Abstract
znuA is known to be an important factor for survival and normal growth under low Zn2+ concentrations for Escherichia coli, Haemophilus spp., Neisseria gonorrhoeae, and Pasteurella multocida. We hypothesized that the znuA gene present in Brucella melitensis 16 M would be similar to znuA in B. abortus and questioned whether it may also be an important factor for growth and virulence of Brucella abortus. Using the B. melitensis 16 M genome sequence, primers were designed to construct a B. abortus deletion mutant. A znuA knockout mutation in B. abortus 2308 (ΔznuA) was constructed and found to be lethal in low-Zn2+ medium. When used to infect macrophages, ΔznuA B. abortus showed minimal growth. Further study with ΔznuA B. abortus showed that its virulence in BALB/c mice was attenuated, and most of the bacteria were cleared from the spleen within 8 weeks. Protection studies confirmed the ΔznuA mutant as a potential live vaccine, since protection against wild-type B. abortus 2308 challenge was as effective as that obtained with the RB51 or S19 vaccine strain.
Zn2+ is an essential mineral required by bacteria as either a structural or catalytic cofactor (32). Bacterial survival and proliferation in the environment and within animal hosts are critically dependent on the uptake and sequestration of transition metals, such as Zn2+ (4). This is problematic, because free Zn2+ concentrations in mammalian hosts are very low, so as to prevent bacterial colonization. To acquire the necessary Zn2+ for its metabolism, bacteria have evolved several types of proteins that are involved in binding and transporting zinc (9).
The translation products of the znuABC operon found in Escherichia coli (5, 31), Haemophilus spp. (27), Neisseria gonorrhoeae (8), Pasteurella multocida (15), and Synechocystis sp. strain 6803 (4) constitute a high-affinity periplasmic binding protein-dependent and ATP-binding cassette (ABC) transport system for Zn2+. In gram-negative bacteria, ABC transporters are involved in the active transport of molecules from periplasm to the cytosol (19). In addition, znuA mutants in H. ducreyi (27) and P. multocida (15) were found to be significantly less virulent than wild-type strains when tested in animal models.
B. abortus is a gram-negative facultative, intracellular pathogen capable of infecting both wildlife and livestock (7), and it is able to cause severe zoonotic infection in humans (3, 34). Currently, there are no human Brucella vaccines, and current livestock vaccines such as S19 and RB51 are virulent in humans. Attempts to develop live brucellae vaccines have met with varied success. For instance, inactivation of the amino acid biosynthesis pathway genes pheA, trpB, and dagA displayed little or no attenuation in cultured murine macrophages or in mice (1). The mutants of purine biosynthesis pathway genes purL, purD, and purE (1) displayed significant attenuation in BALB/c mice, but live brucellae remained viable after 12 weeks, suggesting that their virulence was not sufficiently attenuated for adoption as a livestock vaccine. The aromatic amino acid pathway aroC mutant of B. suis (14), the B. abortus lipid A fatty acid-transporting gene bacA mutant (12, 26), the type IV secretion virB mutant (11), and the ferrochelatase hemH mutant (2) showed highly attenuated virulence, but their protective efficacy has yet to be reported. B. abortus nicotinamidase pncA (22) and exopolysaccharide transporter exsA (33) mutants showed substantial protection, but these vaccine strains still colonized the host even after 6 weeks. One promising live brucellae vaccine candidate was shown with the cyclic β-1,2-glucan B. abortus cgs mutant of S19, which effectively cleared within 4 weeks and conferred complete protection against low-dose, not high-dose, challenge with wild-type B. abortus 2308 (6). Collectively, these studies show that defined Brucella mutants can be effective, but their potential efficacy remains difficult to predict.
MATERIALS AND METHODS
Genetic methods.
Isolation of plasmid and bacterial chromosomal DNA, restriction enzyme digests, and agarose gel electrophoresis were performed according to standard molecular biological techniques. Plasmids were transformed into E. coli strains by standard techniques. Restriction endonucleases, T4 DNA ligase, calf intestinal alkaline phosphatase, the plasmid Miniprep kit, and the DNA fragment gel extraction kit were purchased from New England Biolabs and used according to the manufacturer's specifications.
Bacterial strains.
B. abortus strain 2308 and the vaccine strain RB51 were obtained from the National Veterinary Services Laboratory, USDA (Ames, IA). B. abortus vaccine strain S19 was obtained from Colorado Serum Co. (Denver).
Suicide plasmid and B. abortus mutant construction.
A pair of primers was designed for znuA DNA fragment amplification. The primers' designations were based on B. melitensis 16 M, whereas the template DNA used for PCR was from B. abortus 2308. Primer sequences were the following: Z-F, TTTAAGCTTCGGTTGCCCGGATGCTG; and Z-R, GCGTCTAGATTGAAGGCAAGTGTCGTG. Restriction enzyme sites of HindIII and XbaI (underlined nucleotides in the above sequences) were integrated to the 5′ end of primers Z-F and Z-R, respectively. This pair of primers was designed for amplifying znuA and its upstream (164 bp) and downstream (126 bp) DNA sequences. A total of 1,277 bp was expected to be amplified. The 1,277-bp PCR product was cloned into pUC18 for sequencing, and differences with B. melitensis and B. suis were annotated. Two amino acid differences were determined (GenBank accession no. AY941821). This pair of primers was also used to verify the deleted sequence in the knockout mutant.
For the mutant construction, two pairs of primers were designed for the upstream (1,818 bp) and downstream (1,538 bp) regions of the B. abortus 2308 znuA DNA fragment in which SacI, XbaI, XbaI, and SalI (underlined) sites were integrated into both of the PCR fragment ends. Primer sequences were the following: up-F, TTAGAGCTCACCGTTGCTGCGAGGAG; up-R, GTATCTAGAAGCCAGAAAGGCAGAAGCAAG; and dn-F, CTCTCTAGATCGCTGAAAGACTGCCTG; dn-R, TTTGTCGACTTGGATGTGCGGGAAGCC.
Upstream and downstream znuA DNA fragments from B. abortus 2308 were then cloned into pUC18 and subcloned into the suicide vector pCVD442 (Ampr) between SacI and SalI to yield suicide plasmid pCznuA, which is capable of propagating in E. coli S17-1 λpir+. pCznuA from donor E. coli S17-1 λpir+ was transferred to B. abortus 2308 by conjugation. Cells were spread onto Bacto Potato Infusion Agar (PIA) (DIFCO, Sparks, MD) plates, which contained 100 μg/ml ampicillin plus 7 μg/ml nalidixic acid (E. coli is sensitive to nalidixic acid but B. abortus is not), and incubated at 37°C in 5% CO2. After 5 days, one colony from the selection plate was chosen and inoculated into Brucella Broth (BB) (DIFCO) medium and shaken at 160 rpm, 37°C overnight. Cells were harvested and spread onto PIA plates containing 6% sucrose and incubated at 37°C in 5% CO2. After 4 days, six individual colonies were selected and screened by PCR analysis using primers Z-F and Z-R. A crystal violet test, as described by White and Wilson (38), was performed to confirm that the ΔznuA mutant maintained its smooth phenotype.
Complementation in trans of the ΔznuA mutation.
To restore znuA activity, PCR amplification fragments with primers Z-F and Z-R and vector pBBR1MCS2 (Kanr) (25) were double digested with restriction enzymes HindIII and XbaI and ligated to yield pBznuA, which was electroporated into E. coli S17-1. Transformants were recovered on Luria-Bertani agar containing 10 μg/ml kanamycin. Plasmids from these transformants were isolated (QIAprep Miniprep; QIAGEN Inc., Valencia, CA) and analyzed by agarose gel electrophoresis after restriction digestion. B. abortus ΔznuA was electroporated with pBznuA. Transformants were selected on PIA containing 10 μg/ml kanamycin.
Evaluation of B. abortus ΔznuA attenuation in RAW 264.7 macrophages.
RAW 264.7 cells (American Type Culture Collection, Manassas, VA) were used to assess ΔznuA mutant survival in macrophages compared to that of the B. abortus wild-type 2308 strain, S19, and the complemented mutant, ΔznuA (pBznuA). Infections were conducted in a fashion similar to that previously described (30). Briefly, 1.25 × 106 cells/well in complete medium (CM; RPMI 1640, 10% fetal bovine serum [Atlanta Biologicals, GA], 10 mM HEPES buffer, 10 mM nonessential amino acids, 10 mM sodium pyruvate) without antibiotics were allowed to adhere to plastic in 24-well microtiter dishes (B-D Labware, Franklin, NJ) for 3 h at 37°C. Wells were washed, and the nonadherent cells were collected and counted to determine cell numbers that remained plastic adherent. After overnight culture, cells were infected with varying bacteria-to-macrophage ratios (5:1, 10:1, and 20:1) for 1 h at 37°C. Wells were washed twice with CM without antibiotics and then incubated with 50 μg/ml of gentamicin (Life Technologies) for 30 min at 37°C. After washing twice, as described above, fresh CM without antibiotics (1.0 ml/well) was added, and cells were incubated for an additional 4, 24, or 48 h.
Immunization and challenge of mice.
All experiments with live brucellae were performed in biosafety level 3 facilities. Female BALB/c mice (Frederick Cancer Research Facility, National Cancer Institute, MD) were maintained at the Montana State University Animal Resource Center. All animals were maintained in individually ventilated cages under HEPA-filtered barrier conditions of 12 h of light and 12 h of darkness in the animal biosafety level 3 facility, and they were provided with food and water ad libitum. Experiments were conducted with 7- to 9-week-old age-matched mice. All animal care and procedures were in accordance with institutional policies for animal health and well-being.
Wild-type 2308, ΔznuA mutant, RB51, and S19 Brucella strains were grown overnight in BB at 37°C. Cells were pelleted, washed twice in sterile phosphate-buffered saline (PBS), and diluted to 1 × 108 cells/200 μl in sterile PBS. The actual viable inoculum CFU was confirmed by serial dilution tests on PIA, and 0.2 ml of this suspension was administered to mice via intraperitoneal (i.p.) injection. For challenge study, B. abortus 2308 was diluted in sterile PBS, in which 100 μl of bacterial suspension contained 5 × 104 CFU bacteria, and immunized and naive mice were subsequently i.p. challenged. The challenge dose was confirmed by plating B. abortus on PIA.
Enumeration of brucellae in spleens.
For the in vivo ΔznuA mutant colonization studies, splenic CFU were assessed at 1, 4, and 8 weeks and compared to those from in vivo colonization by RB51, S19, and 2308. Individual spleens were removed and mechanically homogenized in 1 ml of sterile Milli-Q water. After incubation for 3 to 5 days at 37°C in 5% CO2 on PIA, Brucella colonies were enumerated and CFU per spleen were calculated.
Statistical analysis.
The Student t test was used to evaluate differences between variations of in vitro and in vivo colonization by ΔznuA B. abortus, ΔznuA(pBzunA) B. abortus, strain 2303, RB51, or S19 at the 95% confidence interval.
RESULTS
Isolation of B. abortus 2308 znuA.
Zn2+ is an essential element for some bacteria (32), and we hypothesized that a defective Zn2+ transport system may attenuate B. abortus. At the time of these studies, the B. abortus 2308 znuA DNA sequence had not been released, but the B. melitensis 16 M genome sequence was published in 2002 (10). The 16 M genome sequence was referred to for designing primers, utilizing B. abortus strain 2308 as a template for PCR amplification with Z-F and Z-R primers (Fig. 1). The PCR fragment was cloned into pUC18, and three positive clones were chosen for sequencing analysis. DNA sequencing results showed that all three clones were identical and that there were only two 1-bp differences from B. melitensis 16 M and B. suis 1330 znuA. These two 1-bp differences represented two amino acid changes: I265 in B. melitensis and B. suis became T265 in B. abortus, and S333 became P333 in B. abortus. These results confirmed our hypothesis that it would be possible to clone znuA from strain 2308 by using the B. melitensis 16 M genome sequence and allowing for the development of ΔznuA in a B. abortus mutant (Fig. 1).
