] [Google Scholar]
  • 39.McMahon, S. B., H. A. Van Buskirk, K. A. Dugan, T. D. Copeland, and M. D. Cole. 1998. The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94:363-374. [DOI] [PubMed] [Google Scholar]
  • 40.McMahon, S. B., M. A. Wood, and M. D. Cole. 2000. The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Mol. Cell. Biol. 20:556-562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Nair, S. K., and S. K. Burley. 2003. X-ray structures of Myc-Max and Mad-Max recognizing DNA. Molecular bases of regulation by proto-oncogenic transcription factors. Cell 112:193-205. [DOI] [PubMed] [Google Scholar]
  • 42.Nikiforov, M. A., S. Chandriani, B. O'Connell, O. Petrenko, I. Kotenko, A. Beavis, J. M. Sedivy, and M. D. Cole. 2002. A functional screen for Myc-responsive genes reveals serine hydroxymethyltransferase, a major source of the one-carbon unit for cell metabolism. Mol. Cell. Biol. 22:5793-5800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nikiforov, M. A., S. Chandriani, J. Park, I. Kotenko, D. Matheos, A. Johnsson, S. B. McMahon, and M. D. Cole. 2002. TRRAP-dependent and TRRAP-independent transcriptional activation by Myc family oncoproteins. Mol. Cell. Biol. 22:5054-5063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Nikiforov, M. A., I. Kotenko, O. Petrenko, A. Beavis, L. Valenick, I. Lemischka, and M. D. Cole. 2000. Complementation of Myc-dependent cell proliferation by cDNA expression library screening. Oncogene 19:4828-4831. [DOI] [PubMed] [Google Scholar]
  • 45.Obaya, A. J., I. Kotenko, M. D. Cole, and J. M. Sedivy. 2002. The proto-oncogene c-myc acts through the cyclin-dependent kinase (Cdk) inhibitor p27(Kip1) to facilitate the activation of Cdk4/6 and early G(1) phase progression. J. Biol. Chem. 277:31263-31269. [DOI] [PubMed] [Google Scholar]
  • 46.O'Connell, B. C., A. F. Cheung, C. P. Simkevich, W. Tam, X. Ren, M. K. Mateyak, and J. M. Sedivy. 2003. A large scale genetic analysis of c-Myc-regulated gene expression patterns. J. Biol. Chem. 278:12563-12573. [DOI] [PubMed] [Google Scholar]
  • 47.Oster, S. K., D. Y. Mao, J. Kennedy, and L. Z. Penn. 2003. Functional analysis of the N-terminal domain of the Myc oncoprotein. Oncogene 22:1998-2010. [DOI] [PubMed] [Google Scholar]
  • 48.Prescott, J. E., R. C. Osthus, L. A. Lee, B. C. Lewis, H. Shim, J. F. Barrett, Q. Guo, A. L. Hawkins, C. A. Griffin, and C. V. Dang. 2001. A novel c-Myc-responsive gene, JPO1, participates in neoplastic transformation. J. Biol. Chem. 276:48276-48284. [DOI] [PubMed] [Google Scholar]
  • 49.Schreiber-Agus, N., D. Stein, K. Chen, J. S. Goltz, L. Stevens, and R. A. DePinho. 1997. Drosophila Myc is oncogenic in mammalian cells and plays a role in the diminutive phenotype. Proc. Natl. Acad. Sci. USA 94:1235-1240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Schuhmacher, M., F. Kohlhuber, M. Holzel, C. Kaiser, H. Burtscher, M. Jarsch, G. W. Bornkamm, G. Laux, A. Polack, U. H. Weidle, and D. Eick. 2001. The transcriptional program of a human B cell line in response to Myc. Nucleic Acids Res. 29:397-406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Sears, R., F. Nuckolls, E. Haura, Y. Taya, K. Tamai, and J. R. Nevins. 2000. Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev. 14:2501-2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sommer, A., K. Bousset, E. Kremmer, M. Austen, and B. Luscher. 1998. Identification and characterization of specific DNA-binding complexes containing members of the Myc/Max/Mad network of transcriptional regulators. J. Biol. Chem. 273:6632-6642. [DOI] [PubMed] [Google Scholar]
  • 53.Stone, J., T. de Lange, G. Ramsay, E. Jakobovits, J. M. Bishop, H. Varmus, and W. Lee. 1987. Definition of regions in human c-myc that are involved in transformation and nuclear localization. Mol. Cell. Biol. 7:1697-1709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Trumpp, A., Y. Refaeli, T. Oskarsson, S. Gasser, M. Murphy, G. R. Martin, and J. M. Bishop. 2001. c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature 414:768-773. [DOI] [PubMed] [Google Scholar]
  • 55.Vervoorts, J., J. M. Luscher-Firzlaff, S. Rottmann, R. Lilischkis, G. Walsemann, K. Dohmann, M. Austen, and B. Luscher. 2003. Stimulation of c-MYC transcriptional activity and acetylation by recruitment of the cofactor CBP. EMBO Rep. 4:484-490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.von der Lehr, N., S. Johansson, S. Wu, F. Bahram, A. Castell, C. Cetinkaya, P. Hydbring, I. Weidung, K. Nakayama, K. I. Nakayama, O. Soderberg, T. K. Kerppola, and L. G. Larsson. 2003. The F-box protein Skp2 participates in c-Myc proteosomal degradation and acts as a cofactor for c-Myc-regulated transcription. Mol. Cell 11:1189-1200. [DOI] [PubMed] [Google Scholar]
  • 57.Watson, J. D., S. K. Oster, M. Shago, F. Khosravi, and L. Z. Penn. 2002. Identifying genes regulated in a Myc-dependent manner. J. Biol. Chem. 277:36921-36930. [DOI] [PubMed] [Google Scholar]
  • 58.Zeller, K. I., A. G. Jegga, B. J. Aronow, K. A. O'Donnell, and C. V. Dang. 2003. An integrated database of genes responsive to the Myc oncogenic transcription factor: identification of direct genomic targets. Genome Biol. 4:R69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Zhang, X. Y., L. M. Desalle, J. H. Patel, A. J. Capobianco, D. Yu, A. Thomas-Tikhonenko, and S. B. McMahon. 2005. Metastasis-associated protein 1 (MTA1) is an essential downstream effector of the c-MYC oncoprotein. Proc. Natl. Acad. Sci. USA 102:13968-13973. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES