Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2006 Jul;72(7):4638–4647. doi: 10.1128/AEM.00184-06

Phase-Variable Surface Structures Are Required for Infection of Campylobacter jejuni by Bacteriophages

Chris Coward 1,, Andrew J Grant 1,*,, Craig Swift 2, Jennifer Philp 1, Rebecca Towler 1, Mohammad Heydarian 1, Jennifer A Frost 3, Duncan J Maskell 1
PMCID: PMC1489344  PMID: 16820455

Abstract

This study characterizes the interaction between Campylobacter jejuni and the 16 phages used in the United Kingdom typing scheme by screening spontaneous mutants of the phage-type strains and transposon mutants of the sequenced strain NCTC 11168. We show that the 16 typing phages fall into four groups based on their patterns of activity against spontaneous mutants. Screens of transposon and defined mutants indicate that the phage-bacterium interaction for one of these groups appears to involve the capsular polysaccharide (CPS), while two of the other three groups consist of flagellatropic phages. The expression of CPS and flagella is potentially phase variable in C. jejuni, and the implications of these findings for typing and intervention strategies are discussed.


Campylobacter jejuni is a major cause of food-borne gastrointestinal disease in the developed world, with an estimated one in every hundred individuals in both the United States and the United Kingdom developing Campylobacter-related illness each year (19). This places a considerable burden on medical resources, as well as causing great stress and discomfort for the infected individual. Moreover, although most cases are self-limiting, Campylobacter can cause severe postinfection complications, including bacteremia and polyneuropathies such as the Guillain-Barré and Miller-Fisher syndromes. The main routes of infection are considered to be the consumption of contaminated meat (particularly poultry), the ingestion of contaminated water or unpasteurized milk and milk products, contact with pets, and travel. Moreover, a recent study suggests that there may be as-yet-unidentified sources of Campylobacter that significantly contribute to human infection (10).

A greater appreciation of the epidemiology of Campylobacter spp. will require the use of genetic techniques to compare strains isolated from various sources with those causing infections in humans. For convenience, phenotypic methods such as serotyping and phage typing continue to be used to type environmental and human isolates. Sixteen Campylobacter-specific phages are used for the epidemiological typing of C. jejuni and C. coli in the United Kingdom (17). The original phage-typing scheme was described in the United States in 1985 using 14 phages isolated from poultry feces (22) and was later extended to incorporate 5 more phages (31). Six of the original United States phages were combined with 10 virulent phages isolated from various sources in the United Kingdom, including pig and poultry manure and sewage effluent, to form the United Kingdom scheme (46). These 16 phages, all of the Myoviridae family, can be subdivided into three groups according to genome size, ultrastructure, and head size (45). The DNA of these phages is refractory to digestion by a large number of restriction enzymes, and all have icosahedral heads and long contractile, nonflexible tails. To date, 92 phage types have been identified (C. Swift, unpublished observations), a phage type being defined as two or more epidemiologically unrelated Campylobacter isolates giving the same phage reaction pattern (17). Phage lysis as a means to type C. jejuni is used with a very limited understanding of the mechanisms of bacterial resistance or sensitivity to the phage.

C. jejuni colonizes the colon of the broiler chicken to extremely high numbers; chickens reaching the abattoir can carry Campylobacter at 105 to 109 CFU per g of cecal contents (6). Estimates of Campylobacter contamination found on raw chicken sold in the United Kingdom range from 40 to 80% (16). Although improvements in biosecurity help to maintain Campylobacter-negative flocks, once Campylobacter is present in a flock there is evidence for rapid horizontal transfer resulting in infection of almost all of the birds within a few days (39, 55). This, coupled with the low infectious dose of C. jejuni for humans (approximately 500 to 800 organisms) (7), highlights the need for effective intervention strategies within the “farm-to-fork” process to reduce the bacterial load.

Intervention strategies such as competitive exclusion with other organisms or less pathogenic Campylobacter, biosecurity measures, and improved husbandry have all been suggested and used with various degrees of success (50). More recently, there has been a drive to reconsider the use of phage as a means of reducing the bacterial load prior to slaughter (13, 35, 57) or during postprocessing (2, 3, 21). The use of phage as a means to control pathogens is particularly attractive considering the increasing pressure on the veterinary and medical communities to move away from antibiotic therapy. Phages have unique advantages over antibiotics in that they can specifically target a bacterial species and are both self-replicating and self-limiting. More than 170 phages of Campylobacter spp. have been reported (45).

Before phage therapy can be adopted as a means of intervention it will be important to understand phage behavior in a naturally infected flock. Connerton et al. have shown that phage and Campylobacter ecology in a broiler house is complex and may play a significant role in influencing which strains of Campylobacter enter the human food chain (13). In addition, a greater understanding of phage-host interactions and the development of phage resistance in the host will be required before phage can be used as an intervention. To begin to characterize the molecular basis of these interactions, we screened spontaneous mutants of the Campylobacter phage-type strains and transposon mutants of the sequenced strain C. jejuni NCTC 11168 for resistance to the 16 phages used in the United Kingdom typing scheme.

MATERIALS AND METHODS

Bacterial strains, phages, and growth conditions.

Bacterial strains, phages, and plasmids used in the present study are listed in Table 1. C. jejuni was cultured at 42°C on Muller-Hinton (MH) agar (Oxoid, Basingstoke, United Kingdom) supplemented with 5% horse blood (Sigma, Poole, United Kingdom) with 5 μg of trimethoprim/ml under standard microaerophilic conditions (5% O2, 10% CO2, 85% N2) in a MACS VA500 Variable Atmosphere Work Station (Don Whitley Scientific, Shipley, United Kingdom). Escherichia coli strain EC100D pir-116 was grown at 37°C on Luria-Bertani (LB) agar or broth (Oxoid). Campylobacter motility agar was composed of 21 g/liter MH broth (Oxoid) and 0.4% technical agar #3 (Sigma). The media used for the propagation of phage and phage screening were as follows: CBHI, 37 g/liter BHI (Oxoid) supplemented with 1 mmol CaCl2 and 1 mmol MgSO4; CBHIO, CBHI-0.7% Select Agar (Sigma); CPTA, 15 g/liter Nutrient Broth #2 (Sigma)-0.7% Select Agar (Sigma) supplemented with 10 mmol CaCl2 and 1 mmol MgSO4; NZCYM, 22 g/liter NZCYM Broth (Sigma)-1.2% Select Agar (Sigma); and NZCYO, 22 g/liter NZCYM Broth (Sigma)-0.7% Select Agar (Sigma). SM buffer per liter was 5.8 g of NaCl, 2.0 g of MgSO4 · 7H2O, 50 ml of Tris-HCl (pH 7.4), 5.0 ml of 2% gelatin (Sigma), and 945 ml of sterile distilled water. Where necessary for selection, media were supplemented with chloramphenicol (10 μg/ml), ampicillin (100 μg/ml), or kanamycin (25 μg/ml) as appropriate. Long-term storage of bacteria was at −80°C in Microbank vials (Prolab Diagnostics, Neston, United Kingdom).

TABLE 1.

Bacteria, phages, and plasmids

Strain, bacteriophage, or plasmid Relevant characteristicsa Source or referenceb
Strains
    E. coli
        DH5α F (φ80dlacZΔM15) Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rK mK+)supE44 λthi-1 gyrA relA 24
        EC100D pir-116 FmcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λrpsL nupG pir-116 (DHFR) Epicenter Technologies
    Campylobacter sp.
        T1 Phage type strain 1, CRU reference no. C605 CRU
        T2 Phage type strain 2, CRU reference no. C682 CRU
        T5 Phage type strain 5, CRU reference no. C856 CRU
        T14 Phage type strain 14, CRU reference no. C10054 CRU
        T33 Phage type strain 33, CRU reference no. C1873 CRU
        T34 Phage type strain 34, CRU reference no. C13503 CRU
        T36 Phage type strain 36, CRU reference no. C1758 CRU
        T44 Phage type strain 44, CRU reference no. C10131 CRU
        NCTC 11168 Clinical isolate used for genome sequencing 41
        NCTC 12658 Propagating strain for Φ9 CRU
        NCTC 12659 Propagating strain for Φ16 CRU
        NCTC 12660 Propagating strain for Φ7 and Φ13 CRU
        NCTC 12661 Propagating strain for Φ1 and Φ2 CRU
        NCTC 12662 Propagating strain for Φ14 CRU
        NCTC 12663 Propagating strain for Φ4 and Φ12 CRU
        NCTC 12664 Propagating strain for Φ5 and Φ11 CRU
        NCTC 12665 Propagating strain for Φ6 CRU
        NCTC 12666 Propagating strain for Φ8 CRU
        NCTC 12667 Propagating strain for Φ3 CRU
        NCTC 12668 Propagating strain for Φ10 and Φ15 CRU
        11168 motA::cat C. jejuni NCTC 11168 with cat cassette in the motA gene; Cmr This study
        11168 motB::cat C. jejuni NCTC 11168 with cat cassette in the motB gene; Cmr This study
        11168 ΔpflA::cat C. jejuni NCTC 11168 in which pflA gene is deleted and replaced by a cat cassette; Cmr This study
        11168 ΔflhA::cat C. jejuni NCTC 11168 in which flhA gene is deleted and replaced by a cat cassette; Cmr This study
        11168cj1428c C. jejuni hypermotile 11168 with cj1428c::kan insertion; Kmr -
        11168cj1429c C. jejuni hypermotile 11168 with cj1429c::kan insertion; Kmr -
        11168cj1439 C. jejuni hypermotile 11168 with cj1439::kan insertion; Kmr -
        11168kpsM C. jejuni hypermotile 11168 with kpsM::kan insertion; Kmr 30
        AG318 C. jejuni NCTC 11168 with cat cassette in the kpsC gene; Cmr This study
        81-176 Clinical isolate 32
        81-176 motA::cat C. jejuni 81-176 with cat cassette in the motA gene; Cmr This study
        81-176 motB::cat C. jejuni 81-176 with cat cassette in the motB gene; Cmr This study
        81-176 ΔpflA::cat C. jejuni 81-176 in which pflA gene is deleted and replaced by a cat cassette; Cmr This study
        81-176 ΔflhA::cat C. jejuni 81-176 in which flhA gene is deleted and replaced by a cat cassette; Cmr This study
        M1 Environmental isolate D. Newell
        M1 motA::cat C. jejuni M1 with cat cassette in the motA gene; Cmr This study
        M1 motB::cat C. jejuni M1 with cat cassette in the motB gene; Cmr This study
        M1 ΔpflA::cat C. jejuni M1 in which pflA gene is deleted and replaced by a cat cassette; Cmr This study
        M1 ΔflhA::cat C. jejuni M1 in which flhA gene is deleted and replaced by a cat cassette; Cmr This study
Bacteriophages
    Φ1 UK typing phage 1, NCTC 12673 17
    Φ2 UK typing phage 2, NCTC 12674 17
    Φ3 UK typing phage 3, NCTC 12682 17
    Φ4 UK typing phage 4, NCTC 12676 17
    Φ5 UK typing phage 5, NCTC 12678 17
    Φ6 UK typing phage 6, NCTC 12680 17
    Φ7 UK typing phage 7, NCTC 12671 17
    Φ8 UK typing phage 8, NCTC 12681 17
    Φ9 UK typing phage 9, NCTC 12669 17
    Φ10 UK typing phage 10, NCTC 12683 17
    Φ11 UK typing phage 11, NCTC 12679 17
    Φ12 UK typing phage 12, NCTC 12677 17
    Φ13 UK typing phage 13, NCTC 12672 17
    Φ14 UK typing phage 14, NCTC 12675 17
    Φ15 UK typing phage 15, NCTC 12684 17
    Φ16 UK typing phage 16, NCTC 12670 17
Plasmids
    pRY111 Source of cat cassette 60
    pAJG180 pUC19 carrying PCR fragment of region upstream of NCTC 11168 flhA; Apr This study
    pAJG181 pAJG180 carrying cat from pRY111; Apr Cmr This study
    pAJG182 flhA deletion construct; pAJG181 carrying NCTC 11168 cj0881c PCR fragment 3′ to cat; Apr Cmr This study
    pAJG316 pUC19 carrying NCTC 11168 kpsC gene; Apr This study
    pAJG317 kpsC deletion-insertion construct; pAJG316 with cat cassette inserted into kpsC; Apr Cmr This study
    pJP1 pUC19 carrying PCR fragment of NCTC 11168 region upstream of pflA; Apr This study
    pJP2 pJP1 carrying PCR fragment of NCTC 11168 region downstream of pflA; Apr This study
    pBEG000 pUC19 carrying PCR fragment of NCTC 1168 motA gene; Apr This study
    pBEG001 pflA deletion construct; pJP2 with cat cassette inserted into the BamHI site; Apr Cmr This study
    pBEG003 motA insertion construct; pBEG000 with cat cassette inserted into the NcoI site of motA; Apr Cmr This study
    pBEG004 pUC19 carrying PCR fragment of NCTC 11168 motB gene; Apr This study
    PBEG005 motB insertion construct; pBEG004 with cat cassette inserted into the XbaI site of motB; Apr Cmr This study
    pUC19 Cloning vector; Apr 59
a

Cmr, chloramphenicol resistance; Apr, ampicillin resistance; Kmr, kanamycin resistance.

b

-, kindly provided by B. Wren, A. Karlyshev, and G. Thacker, London School of Hygiene and Tropical Medicine. CRU, Campylobacter Reference Unit (Health Protection Agency, Colindale, London, United Kingdom).

Phage propagation.

Phages were propagated essentially as described previously (17). Propagating strains (Table 1) were grown as lawns for 48 h and harvested in CBHI, and the cell density adjusted to MacFarland standard no. 1 (optical density at 550 nm = 0.25). The culture was then incubated microaerophilically with shaking for 4 h, mixed with phage (∼109 PFU/ml) in a 1:1 ratio, and incubated standing microaerophilically for 30 min to allow the phage to adsorb. Then, 1 ml of adsorbed suspension was mixed with 5 ml of molten NZCYO tempered to 50°C and poured into a 90-mm petri dish previously prepared with 25 ml of solid NZCYM. The agar was allowed to set, and the plates were incubated uninverted overnight at 42°C in microaerophilic conditions. Subsequently, 5 ml of SM buffer was applied to the agar, followed by incubation at 4°C overnight on a rotary shaker (100 rpm). The phage-containing SM buffer was aspirated, and the plates were washed with a further 1 ml of SM buffer. The phage suspension was sterilized by filtration through 0.2-μm-pore-size filters (Sartorius, Hannover, Germany).

Selection of spontaneous Campylobacter mutants resistant to a typing phage.

Isolation plates were prepared by applying 1 ml of phage suspension (∼108 PFU/ml) onto the surface of a CPTA agar plate using a sterile disposable spreader. After drying, a single colony of the Campylobacter type strain of interest was spread onto the surface with a sterile disposable loop and incubated at 37°C in microaerophilic conditions for 24 h. Growth from this plate was then subcultured for 24 h on a fresh plate. Five putatively resistant colonies were picked from this plate and subcultured once more to ensure single isolates were obtained. Phage sensitivity of the resultant strain was then assessed by applying phage at a routine test dilution (ca. 106 to 109 PFU/ml) (17) to a lawn of confluent growth of the test strain and scoring for the presence or absence of lysis after 18 h of incubation.

Phage screening of transposon mutant libraries by spot assay.

C. jejuni NCTC 11168 random transposon mutants generated as previously described (23) were screened against the nine typing phages lytic for NCTC 11168 in 12-well tissue culture dishes prepared with 3 ml of CPTA per well. Bacteria were grown as lawns for 48 h, harvested, and adjusted to optical density at 550 nm of 0.25 in aliquots of 1 ml in 1.5-ml microcentrifuge tubes (tube lids were left open). After incubation for 4 h under microaerophilic conditions, 850 μl of bacterial suspension was added to 10 ml of BHIO tempered to 50°C, and 750 μl of this mixture was dispensed into each well of a prepared 12-well plate. Plates were incubated microaerophilically for 30 min while the agar solidified. Subsequently, 10 μl of phage suspension (∼109 PFU/ml assayed on propagating strain) was applied to the center of each well. Controls on each plate were a well with only 10 μl of SM buffer added and an untreated well. Plates were incubated microaerophilically for 18 to 36 h and scored for the presence or absence of lysis. Mutants that appeared to have a gain of resistance to at least one phage were rescreened by using the same protocol at least twice more. The determination of transposon insertion sites was as previously described (23).

Motility assays.

Motility assays for the phage-type strains and spontaneous mutants was done by the Craigie tube method with 2,3,5-triphenyltetrazolium chloride (TTC) incorporated into motility agar. Viable bacteria reduce the TTC, resulting in a reddish coloration of the media; motile bacteria result in coloration in the outer part of the tube. Motility assays for transposon and defined mutants were performed essentially as described previously (51). Briefly, a platinum wire was inoculated with a single colony and used to stab Campylobacter motility agar. Motility was assessed by measuring the colony diameter after incubation at 42°C for 16 h. For large-scale primary screens, 24-well plates were used with 2 ml of motility agar in each well. Confirmatory assays were performed in 90-mm petri dishes containing 30 ml of motility agar, with three inoculation sites: two for the mutant and one for the wild type.

Construction of defined Campylobacter mutants.

Insertion and insertion-deletion mutants were constructed as follows in the genes flhA, required for flagella biosynthesis (9, 36, 40); kpsC, required for capsule formation (30); and pflA, motA, and motB, all required for flagellum function (8, 61). Standard methods were used for molecular cloning (47). PCRs were carried out by using an Applied Biosystems GeneAmp PCR System 9700 thermal cycler; reactions were performed in 50-μl volumes containing 0.01 volume of ProofStart DNA polymerase (QIAGEN, Crawley, United Kingdom) according to the manufacturer's instructions with 1 μM concentrations of the forward and reverse primers (Table 2) and the template DNA. Approximately 50 ng of plasmid DNA or 100 ng of genomic DNA was used as a template in the PCR. Thermal cycling conditions were 94°C for 5 min, 30 cycles of 94°C for 1 min (denaturing), 55°C for 1 min (annealing), and 72°C for 1 min (extension), with a concluding extension of 72°C for 10 min. Products were purified by using the QIAquick PCR purification kit (QIAGEN) according to manufacturer's instructions.

TABLE 2.

Oligonucleotides used in this study

Primer Sequence (5′ to 3′)
ajg210 GGGGGGGGGGTACCCTCGGCGGTGTTCCTTTCCAA
ajg211 AAAAAAAAGGATCCCGCCCTTTAGTTCCTAAAGGG
ajg287 GGGGGGATCCGTGAAGTATTACTCAATATCA
ajg288 GGGGGGATCCTCATTTCTTTGCTAAAAATTC
ajg302 GAGCTCGAATTCTTATTTATCTCTAAGATTTAA
ajg303 CCCGGGGTACCTTATTTTTTGCCATTATTTTTCAT
ajg304 GAGCTCGGATCCACCGAGGGTATTATTAGGATA
ajg305 CCCGGGCTGCAGTTATTGTTTTGATTCATTGTT
ajg364 GGATCCCCCGGGCTCGGCGGTGTTCCTTTCCAAG
ajg365 GAATTCCCCGGGTTATTTATTCAGCAAGTCTTG
ajg369 CCCGGGGAATTCGCGGTCGCAAGCGTTATTT
ajg370 CCCGGGGGATCCTTGTATATCAGCTGAAACG
ajg371 CCCGGGCCATGGCTCGGCGGTGTTCCTTTCCAAG
ajg372 CCCGGGCCATGGCGCCCTTTAGTTCCTAAAGGG
ajg373 CCCGGGGAATTCGCGTTAGAATCAAGAACC
ajg375 CCCGGGTCTAGACTCGGCGGTGTTCCTTTCCAAG
ajg376 CCCGGGTCTAGACGCCCTTTAGTTCCTAAAGGG
ajg395 CCCGGGGTCGACGTAGACTTCAAATGGAAGC
jp001 GGGGGGGCATGCTTTGAAGAATACAAAAGCTTAGAC
jp002 CGCGGATCCGTAAATTTAGAGATAACTAGCTTTTTG
jp003 CGCGGATCCAAAATAATTATAGCAAAACTCTTATAAC
jp004 CCGGAATTCTTGTGCAATCAAGCTTTCTT
jp005 CGCGGATCCCTCGGCGGTGTTCCTTTCCAA
jp006 CGCGGATCCCGCCCTTTAGTTCCTAAAGGG

To generate the flhA mutant, the downstream region, including genes rpsO and cj0883c, was amplified from C. jejuni NCTC 11168 chromosomal DNA by PCR using the primers ajg302 and ajg303. The resulting fragment was cloned as an EcoRI-KpnI fragment into EcoRI-KpnI-digested pUC19 to create the plasmid pAJG180. To facilitate subsequent selections, a chloramphenicol resistance gene with its promoter was PCR amplified from pRY111 using the primers ajg210 and ajg211 and inserted as a KpnI-BamHI fragment into KpnI-BamHI-digested pAJG180, generating pAJG181. The upstream region, including cj0881c and the last 30 bases of flhA, was PCR amplified from C. jejuni NCTC 11168 chromosomal DNA using the primers ajg304 and ajg305. The resulting fragment was cloned as a BamHI-PstI fragment into BamHI-PstI-digested pAJG181 to create the plasmid pAJG182. pAJG182 was transformed into C. jejuni by natural transformation method using a plate biphasic method adapted from reference 56. The structure of a representative isolate, with a chromosomally located ΔflhA::cat insertion was confirmed by PCR and Southern hybridization (data not shown).

To create the kpsC mutant, the kpsC gene was amplified from C. jejuni NCTC 11168 chromosomal DNA by PCR using primers ajg287 and ajg288; the resulting fragment was cloned as a BamHI fragment into BamHI-digested pUC19 to create the plasmid pAJG316. To disrupt the reading frame of kpsC and to facilitate subsequent selections, a chloramphenicol resistance gene with its promoter was PCR amplified from pRY111 by using the primers ajg364 and ajg365 and inserted as a SmaI fragment into SwaI-digested pAJG316, deleting 276 bp of the kpsC gene. Restriction analysis confirmed a construct in which the cat gene had inserted in the same orientation as kpsC. The resulting plasmid, pAJG317, was transformed into C. jejuni. The structure of a representative isolate, AG318, with a chromosomally located kpsC::cat fusion was confirmed by PCR and Southern hybridization (data not shown).

To create the pflA deletion mutant, PCR was used to generate fragments upstream (using primers jp001 and jp002) and downstream (using primers jp003 and jp004) of pflA. The upstream region was cloned as a BamHI-SphI fragment into BamHI-SphI-digested pUC19 to create the plasmid pJP1. The downstream region was cloned as a BamHI-EcoRI fragment into BamHI-EcoRI-digested pJP1 to create the plasmid pJP2. To facilitate subsequent genetic selections, a chloramphenicol resistance gene with its promoter was PCR amplified from pRY111 using primers jp005 and jp006 and inserted into the BamHI site of pJP2. Restriction analysis confirmed a construct in which the cat gene had been inserted in the same orientation as pflA would have been. The resulting plasmid, pBEG001, was transformed into C. jejuni. The structure of a representative isolate, 11168 ΔpflA::cat, with a chromosomally located ΔpflA::cat insertion was confirmed by PCR and Southern hybridization (data not shown).

To create the motA mutant, PCR was used to generate a fragment that contained the motA gene and flanking sequence. The region was PCR amplified from C. jejuni NCTC 11168 chromosomal DNA by PCR using the primers ajg369 and ajg370. The resulting fragment was cloned as an EcoRI-BamHI fragment into EcoRI-BamHI-digested pUC19 to create the plasmid pBEG000. To disrupt the reading frame of motA and to facilitate subsequent selections, a chloramphenicol resistance gene with its promoter was PCR amplified from pRY111 using primers ajg371 and ajg372 and inserted into the unique NcoI restriction site within the reading frame of motA. Restriction analysis confirmed a construct in which the cat gene had been inserted in the same orientation as motA. The resulting plasmid, pBEG003, was transformed into C. jejuni as previously detailed. The structure of a representative isolate, 11168 motA::cat, with a chromosomally located motA::cat fusion was confirmed by PCR and Southern hybridization (data not shown).

To generate the motB mutant, the motB gene and flanking sequence was PCR amplified from C. jejuni NCTC 11168 chromosomal DNA by PCR using the primers ajg373 and ajg395. The resulting fragment was cloned as an EcoRI-SalI fragment into EcoRI-SalI-digested pUC19 to create the plasmid pBEG004. To disrupt the reading frame of motB and to facilitate subsequent selections, a chloramphenicol resistance gene with its promoter was PCR amplified from pRY111 using the primers ajg375 and ajg376 and inserted into the XbaI restriction site within the reading frame of motB (there are two XbaI sites; however, one was protected from digestion by overlapping dcm methylation). Restriction analysis confirmed a construct in which the cat gene had been inserted in the same orientation as motB. The resulting plasmid, pBEG005, was transformed into C. jejuni, and the structure of a representative isolate with a chromosomally located motB::cat fusion was confirmed by PCR and Southern hybridization (data not shown).

RESULTS

Campylobacter typing phages can be assigned to four groups based on their reaction with spontaneous resistant mutants of Campylobacter type strains.

We selected eight of the definitive Campylobacter phage-type strains for the isolation of spontaneous mutants resistant to lysis by the typing phage. Seven of these (T1, T2, T5, T33, T34, T36, and T44) were among the most common types identified in the human Campylobacter isolates; T14 was also included since this strain is sensitive to all 16 of the typing phages (17). Resistant mutants were selected by spreading a single colony of the type strain onto an agar plate previously impregnated with an individual phage species to which the type strain is sensitive. Five putatively resistant colonies were picked from each plate and subcultured to ensure single isolates were obtained. The resultant strains were then tested for their reactivity with the typing phage (Table 3). Mutants were designated by the type strain and phage they had been selected on, e.g., T1Φ4 was type strain 1 selected on phage 4. In all cases but T5Φ5, all five mutants isolated from each selection plate showed the same phage resistance phenotype. For T5Φ5 only one of the five isolated mutants showed altered phage sensitivity. Strikingly, common patterns of resistance were observed, in that selection for resistance to one phage also conferred resistance to other phage; e.g., T1Φ4 was resistant to both Φ4 and Φ12, whereas T33Φ1 was resistant to Φ1, Φ2, Φ6, Φ11, and Φ16. These patterns enabled us to group the 16 typing phages into four classes: A (Φ1, Φ2, Φ6, Φ11, and Φ16), B (Φ3, Φ8, Φ10, Φ14, and Φ15), C (Φ5, Φ7, Φ9, and Φ13), and D (Φ4 and Φ12). The only exception was for T33Φ16, which was resistant to Φ16 but not to any other phage from group A. All of the spontaneous phage-resistant mutants were typed by pulsed-field gel electrophoresis (PFGE) (20) and showed no changes compared to the parent strain (Table 3), indicating that large-scale genomic rearrangements were not responsible for the resistance phenotype. There were six cases, all for which the selecting phage was from group C (T14Φ5, T14Φ7, T14Φ9, T14Φ13, T33Φ5, and T33Φ13), in which the mutant isolated from the selection plate proved upon retesting not to be resistant to the phage used to isolate it but was resistant to phages from other groups (A, B, or D). All variations in sensitivity were stable after storage at −80°C and after repeat subculturing.

TABLE 3.

Phage sensitivity of C. jejuni phage-type strains and derivatives

Strain and derivative(s)a Phage sensitivityb
Motilityc HS serotyped PFGE typee
Φ1 Φ2 Φ3 Φ4 Φ5 Φ6 Φ7 Φ8 Φ9 Φ10 Φ11 Φ12 Φ13 Φ14 Φ15 Φ16
T1 + + + HS2 1
    T1Φ4 - - - HS2 1
    T1Φ12 - - - HS2 1
T2 + + + + + + + + HS4 1
    T2Φ3 - - - - - - - - HS4 1
    T2Φ8 - - - - - - - - HS4 1
    T2Φ10 - - - - - - - - HS4 1
    T2Φ4 - - - - - - - - HS4 1
    T2Φ12 - - - - - - - - HS4 1
T5 + + + + + + + HS50 2
    T5Φ5 + - - - + - + HS50 2
T14 + + + + + + + + + + + + + + + + + HSUT 3
    T14Φ1 - - + - + - + + + + - - + + + - - HS44 3
    T14Φ2 - - + - + - + + + + - - + + + - - HS44 3
    T14Φ6 - - + - + - + + + + - - + + + - - HS44 3
    T14Φ11 - - + - + - + + + + - - + + + - - HS1 3
    T14Φ16 - - + - + - + + + + - - + + + - - HS44 3
    T14Φ3 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ8 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ10 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ14 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ15 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ5 + + + - + + + + + + + - + + + + - HS44 3
    T14Φ7 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ9 + + - - + + + - + - + - + - - + - HSUT 3
    T14Φ13 + + + - + + + + + + + - + + + + - HS8 3
T33 + + + + + + + + + + + + HSUT 4
    T33Φ1 - - + + - + + - + + - + HS13 4
    T33Φ2 - - + + - + + - + + - + HS4 4
    T33Φ6 - - + + - + + - + + - + HSUT 4
    T33Φ11 - - + + - + + - + + - + HSUT 4
    T33Φ16 + + + + + + + + + + - + HS4 4
    T33Φ5 - - + + - + + - + + - + HSUT 4
    T33Φ13 - - + + - + + - + + - + HS4 4
T34 + + + + + + + + HS50 5
    T34Φ16 + + + + + + - + HS50 5
T36 + + + + + + + + + + HSUT 6
    T36Φ1 - - + + - + + + + + HSUT 6
T44 + + + + + HS31 7
    T44Φ10 - - - - - HS17 7
    T44Φ15 - - - - - HS13 7
a

Derivatives are indented in column 1.

b

Scored as lysis observed (+) or not observed (-) in a spot assay using routine test dilution of typing phage.

c

As assessed by using a Craigie tube.

d

Heat-stable serotype as determined by the method of Frost et al. (18). HSUT, untypeable by heat-stable serotype.

e

PFGE was carried out according to the method of Gibson et al. (20); types were defined on the basis of one or more band pattern differences using the method of Peters et al. (43).

Screens of random C. jejuni transposon mutants identified classes resistant to lysis by typing phages from different groups.

Concurrent with the isolation of spontaneous phage-resistant mutants, we used a transposon-based mutagenesis approach to determine the genetic basis of Campylobacter phage resistance. We screened 400 random transposon mutants of C. jejuni NCTC 11168 generated as previously described (23) for resistance to the nine typing phages lytic for this strain (Φ1, Φ2, Φ4, Φ5, Φ6, Φ9, Φ12, Φ13, and Φ16) by a spot lysis method. Fifteen mutants were identified that were refractory to lysis by at least one of the phages. The location of the transposon insertion in these mutants was determined (Table 4). Two major classes of mutants could be identified; strains consistently resistant to Φ4 and Φ12 (group D) had insertions in genes known to code for motility functions or were otherwise nonmotile, while eight capsular polysaccharide (CPS) synthesis mutants were resistant to Φ1, Φ2, Φ6, and Φ16 (group A). Some variable lysis was observed with Φ4 and Φ12, a finding consistent with previously published observations (17). In the screen of 400 mutants no resistance was seen to Φ5 or Φ13. Because motility functions appeared to be important for sensitivity to Φ4 and Φ12, we screened 6,000 transposon mutants for reduced motility and subsequently for sensitivity to the 16 typing phages. A total of 64 motility mutants were identified, and all of them were consistently resistant to Φ4 and Φ12 (data not shown). Motility assays were subsequently performed on the spontaneous phage-resistant mutants to determine whether the correlation between the loss of motility in NCTC 11168 transposon mutants and resistance to Φ4 and Φ12 also applied to the phage-type strain mutants. All of the wild-type strains were motile, whereas mutants that had gained resistance to Φ4 and Φ12 were nonmotile (Table 3). In contrast, mutants that had gained resistance only to phages from group A (Φ1, Φ2, Φ6, Φ11, and Φ16) or C (Φ5, Φ7, Φ9, and Φ13) were motile.

TABLE 4.

Phage sensitivity of C. jejuni NCTC 11168 transposon mutants as assessed by spot assay

Mutant Resistant to indicated Φa Insertion site Putative functionb Motility
03-21c 1, 2, 6, 16 cj0618 Unknown +
cj1413c (kpsS) Polysaccharide modification protein*
04-01 1, 2, 6, 16 cj1428c (fcl) Fucose synthetase* +
04-05 1, 2, (4), 6, (12), 16 cj1432c Sugar transferase* +
04-12 1, 2, (4), 6, (12), 16 cj1432c Sugar transferase* +
04-16 1, 2, (4), 6, (12), 16 cj1441c (kfiD) UDP-glucose 6-dehydrogenase* +
04-20 1, 2, (4), 6, (12), 16 cj1440c Sugar transferase* +
04-23 1, 2, (4), 6, 16 cj0182 Transmembrane transport protein +
05-03 1, 2, 6, 16 cj1429c Unknown* +
31-42 1, 2, 16 cj1532 Unknown +
45-42 1, 2, 6, 16 cj1438c Sugar transferase* +
30-05 (4), 12 cj0171 Unknown +
30-17 1, 2, 4, 9, 12 cj0390 Unknown -
30-28 4, 12 cj0860 Integral membrane protein -
30-39 4, 12 cj0336c (motB) Flagellar motor protein -
31-26 4, 12 cj0061c (fliA) Flagellar biosynthesis sigma factor -
a

Phages for which variable lysis was seen are indicated in parentheses.

b

From J. Parkhill et al. (41). ✽, gene in CPS locus.

c

Mutant 03-21 had a transposon insertion in two genes.

Phage resistance phenotypes of defined motility mutants.

To rule out the possibility that the observed phage resistance phenotypes of the NCTC 11168 transposon mutants were due to polar effects of the transposon insertions, defined pflA, flhA, motA, and motB mutants were constructed in the NCTC 11168 background. All of these strains were nonmotile (not shown) and were resistant to group D phages (Φ4 and Φ12) as determined by spot assay, confirming the results from the transposon screens. In the screens of the Campylobacter phage-type strains, resistance to group B phages (Φ3, Φ8, Φ10, Φ14, and Φ15) was always accompanied by resistance to Φ4 and Φ12 and loss of motility. This suggested that there may be a connection between sensitivity to group B phages and motility. NCTC 11168 of phage type 38 is not sensitive to Φ3, Φ7, Φ8, Φ10, Φ11, Φ14, or Φ15; hence, no information regarding factors required for lysis by group B phages could be obtained from the transposon screens of this strain. By the spot assay, we determined that C. jejuni 81-176 (32) was sensitive to Φ3, Φ5, Φ10, and Φ14 and that strain M1 was sensitive to Φ3 and Φ14 (not shown). We constructed defined pflA, flhA, motA, and motB mutants of these two strains, confirmed that they were nonmotile, and tested their phage sensitivity by spot assay. All of these motility mutants were resistant to lysis by the group B phages (data not shown).

Heat-stable antigen serotyping of Campylobacter phage-type strain mutants.

CPS is the determinant of heat-stable antigen serotype (11, 18, 30). The correlation between gain of resistance to phages from group A and transposon-mediated mutation of CPS genes suggested that an HS serotype change may be observed in the spontaneous mutants resistant to these phages. Serotyping (Table 3) showed that to some extent this was the case; of 14 mutants that had gained resistance to phages from group A, 9 (64%) had an altered serotype. In contrast, 4 of 19 (21%) mutants that had gained resistance only to phages from group B, C, or D showed a serotype change.

Phage resistance phenotype of defined CPS mutants.

Because the NCTC 11168 transposon library screening implicated CPS biosynthetic genes as being important in sensitivity to group A phages (Φ1, Φ2, Φ6, and Φ16), we sought to confirm the phenotypes of some of the transposon mutants by screening defined mutants of NCTC 11168 in cj1428c (fcl) and cj1429c. In both cases the defined mutants had a wild-type phenotype as determined by the spot assay. Possibly, the transposon insertions were polar on downstream genes, resulting in a significant alteration in, or complete loss of, the capsule structure in these mutants compared to the defined mutants. If this was the case, we predicted that acapsular mutants would be resistant to Φ1, Φ2, Φ6, and Φ16. To investigate this, we screened defined mutants in kpsC (constructed in the present study), kpsM, and cj1439 (glf), previously shown to be acapsular (30, 52) for phage sensitivity using the spot assay. All three mutants were completely resistant to the lytic activity of Φ1 and Φ2. For Φ6 and Φ16, the mutants were sensitive but to a lesser degree than the wild type.

DISCUSSION

Despite the significance of C. jejuni as a food-borne pathogen, comparatively little is known regarding the physiology, biochemistry, or pathogenesis of the organism. Campylobacter sp. incidence in the United Kingdom is high; over 50,000 laboratory cases were confirmed each year from 1997 to 2001 in England and Wales, although there has been a decrease to around 42,000 cases annually over recent years (26). The use of phage typing in conjunction with serotyping facilitates the screening of large numbers of isolates (17). The key to the continued understanding of the significance of Campylobacter spp. in food safety is the ability to distinguish between strains. This is necessary for the identification of sources of infection and elucidation of the routes of transmission and is a prerequisite for the development of targeted control strategies.

With the continued emergence of antibiotic-resistant bacteria and the desire to identify alternative methods to control pathogens, the specificity of phage for particular bacterial species has led some researchers to propose the exploitation of phage as a possible means to control Campylobacter spp. (2, 3, 13, 21, 35, 57). For this to be a viable option, it will be necessary to have a greater understanding of the relationship between C. jejuni and Campylobacter-specific phages. In the present study, we sought to investigate these phage-bacterium interactions by screening for spontaneous and transposon mutants resistant to lysis by the United Kingdom typing phages. These phages were selected since they are the best-characterized Campylobacter-specific phages; data regarding their ultrastructure, genome size, and restriction profile is available (45), as are their patterns of lysis against many Campylobacter isolates (17). Sixteen phages are used in the United Kingdom typing scheme, all of which belong to the Myoviridae family, and they have been classified into three groups based on structural criteria: group I (Φ4 and Φ12), group II (Φ3, Φ8, Φ10, Φ14, and Φ15), and group III (Φ1, Φ2, Φ5, Φ6, Φ7, Φ9, Φ11, Φ13, and Φ16) (45).

We screened eight Campylobacter phage-type strains for spontaneous gain of resistance to the typing phages and observed common patterns of resistance that enabled us to group the phages into four categories: group A (Φ1, Φ2, Φ6, Φ11, and Φ16), group B (Φ3, Φ8, Φ10, Φ14, and Φ15), group C (Φ5, Φ7, Φ9, and Φ13), and group D (Φ4 and Φ12). Selection for resistance to phages from within a group in general also conferred resistance to the other phages within that group, presumably as a consequence of phages within a group targeting related bacterial factors. Screens of transposon and defined mutants of C. jejuni NCTC 11168, M1, and 81-176 showed that resistance to phages from group A could be imparted by disruption of CPS expression, while loss of motility correlated with resistance to phages from groups B and D. Moreover, this was reflected in the screens of spontaneous mutants, where resistance to phage groups B and D was also associated with a motility defect. Interestingly, there was a correlation between the structural groupings reported by Sails et al. (45) and the phenotypic groupings reported here; phages with a motility association, those in groups B and D, correspond to structural groups II and I, respectively, whereas the CPS-associated phages are all in structural group III. Whether these groupings are a general feature of Campylobacter phages is unclear. It would be of interest to determine whether additional phage species, such as those recently isolated from retail poultry (2, 13, 15), show these structural and phenotypic relationships.

In the screens for spontaneous mutants there were a few exceptions to these rules. Phage-type strain T33 selected on Φ16 yielded a derivative resistant to Φ16 but sensitive to other phages from group A. Given the apparent connection between CPS and phages from this group, it is possible that this spontaneous resistant mutant had a CPS structural change that specifically disrupted the interaction with Φ16 but did not affect the ability of the other phages to bind to the bacterium. Nuclear magnetic resonance and mass spectroscopy techniques such as have recently been used to characterize the CPS structure of Campylobacter (52, 53) could be used to investigate this possibility, but such was beyond the scope of the present study. In six cases of the screens for spontaneous phage-resistant mutants, all using phages from group C, the isolated derivative proved upon retesting to be sensitive to the selecting phages but resistant to phages from other groups. Possibly, the initial selection was not stringent enough to select for mutants resistant to direct application of high-titer phages. The resistance of these isolates to phages from groups A, B, and D may suggest that resistance to these phages arises at a relatively high frequency or imparts some limited protection against group C phages.

Successful phage replication requires binding of the phage to the host bacterium, injection and replication of phage DNA, synthesis of progeny phage particles, and lysis of the host. The initial binding necessarily requires an interaction between the phage and structures on the surface of the bacterium. It has long been known that flagella and extracellular polysaccharide can serve as phage receptors in other bacterial species (33). For flagellatropic phages, e.g., Bacillus subtilis phage PBS1 (44), E. coli χ-phage (28, 49), and ΦCbK of Caulobacter crescentus (5), the flagella are not thought to be the site at which irreversible attachment of the phages to the bacteria occurs. Rather, the phage appears to reversibly bind to the flagella and use its rotation to translocate to the bacterial body, where irreversible attachment and DNA injection occur (33, 44, 48, 49). Bacteria with intact but paralyzed flagella are refractory to lysis by such phages (33, 48). Our results are consistent with this model; resistance to phages from groups B and D was observed for defined mutants in flhA, which are aflagellate (9, 36, 40), as well as motA, motB, and pflA mutants (8, 61), which possess intact but nonfunctional flagella. The association between motility and phage in Campylobacter is significant in light of the fact that the Campylobacter flagellum is known to be phase variable (34, 40). Variation in flagellum expression would be predicted to result in inconsistent patterns of lysis with flagellatropic phages, and indeed Frost et al. reported that in the development of the United Kingdom phage typing scheme the reactions exhibited by Φ4 and Φ12 were difficult to reproduce (17). We also observed this phenomenon during screens of transposon mutants.

The structure of the Campylobacter CPS has recently been determined for strain NCTC 11168 (52). CPS is a determinant of sensitivity in some phage-bacterium systems (33). In the present study NCTC 11168 kpsC, kpsM, and cj1439 mutants, previously shown to be acapsular (30, 52), were resistant to lysis by United Kingdom typing phages Φ1 and Φ2. These phages show very similar reactions in the typing scheme (17) and have similar restriction digest patterns (45). Lysis by the other phages from group A lytic for NCTC 11168 (Φ6 and Φ16) appeared to be reduced but not eliminated for these acapsular mutants. Further characterization of the molecular basis of the phage-CPS interaction will be required to account for these differences. Expression of the capsule of Campylobacter is thought to be phase variable (29, 41), although there does not appear to be the same variation in the degree of lysis with Φ1, Φ2, Φ6, and Φ16 as with the flagellatrophic Φ4 and Φ12. Variable regions in the CPS locus are associated with structural genes rather than the transport functions that display CPS on the cell surface (30, 34, 41). Presumably, phase variation in this region results in alterations of CPS structure rather than switching between capsulated and acapsular forms. Indeed, variation of CPS structure within a strain of Campylobacter has been observed (1, 25, 53). This contrasts with the flagella, the expression of which is known to be phase variable (34, 40). It may therefore be expected that resistance to Φ4 and Φ12 would arise at a higher frequency than that for group A phages.

We have demonstrated that the United Kingdom Campylobacter typing phages fall into four classes based on their reactivity with mutants of the type strains and NCTC 11168. Group A phages (Φ1, Φ2, Φ6, Φ11, and Φ16) may interact with the capsule, whereas phages of groups D (Φ4 and Φ12) and B (Φ3, Φ8, Φ10, Φ14, and Φ15) may be flagellatropic. Interestingly, the results for one transposon cj0390 mutant suggested that there may be some overlap between the phage groups. This nonmotile mutant was resistant to Φ4 and Φ12 (group D) but also to Φ1 and Φ2 (group A) and Φ9 (group C). cj0390, which is predicted to possess a transmembrane domain and a number of tetratricopeptide repeats that are believed to mediate protein-protein interactions, was previously identified in motility screens of C. jejuni transposon mutants (12; A. Grant, unpublished observations). The precise function of cj0390 in bacterial motility is the subject of a continued study (A. Kanji and A. Grant, unpublished observations) and will be published elsewhere. The lack of motility would account for the resistance to Φ4 and Φ12. The resistance to Φ1, Φ2, and Φ9 could be due to pleiotropic effects of the mutation or may indicate overlap of the receptors for phages from different groups. This study did not give any other indication regarding bacterial factors important in sensitivity to phages from group C (Φ5, Φ7, Φ9, and Φ13).

The phase-variable nature of flagella and capsule means that at least 12 of the 16 typing phages may be interacting with targets that can vary within a strain of Campylobacter, calling into question the efficacy of the phage-typing scheme as currently described. Particularly notable in this regard is the predominance of PT1, accounting for 19.6% of C. jejuni isolates from human infections (17), defined on the basis of sensitivity to only phages Φ4 and Φ12. The flagellatropic nature of these phages may account for the inconsistent lysis patterns previously seen with them (17) and makes a case for their removal from the typing scheme. Frost et al. suggested this as a possibility but noted that the removal of these phages would increase the proportion of untypeable isolates from 15 to 35% (17). Extension of the phage typing scheme by the addition of new phages could improve discrimination, provided any new phages did not target phase-variable structures. More likely, however, is the increased use of genetic techniques such as multilocus sequence typing (14) and comparative phylogenomics (10), which also yield data regarding the evolutionary relationships between different strains, in contrast to the phenotypic methods of phage typing and serotyping.

The use of phage as a control strategy for Campylobacter spp. is still of great interest, but a more detailed understanding of the phage-bacterium interaction is of paramount importance before it can be used successfully. Recent studies by Connerton and coworkers have begun to explore the dynamics of phage-host interaction during colonization of chickens with Campylobacter spp. (13, 15, 35). The present study has begun to characterize the molecular basis of the phage-host interaction and demonstrates that consideration must be made of the possibility that phage targets are under phase-variable regulation. The significance of this observation is likely to be different depending upon where the use of phage therapy is envisaged. Application of phage in vivo, within broiler chickens prior to slaughter, for example, is fundamentally different from postprocessing applications, where the bacteria may not be replicating. A recent report has shown that in an experimental model, phage-resistant campylobacters were isolated at a lower frequency in vivo (from chicken intestinal contents) than in vitro (broth culture) (35). These resistant bacteria became sensitive to phage when passaged through the avian host. Since structural features such as flagella and CPS are important in colonization (4, 23, 27, 37, 38, 42, 54, 58), it is tempting to speculate that phase variation gives rise to a population that is phage resistant but impaired for colonization. Whatever the precise dynamics of the phage-host interaction, it is likely that any phage-based intervention strategy would use combinations of phage that simultaneously target the capsule, flagella, and, ideally, nonvariable structures, too, should such phage be identified. We are currently extending our screens of transposon mutants to explore new host-phage interactions, as well as consolidating our findings from the present study to identify the actual receptors required by the phages for their binding.

Acknowledgments

We thank Pat Guerry for C. jejuni strain 81-176; Diane Newell for C. jejuni strain M1; and Judith Richardson, Robert J. Owen, and Ian F. Connerton for helpful discussions.

This study was supported by a Department for the Environment, Food, and Rural Affairs (Defra) Senior Fellowship in Veterinary Microbiology to D.J.M.; Defra Link Project FQS02; The Health Protection Agency Laboratory of Enteric Pathogens; U.S. Department of Agriculture grant 2002-35600-12775 to M.H.; and a Wellcome Trust Fundamentals of Veterinary Sciences summer studentship to J.P.