B. abortus znuA mutant and its complementation in trans.
Out of six clones randomly selected from PIA supplemented with 6% sucrose, one clone was confirmed as a positive in-frame knockout mutant, as selected by PCR with primers Z-F and Z-R, and subsequently was confirmed by sequencing. A 933-bp inner DNA fragment of znuA was deleted from B. abortus 2308 genome chromosome II, and only 78 bp of this gene sequence remained.
To verify that ΔznuA attenuation was due to gene replacement and not to a secondary mutation, we complemented the B. abortus ΔznuA mutant with pBznuA plasmid. pBznuA was constructed by PCR amplification of the wild-type B. abortus znuA gene with primers Z-F and Z-R, including 164 bp upstream and 126 bp downstream of the coding sequence. The 1,277-bp amplification product was cloned into vector pBBR1MCS2 (25) and transferred into B. abortus ΔznuA mutant for complementation analysis.
znuA is required for B. abortus growth in low-Zn2+ medium.
ΔznuA mutations in E. coli (31), H. ducreyi (27), N. gonorrhoeae (8), P. multocida (15), and Synechocystis sp. strain 6803 (4) have been shown to be defective in growth medium lacking Zn2+. For comparison, we investigated the growth of B. abortus ΔznuA in different concentrations of Zn2+ in Gerhardt's minimal medium (GMM). Without Zn2+, B. abortus ΔznuA showed no growth, while wild-type 2308 and ΔznuA(pBznuA) grew to similar concentrations. With increasing Zn2+ concentrations, the B. abortus ΔznuA mutant recovered growth that approached that of wild-type strain 2308 and recombinant strain B. abortus ΔznuA(pBzunA) (Fig. 2A). Further testing showed that 200 μM Zn2+ is required for optimal growth of B. abortus ΔznuA (Fig. 2B). These data suggest that znuA is required for normal growth in low-Zn2+ medium.
ΔznuA mutant's growth is arrested in RAW 264.7 macrophages.
To further assess the ΔznuA mutant's attenuation, RAW 264.7 macrophages were infected with ΔznuA mutant and compared to other B. abortus strains to determine their ability to replicate in macrophages. Three ratios of bacteria to macrophage were tested at three time points, 4, 24, and 48 h (Fig. 3). At 0 h, there were no differences in the amount of bacteria that infected the RAW 264.7 cells (Fig. 3). By 4 h postinfection, the macrophages contained equivalent bacterial loads, but by 24 h the znuA mutant's growth was significantly arrested compared to that of macrophages infected with wild-type 2308, the ΔznuA(pBznuA) strain (P ≤ 0.001), or the S19 strain (P ≤ 0.005), and results were similar at 48 h. These results show that the ΔznuA mutant has a limited capability of replicating in RAW 264.7 macrophages compared to that of virulent B. abortus or the vaccine S19 strain. In addition, these results show enhanced attenuation in macrophages, as opposed to that reported using a transposon-induced mutant of the znuA gene of B. abortus using bone marrow-derived macrophages (22).
ΔznuA mutant is attenuated in BALB/c mice.
To evaluate ΔznuA mutant virulence in vivo, BALB/c mice were i.p. infected with 1 × 108 CFU of B. abortus ΔznuA, wild-type 2308, the smooth vaccine strain S19, or the rough vaccine strain RB51. Compared to wild-type strain 2308, splenic CFU in B. abortus ΔznuA-dosed mice were significantly decreased (P < 0.001) at weeks 1, 4, and 8. Importantly, by week 8, in three of the five B. abortus ΔznuA-dosed mice, splenic CFU could not be detected (Fig. 4). These results show that the ΔznuA strain is attenuated. In addition, in this study RB51 was cleared by week 4, which is consistent with what has been previously shown (21, 35). While an in vivo splenic colonization study has been previously reported (22), no kinetic study was described using the transposon-induced znuA mutant.
B. abortus ΔznuA confers protection to BALB/c mice.
Due to decreased virulence, the ΔznuA mutant strain is a potential live vaccine candidate, and past works have not tested its potential efficacy (22). To assess its protective efficacy, four groups of BALB/c mice were immunized i.p. with 1 × 108 CFU of B. abortus ΔznuA, RB51, or S19 or with sterile PBS. This immunization dose was similar to what others have used to determine protective efficacy (21, 29, 37) for rough Brucella mutants, due to their rapid clearance in animal hosts. Since our ΔznuA mutant is also highly attenuated in mice (Fig. 4), although bearing a smooth phenotype, we elected to use a high dose for immunization to reflect what may be used in livestock. Eight weeks postimmunization, mice were i.p. challenged with wild-type strain 2308. Four weeks postchallenge, mice vaccinated with B. abortus ΔznuA showed significantly fewer splenic CFU than mice given PBS. B. abortus znuA was as protective as RB51 and S19 vaccines (Fig. 5A).