REFERENCES

  • 1.Aspinall, G. O., A. G. McDonald, and H. Pang. 1992. Structures of the O chains from lipopolysaccharides of Campylobacter jejuni serotypes O:23 and O:36. Carbohydr. Res. 231:13-30. [DOI] [PubMed] [Google Scholar]
  • 2.Atterbury, R. J., P. L. Connerton, C. E. R. Dodd, C. E. D. Rees, and I. F. Connerton. 2003. Isolation and characterization of Campylobacter bacteriophages from retail poultry. Appl. Environ. Microbiol. 69:4511-4518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Atterbury, R. J., P. L. Connerton, C. E. R. Dodd, C. E. D. Rees, and I. F. Connnerton. 2003. Application of host-specific bacteriophages to the surface of chicken skin leads to a reduction in recovery of Campylobacter jejuni. Appl. Environ. Microbiol. 69:6302-6306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bacon, D. J., C. M. Szymanski, D. H. Burr, R. P. Silver, R. A. Alm, and P. Guerry. 2001. A phase-variable capsule is involved in virulence of Campylobacter jejuni 81-176. Mol. Microbiol. 40:769-777. [DOI] [PubMed] [Google Scholar]
  • 5.Bender, R. A., C. M. Refson, and E. A. O'Neil. 1989. Role of the flagellum in cell-cycle-dependent expression of bacteriophage receptor activity in Caulobacter crescentus. J. Bacteriol. 171:1035-1040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Berrang, M. E., R. J. Buhr, and J. A. Carson. 2000. Campylobacter recovery from external and internal organs of commercial broiler carcass prior to scalding. Poultry Sci. 79:286-290. [DOI] [PubMed] [Google Scholar]
  • 7.Black, R. E., M. M. Levine, M. L. Clements, T. P. Hughes, and M. J. Blaser. 1988. Experimental Campylobacter jejuni infection in humans. J. Infect. Dis. 157:472-479. [DOI] [PubMed] [Google Scholar]
  • 8.Bleumink-Pluym, N. M., F. Verschoor, W. Gaastra, B. A. van der Zeijst, and B. N. Fry. 1999. A novel approach for the construction of a Campylobacter mutant library. Microbiology 145:2145-2151. [DOI] [PubMed] [Google Scholar]
  • 9.Carrillo, C. D., E. Taboada, J. H. E. Nash, P. Lanthier, P. J. Kelly, P. C. Lau, R. Verhulp, O. Mykytczuk, J. Sy, W. A. Findlay, K. Amoako, S. Gomis, P. P. Willson, J. W. Austin, A. Potter, L. Babiuk, B. Allan, and C. M. Szymanski. 2004. Genome-wide expression analyses of Campylobacter jejuni NCTC11168 reveals coordinate regulation of motility and virulence by flhA. J. Biol. Chem. 279:20327-20338. [DOI] [PubMed] [Google Scholar]
  • 10.Champion, O. L., M. W. Gaunt, O. Gundogdu, A. Elmi, A. A. Witney, J. Hinds, N. Dorrell, and B. W. Wren. 2005. Comparative phylogenomics of the food-borne pathogen Campylobacter jejuni reveals genetic markers predictive of infection source. Proc. Natl. Acad. Sci. USA 102:16043-16048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chart, H., J. A. Frost, A. Oza, R. Thwaites, S. Gillanders, and B. Rowe. 1996. Heat-stable serotyping antigens expressed by strains of Campylobacter jejuni are probably capsular and not long-chain lipopolysaccharide. J. Appl. Bacteriol. 81:635-640. [DOI] [PubMed] [Google Scholar]
  • 12.Colegio, O. R., T. J. Griffin IV, N. D. Grindley, and J. E. Galan. 2001. In vitro transposition system for efficient generation of random mutants of Campylobacter jejuni. J. Bacteriol. 183:2384-2388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Connerton, P. L., C. M. Loc Carrillo, C. Swift, E. Dillon, A. Scott, C. E. D. Rees, C. E. R. Dodd, J. Frost, and I. F. Connerton. 2004. Longitudinal study of Campylobacter jejuni bacteriophages and their hosts from broiler chickens. Appl. Environ. Microbiol. 70:3877-3883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dingle, K. E., F. M. Colles, D. R. Wareing, R. Ure, A. J. Fox, F. E. Bolton, H. J. Bootsma, R. J. Willems, R. Urwin, and M. C. Maiden. 2001. Multilocus sequence typing system for Campylobacter jejuni. J. Clin. Microbiol. 39:14-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.El-Shibiny, A., P. L. Connerton, and I. F. Connerton. 2005. Enumeration and diversity of campylobacters and bacteriophages isolated during the rearing cycles of free-range and organic chickens. Appl. Environ. Microbiol. 71:1259-1266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Food Standards Agency. 2003. UK-wide survey of Salmonella and Campylobacter contamination of fresh and frozen chicken on retail sale. Food Standards Agency, London, United Kingdom. [Online.] http://www.food.gov.uk/multimedia/pdfs/campsalmsurvey.pdf.
  • 17.Frost, J. A., J. M. Kramer, and S. A. Gillanders. 1999. Phage typing of Campylobacter jejuni and Campylobacter coli and its use as an adjunct to serotyping. Epidemiol. Infect. 123:47-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Frost, J. A., A. N. Oza, R. T. Thwaites, and B. Rowe. 1998. Serotyping scheme for Campylobacter jejuni and Campylobacter coli based on direct agglutination of heat-stable antigens. J. Clin. Microbiol. 36:225-339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gaynor, E. C., S. Cawthraw, G. Manning, J. K. MacKichan, S. Falkow, and D. G. Newell. 2004. The genome-sequenced variant of Campylobacter jejuni NCTC 11168 and the original clonal clinical isolate differ markedly in colonization, gene expression, and virulence-associated phenotypes. J. Bacteriol. 186:503-517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gibson, J. R., K. Sutherland, and R. J. Owen. 1994. Inhibition of DNAse activity in PFGE analysis of DNA from Campylobacter jejuni. Lett. Appl. Microbiol. 19:357-358. [DOI] [PubMed] [Google Scholar]
  • 21.Goode, D., V. M. Allen, and P. A. Barro. 2003. Reduction of experimental Salmonella and Campylobacter contamination of chicken skin by application of lytic bacteriophages. Appl. Environ. Microbiol. 69:5032-5036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Grajewski, B. A., J. W. Kusek, and H. M. Gelfand. 1985. Development of a bacteriophage typing system for Campylobacter jejuni and Campylobacter coli. J. Clin. Microbiol. 22:13-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Grant, A. J., C. Coward, M. A. Jones, C. A. Woodall, P. A. Barrow, and D. J. Maskell. 2005. Signature-tagged transposon mutagenesis studies demonstrate the dynamic nature of cecal colonization of 2-week-old chickens by Campylobacter jejuni. Appl. Environ. Microbiol. 71:8031-8041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580. [DOI] [PubMed] [Google Scholar]
  • 25.Hanniffy, O. M., A. S. Shashkov, A. P. Moran, M. M. Prendergast, S. N. Senchenkova, Y. A. Knirel, and A. V. Savage. 1999. Chemical structure of a polysaccharide from Campylobacter jejuni 176.83 (serotype O:41) containing only furanose sugars. Carbohydr. Res. 319:124-132. [DOI] [PubMed] [Google Scholar]
  • 26.Health Protection Agency. 2006. Campylobacter spp. Laboratory reports of faecal isolates England & Wales, 1986-2005. Health Protection Agency, London, United Kingdom. [Online.] http://www.hpa.org.uk/infections/topics_az/campy/data_ew.htm.
  • 27.Hendrixson, D. R., and V. J. DiRita. 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol. Microbiol. 52:471-484. [DOI] [PubMed] [Google Scholar]
  • 28.Kagawa, N. H., N. Ono, M. Enomoto, and Y. Komeda. 1984. Bacteriophage Chi sensitivity and motility of Escherichia coli K-12 and Salmonella typhimurium Fla mutants possessing the hook structure. J. Bacteriol. 157:649-654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Karlyshev, A. V., J. M. Ketley, and B. W. Wren. 2005. The Campylobacter jejuni glycome. FEMS Microbiol. Rev. 29:377-390. [DOI] [PubMed] [Google Scholar]