We showed that the ΔznuA mutant was mostly cleared by 8 weeks postinfection. To verify if any ΔznuA mutant remained after the strain 2308 challenge that may confound the splenic CFU determinations, ΔznuA mutant-immunized BALB/c mice were evaluated by PCR 4 weeks after wild-type 2308 challenge (12 weeks after immunization). Spleens were removed, and the homogenized tissues were spread onto PIA plates for selecting individual bacterial colonies. Fifty colonies were randomly chosen from PIA plates and mixed together to extract genomic DNA, which was used as a template for PCR amplification. The primers used were Z-F and Z-R. A 1,277-bp DNA fragment was expected to be amplified for the wild-type strain, and 344 bp (1,277 bp minus 933 bp) was expected to be amplified for the ΔznuA mutant strain. Wild-type 2308 genomic DNA was used as positive control I, and 2308 genomic DNA from 49 mixed colonies plus 1 colony from ΔznuA mutant genomic DNA was used as positive control II. None of the isolates from ΔznuA mutant-immunized and challenged mice showed a detectable 344-bp fragment following PCR, despite the experiments being repeated five times per mouse (Fig. 5B). These results confirmed that the splenic CFU detected 4 weeks postchallenge were all wild type, and none were from the ΔznuA mutant.
DISCUSSION
As with E. coli, Haemophilus spp., N. gonorrhoeae, P. multocida, and Synechocystis sp. strain 6803, znuA is also required by B. abortus for growth in low-Zn2+ medium. These observations suggest that znuA proteins from these bacteria share a similar function, i.e., providing the capacity to grow in a low-Zn2+ environment. The earliest report on znuA virulence was regarding H. ducreyi (27). Subsequently, it was demonstrated that znuA and znuBC transcriptional units in P. multocida are required for virulence in the mouse model (15). As shown in this present study, our znuA mutant's growth depends on environmental Zn2+ concentration, and its growth is compromised when it is cultured under no or little Zn2+. Similar results were obtained when Zn2+ was chelated from the growth medium for the transposon-induced mutant (22). In addition, we assessed the potential of using the ΔznuA mutant as a live vaccine. Since site-directed mutagenesis was done, no antibiotic selection was used to develop this vaccine strain, and our mutation was limited solely to the znuA gene. Thus, the strain described in our study is different from the previously described znuA mutant (22), in which a polar mutation was produced by the insertion of a kanamycin resistance gene into the znuA gene. Because of this approach, downstream gene expression was affected, unlike the results of our approach, in which an in-frame disruption was used to limit the effects to a single gene, znuA.
A successful infection involves Brucella survival in the phagosomes of macrophages (18, 28). However, in phagosomes the low pH, limited nutrition, and O2 tension adds more pressure for bacterial survival (13, 17, 20, 23, 24). Thus, to counteract this inhospitable environment, bacteria develop a number of survival mechanisms. One strategy involves the znuABC operon for high-affinity binding of Zn2+ to allow survival where Zn2+ levels are limiting. This requirement for zinc is evident by serving as a cofactor for the Cu,Zn superoxide dismutase (sodC gene) and enabling Brucella to resist oxidation by the host phagosome (16). In addition, Zn2+ is an essential structural or catalytic cofactor for many enzymes, and losing its ability to acquire the limited Zn2+ levels from phagosomes would inhibit the activity of enzymes such as alkaline phosphatase, RNA polymerase, aspartate transcarbamylase, FtsH (Zn2+-dependent protease), and zinc finger proteins (31).
Because of this importance of Zn2+, we sought the development of the ΔznuA mutant for B. abortus. As a result, we observed diminished splenic CFU displayed by the B. abortus ΔznuA mutant in BALB/c mice and in RAW 264.7 macrophages. Although dosages of the mutant were different from those in a previous study (22), it was apparent that our mutant was eventually cleared within 8 weeks. Moreover, the clearance of our ΔznuA mutant from RAW 264.7 macrophages was an order of magnitude greater than that observed with the polar ΔznuA mutant (22). Such development of a vaccine exhibiting less virulence but higher protective efficacy is desired. As such, the B. abortus pgm mutant also showed low virulence, but its protective efficacy was only as good as that of S19 (36). The advantage of this mutant, like RB51, is its lack of the lipopolysaccharide O side chain, which enables us to distinguish wild-type Brucella-infected animals from those that have been vaccinated.
Our findings show that the znuA mutant may be another suitable live vaccine candidate for B. abortus, because of its low virulence in BALB/c mice while maintaining a protective efficacy similar to that of RB51 and S19 vaccine strains. Further testing in livestock will determine whether the B. abortus ΔznuA mutant will be a promising live vaccine candidate, since it is proposed that some immunity to lipopolysaccharide is desirable for stimulating optimal immunity in livestock. Current studies are evaluating whether additional mutations will enhance the ΔznuA mutant's efficacy and determining how to distinguish vaccinated from naturally infected animals.
Acknowledgments
We thank Michael Donnenberg and Xiaolin Wang from the University of Maryland, School of Medicine, Division of Infectious Diseases, for kindly providing us with the suicide plasmid pCVD442; Gao Weimin from the Oak Ridge National Laboratory for kindly providing us with the E. coli S17-1 λpir strain; and Nancy Kommers for her assistance in preparing the manuscript.
This work was supported by a grant from the USDA (2005-06034). It was also supported in part by the Montana Agricultural Station and USDA Formula Funds as well as NIH/NCRR COBRE-supported (P20 RR-020185) biosafety level 3 facilities.
Editor: V. J. DiRita
REFERENCES
- 1.Alcantara, R. B., R. D. Read, M. W. Valderas, T. D. Brown, and R. M. Roop, Jr. 2004. Intact purine biosynthesis pathways are required for wild-type virulence of Brucella abortus 2308 in the BALB/c mouse model. Infect. Immun. 72:4911-4917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Almirón, M., M. Martínez, N. Sanjuan, and R. A. Ugalde. 2001. Ferrochelatase is present in Brucella abortus and is critical for its intracellular survival and virulence. Infect. Immun. 69:6225-6230. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ashford, D. A., J. di Pietra, J. Lingappa, C. Woods, H. Noll, B. Neville, R. Weyant, S. L. Bragg, R. A. Spiegel, J. Tappero, and B. B. Perkins. 2004. Adverse events in humans associated with accidental exposure to the livestock brucellosis vaccine RB51. Vaccine 22:3435-3439. [DOI] [PubMed] [Google Scholar]
- 4.Banerjee, S., B. Wei, M. Bhattacharyya-Pakrasi, H. B. Pakrasi, and T. J. Smith. 2003. Structural determinants of metal specificity in the zinc transport protein ZnuA from Synechocystis 6803. J. Mol. Biol. 333:1061-1069. [DOI] [PubMed] [Google Scholar]
- 5.Beard, S. J., R. Hashim, G. Wu, M. R. Binet, M. N. Hughes, and R. K. Poole. 2000. Evidence for the transport of zinc(II) ions via the pit inorganic phosphate transport system in Escherichia coli. FEMS Microbiol. Lett. 184:231-235. [DOI] [PubMed] [Google Scholar]
- 6.Briones, G., N. Iñón de Iannino, M. Roset, A. Vigliocco, P. S. Paulo, and R. A. Ugalde. 2001. Brucella abortus cyclic β-1,2-glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infect. Immun. 69:4528-4535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cao, T. B., and M. H. Saier, Jr. 2001. Conjugal type IV macromolecular transfer systems of gram-negative bacteria: organismal distribution, structural constraints and evolutionary conclusions. Microbiology 147:3201-3214. [DOI] [PubMed] [Google Scholar]
- 8.Chen, C. Y., and S. A. Morse. 2001. Identification and characterization of a high-affinity zinc uptake system in Neisseria gonorrhoeae. FEMS Microbiol. Lett. 202:67-71. [DOI] [PubMed] [Google Scholar]
- 9.Claverys, J. P. 2001. A new family of high-affinity ABC manganese and zinc permeases. Res. Microbiol. 152:231-243. [DOI] [PubMed] [Google Scholar]
- 10.Del Vecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. Ivanova, I. Anderson, A. Bhattacharyya, A. Lykidis, G. Reznik, L. Jablonski, N. Larsen, M. D'Souza, A. Bernal, M. Mazur, E. Goltsman, E. Selkov, P. H. Elzer, S. Hagius, D. O'Callaghan, J. J. Letesson, R. Haselkorn, N. Kyrpides, and R. Overbeek. 2002. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. USA 99:443-448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.den Hartigh, A. B., Y. H. Sun, D. Sondervan, N. Heuvelmans, M. O. Reinders, T. A. Ficht, and R. M. Tsolis. 2004. Differential requirements for VirB1 and VirB2 during Brucella abortus infection. Infect. Immun. 72:5143-5149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ferguson, G. P., A. Datta, J. Baumgartner, R. M. Roop, Jr., R. W. Carlson, and G. C. Walker. 2004. Similarity to peroxisomal-membrane protein family reveals that Sinorhizobium and Brucella BacA affect lipid-A fatty acids. Proc. Natl. Acad. Sci. USA 101:5012-5017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Finlay, B. B., and S. Falkow. 1997. Common themes in microbial pathogenicity revisited. Microbiol. Mol. Biol. Rev. 61:136-169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Foulongne, V., K. Walravens, G. Bourg, M. L. Boschiroli, J. Godfroid, M. Ramuz, and D. O'Callaghan. 2001. Aromatic compound-dependent Brucella suis is attenuated in both cultured cells and mouse models. Infect. Immun. 69:547-550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Garrido, M. E., M. Bosch, R. Medina, M. Llagostera, A. M. Pérez de Rozas, I. Badiola, and J. Barbé. 2003. The high-affinity zinc-uptake system znuACB is under control of the iron-uptake regulator (fur) gene in the animal pathogen Pasteurella multocida. FEMS Microbiol. Lett. 221:31-37. [DOI] [PubMed] [Google Scholar]
- 16.Gee, J. M., M. W. Valderas, M. E. Kovach, V. K. Grippe, G. T. Robertson, W. L. Ng, J. M. Richardson, M. E. Winkler, and R. M. Roop, Jr. 2005. The Brucella abortus Cu,Zn superoxide dismutase is required for optimal resistance to oxidative killing by murine macrophages and wild-type virulence in experimentally infected mice. Infect. Immun. 73:2873-2880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Grinberg, O. Y., P. E. James, and H. M. Swatz. 1998. Are there significant gradients of pO2 in cells? Adv. Exp. Med. Biol. 454:415-423. [DOI] [PubMed] [Google Scholar]
- 18.Harmon, B. G., L. G. Adams, and M. Frey. 1988. Survival of rough and smooth strains of Brucella abortus in bovine mammary gland macrophages. Am. J. Vet. Res. 49:1092-1097. [PubMed] [Google Scholar]
- 19.Higgins, C. F. 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8:67-113. [DOI] [PubMed] [Google Scholar]
- 20.James, P. E., O. Y. Grinberg, and H. M. Swartz. 1988. Superoxide production by phagocytosing macrophages in relation to the intracellular distribution of oxygen. J. Leukoc. Biol. 64:78-84. [DOI] [PubMed] [Google Scholar]
- 21.Jiménez de Bagues, M. P., P. H. Elzer, S. M. Jones, J. M. Blasco, F. M. Enright, G. G. Schurig, and A. J. Winter. 1994. Vaccination with Brucella abortus rough mutant RB51 protects BALB/c mice against virulent strains of Brucella abortus, Brucella melitensis, and Brucella ovis. Infect. Immun. 62:4990-4996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kim, S., K. Watanabe, T. Shirahata, and M. Watarai. 2004. Zinc uptake system (znuA locus) of Brucella abortus is essential for intracellular survival and virulence in mice. J. Vet. Med. Sci. 66:1059-1063. [DOI] [PubMed] [Google Scholar]
- 23.Ko, J., and G. A. Splitter. 2000. Residual virulence of Brucella abortus in the absence of the cytochrome bc(1) complex in a murine model in vitro and in vivo. Microb. Pathog. 29:191-200. [DOI] [PubMed] [Google Scholar]
- 24.Kohler, S., V. Foulongne, S. Ouahrani-Bettache, J. Bourg, G., Teyssier, M. Ramuz, and J. P. Liautard. 2002. The analysis of the intramacrophagic virulome of Brucella suis deciphers the environment encountered by the pathogen inside the macrophage host cell. Proc. Natl. Acad. Sci. USA 99:15711-15716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop, Jr., and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176. [DOI] [PubMed] [Google Scholar]
- 26.LeVier, K., R. W. Phillips, V. K. Grippe, R. M. Roop, Jr., and G. C. Walker. 2000. Similar requirements of a plant symbiont and a mammalian pathogen for prolonged intracellular survival. Science 287:2492-2493. [DOI] [PubMed] [Google Scholar]
- 27.Lewis, D. A., J. Klesney-Tait, S. R. Lumbley, C. K. Ward, J. L. Latimer, C. A. Ison, and E. J. Hansen. 1999. Identification of the znuA-encoded periplasmic zinc transport protein of Haemophilus ducreyi. Infect. Immun. 67:5060-5068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Liautard, J. P., A. Gross, J. Dornald, and S. Kohler. 1996. Interactions between professional phagocytes and Brucella spp. Microbiologia 12:197-206. [PubMed] [Google Scholar]
- 29.Oñate, A., S. Céspedes, A. Cabrera, R. Rivers, A. González, C. Muñoz, H. Folch, and E. Andrews. 2003. A DNA encoding Cu,Zn superoxide dismutase of Brucella abortus induces protective immunity in BALB/c mice. Infect. Immun. 71:4857-4861. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Pascual, D. W., T. Trunkle, and J. Sura. 2002. Fimbriated Salmonella enterica serovar Typhimurium abates the initial inflammatory responses by macrophages. Infect. Immun. 70:4273-4281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Patzer, S. I., and K. Hantke. 1998. The znuABC high-affinity zinc uptake system and its regulator Zur in Escherichia coli. Mol. Microbiol. 28:1199-1210. [DOI] [PubMed] [Google Scholar]
- 32.Ratledge, C., and L. G. Dover. 2000. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 54:881-941. [DOI] [PubMed] [Google Scholar]
- 33.Rosinha, G. M., D. A. Freitas, A. Miyoshi, V. Azevedo, E. Campos, S. L. Cravero, O. Rossetti, G. Splitter, and S. C. Oliveira. 2002. Identification and characterization of a Brucella abortus ATP-binding cassette transporter homolog to Rhizobium meliloti ExsA and its role in virulence and protection in mice. Infect. Immun. 70:5036-5044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Smith, L. D., and T. A. Ficht. 1990. Pathogenesis of Brucella. Crit. Rev. Microbiol. 17:209-230. [DOI] [PubMed] [Google Scholar]
- 35.Stevens, M. G., S. C. Olsen, G. W. Pugh, Jr., and M. V. Palmer. 1994. Immune and pathologic responses in mice infected with Brucella abortus 19, RB51, or 2308. Infect. Immun. 62:3206-3212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ugalde, J. E., D. J. Comerci, M. S. Leguizamon, and R. A. Ugalde. 2003. Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live rough-phenotype vaccine. Infect. Immun. 71:6264-6269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Vemulapalli, R., Y. He, L. S. Buccolo, S. M. Boyle, N. Sriranganathan, and G. G. Schurig. 2000. Complementation of Brucella abortus RB51 with a functional wboA gene results in O-antigen syntheses and enhanced vaccine efficacy but no change in rough phenotype and attenuation. Infect. Immun. 68:3927-3932. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.White, P. G., and J. B. Wilson. 1951. Differentiation of smooth from nonsmooth colonies of brucellae. J. Bacteriol. 61:239-240. [DOI] [PMC free article] [PubMed] [Google Scholar]