  • 30.Karlyshev, A. V., D. Linton, N. A. Gregson, A. J. Lastovica, and B. W. Wren. 2000. Genetic and biochemical evidence of a Campylobacter jejuni capsular polysaccharide that accounts for Penner serotype specificity. Mol. Microbiol. 35:529-541. [DOI] [PubMed] [Google Scholar]
  • 31.Khakhira, R., and H. Lior. 1992. Extended phage-typing scheme for Campylobacter jejuni and Campylobacter coli. Epidemiol. Infect. 108:403-414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Korlath, J. A., M. T. Osterholm, L. A. Judy, J. C. Forfang, and R. A. Robinson. 1985. A point-source outbreak of campylobacteriosis associated with consumption of raw milk. J. Infect. Dis. 152:592-596. [DOI] [PubMed] [Google Scholar]
  • 33.Lindberg, A. A. 1973. Bacteriophage receptors. Annu. Rev. Microbiol. 27:205-241. [DOI] [PubMed] [Google Scholar]
  • 34.Linton, D., A. V. Karlyshev, and B. W. Wren. 2001. Deciphering Campylobacter jejuni cell surface iterations from the genome sequence. Curr. Opin. Microbiol. 4:35-40. [DOI] [PubMed] [Google Scholar]
  • 35.Loc Carrillo, C. M., R. J. Atterbury, A. El-Shibiny, P. L. Connerton, E. Dillon, A. Scott, and I. F. Connerton. 2005. Bacteriophage therapy to reduce Campylobacter jejuni colonization of broiler chickens. Appl. Environ. Microbiol. 71:6554-6563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Miller, S., E. C. Pesci, and C. L. Pickett. 1993. A Campylobacter jejuni homolog of the LcrD/FlbF family of proteins is necessary for flagellar biogenesis. Infect. Immun. 61:2930-2936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Morooka, T., A. Umeda, and K. Amako. 1985. Motility as an intestinal colonization factor for Campylobacter jejuni. J. Gen. Microbiol. 131:1973-1980. [DOI] [PubMed] [Google Scholar]
  • 38.Nachamkin, I., X. H. Yang, and N. J. Stern. 1993. Role of Campylobacter jejuni flagella as colonization factors for three-day-old chicks: analysis with flagellar mutants. Appl. Environ. Microbiol. 59:1269-1273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Newell, D. G., and C. Fearnley. 2003. Sources of Campylobacter colonization in broiler chickens. Appl. Environ. Microbiol. 69:4343-4351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Park, S. F., D. Purdy, and S. Leach. 2000. Localized reversible frameshift mutation in the flhA gene confers phase variability to flagellin expression in Campylobacter coli. J. Bacteriol. 182:207-210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Parkhill, J., B. W. Wren, K. Mingall, J. M. Ketley, C. Churcher, D. Basham, T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M.-A. Rajandream, K. M. Rutherford, A. H. M. van Vliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665-668. [DOI] [PubMed] [Google Scholar]
  • 42.Pavlovskis, O. R., D. M. Rollins, R. L. Haberberger, Jr., A. E. Green, L. Habash, S. Strocko, and R. I. Walker. 1991. Significance of flagella in colonization resistance of rabbits immunized with Campylobacter spp. Infect. Immun. 59:2259-2264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Peters, T. M., C. Maguire, E. J. Threlfall, I. S. T. Fisher, N. Gill, and A. J. Gatto. 2003. The Salm-gene project: a European collaboration for DNA fingerprinting for food-related salmonellosis. Eur. Surveill. 8:46-50. [DOI] [PubMed] [Google Scholar]
  • 44.Raimondo, L. M., N. P. Lundh, and R. J. Martinez. 1968. Primary adsorption site of phage PBS1: the flagellum of Bacillus subtilis. J. Virol. 2:256-264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sails, A. D., D. R. A. Wareing, F. J. Bolton, A. J. Fox, and A. Curry. 1998. Characterisation of 16 Campylobacter jejuni and C. coli typing bacteriophages. J. Med. Microbiol. 47:123-128. [DOI] [PubMed] [Google Scholar]
  • 46.Salama, S. M., F. J. Bolton, and D. N. Hutchinson. 1990. Application of a new phagetyping scheme to campylobacters isolated during outbreaks. Epidemiol. Infect. 104:405-411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sambrook, J., and D. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 48.Samuel, A. D. T., T. P. Pitta, W. S. Ryu, P. N. Danese, E. C. W. Leung, and H. C. Berg. 1999. Flagellar determinants of bacterial sensitivity to c-phage. Proc. Natl. Acad. Sci. USA 96:9863-9866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Schade, S. Z., J. Adler, and H. Ris. 1967. How bacteriophage c attacks motile bacteria. J. Virol. 1:599-609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shane, S. M. 2000. Campylobacter infection of commercial poultry. Rev. Sci. Technol. 19:376-395. [DOI] [PubMed] [Google Scholar]
  • 51.Silverman, M., and M. Simon. 1973. Genetic analysis of flagellar mutants in Escherichia coli. J. Bacteriol. 113:105-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.St. Michael, F., C. M. Szymanski, J. Li, K. H. Chan, N. H. Khieu, S. Larocque, W. W. Wakarchuk, J.-R. Brisson, and M. A. Monteiro. 2002. The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168. Eur. J. Biochem. 269:5119-5136. [DOI] [PubMed] [Google Scholar]
  • 53.Szymanski, C. M., F. St. Michael, H. C. Jarrell, J. Li, M. Gilbert, S. Larocque, E. Vinogradov, and J.-R. Brisson. 2003. Detection of conserved N-linked glycans and phase-variable lipooligosaccharides and capsules from Campylobacter cells by mass spectrometry and high resolution magic angle spinning NMR spectroscopy. J. Biol. Chem. 278:24509-24520. [DOI] [PubMed] [Google Scholar]
  • 54.Takata, T., S. Fujimoto, and K. Amako. 1992. Isolation of nonchemotactic mutants of Campylobacter jejuni and their colonization of the mouse intestinal tract. Infect. Immun. 60:3596-3600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.van Gerwe, T. J. W. M., A. Bouma, W. F. Jacobs-Reitsma, J. van den Broek, D. Klinkenberg, J. A. Stegeman, and J. A. P. Heesterbeek. 2005. Quantifying transmission of Campylobacter spp. among broilers. Appl. Environ. Microbiol. 71:5765-5770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.van Vliet, A. H. M., A. C. Wood, J. Henderson, K. Wooldridge, and J. M. Ketley. 1997. Genetic manipulation of enteric Campylobacter species. Methods Microbiol. 27:407-419. [Google Scholar]
  • 57.Wagenaar, J. A., M. A. P. van Bergen, M. A. Mueller, T. M. Wassenaar, and R. M. Carlton. 2005. Phage therapy reduces Campylobacter jejuni colonization in broilers. Vet. Microbiol. 109:275-283. [DOI] [PubMed] [Google Scholar]
  • 58.Wassenaar, T. M., B. A. van der Zeijst, R. Ayling, and D. G. Newell. 1993. Colonization of chicks by motility mutants of Campylobacter jejuni demonstrates the importance of flagellin A expression. J. Gen. Microbiol. 139:1171-1175. [DOI] [PubMed] [Google Scholar]
  • 59.Yanisch-Perron, C., J. Vieira, and J. Messing. 1992. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 114:81-83. [DOI] [PubMed] [Google Scholar]
  • 60.Yao, R., R. A. Alm, T. J. Trust, and P. Guerry. 1993. Construction of new Campylobacter cloning vectors and a new mutational cat cassette. Gene 130:127-130. [DOI] [PubMed] [Google Scholar]
  • 61.Yao, R., D. H. Burr, P. Doig, T. J. Trust, H. Niu, and P. Guerry. 1994. Isolation of non-motile insertional mutants of Campylobacter jejuni: the role of motility in adherence and invasion of eukaryotic cells. Mol. Microbiol. 14:883-893. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES