Abstract
Neutrophils are well-known to rapidly respond to infection through chemotactic infiltration at sites of inflammation, followed by rapid release of microbicidal molecules, chemokines, and proinflammatory cytokines. For tumor necrosis factor alpha (TNF-α), we recently found that neutrophils contain intracellular pools of the cytokine and display the capacity to upregulate transcriptional activity of the gene during lipopolysaccharide (LPS) stimulation. We now show that triggering of mouse peritoneal neutrophils with Toll-like receptor 2 (TLR2), TLR4, and TLR9 ligands, but not ligands of TLR3, induces upregulation of surface membrane TNF-α. However, neutrophils infected with the protozoan Toxoplasma gondii displayed an inability to respond fully in terms of TLR ligand-induced increases in membrane TNF-α expression. Infected neutrophils failed to display decreased levels of intracellular TNF-α upon LPS exposure. In contrast to intermediate inhibitory effects in nontreated neutrophils, T. gondii induced a complete blockade in LPS-induced surface TNF-α expression in the presence of the protein synthesis inhibitor cycloheximide. Despite these inhibitory effects, the parasite did not affect LPS-induced upregulation of TNF-α gene transcription. Collectively, the results show that Toxoplasma prevents TLR ligand-triggered mobilization of TNF-α to the neutrophil surface, revealing a novel immunosuppressive activity of the parasite.
Toxoplasma gondii is an intracellular protozoan parasite with global distribution among humans and animals (17, 20). The parasite is a major opportunistic pathogen in immunocompromised patients and can cause severe birth defects during congenital infection (24, 27). Nevertheless, in immunocompetent individuals, infection with Toxoplasma is asymptomatic under most circumstances. An ongoing strong type 1 cytokine response and robust cell-mediated immunity are necessary to survive both acute and chronic phases of infection, but in some situations overproduction of these mediators has pathological consequences (1, 15, 39).
Our work focuses on the role of neutrophils in Toxoplasma infection. Polymorphonuclear leukocytes (PMN) are known to be the first immune cell type to arrive at foci of infection where they exert their effector potential through phagocytosis and release of granules rich in antimicrobial and tissue-degrading enzymes (32). These cells have been considered terminally differentiated antimicrobial immune effectors but more recently have emerged as immunoregulatory cells that are capable of producing proinflammatory mediators and that express cytokines such as interleukin 12 (IL-12) and tumor necrosis factor alpha (TNF-α) as preformed intracellular pools (3, 6, 11, 14, 28, 36).
The expression of TNF-α itself involves transport to the cell surface where it is subsequently subjected to cleavage and release by the metalloproteinase TNF-α-converting enzyme (4, 5). Expression of a membrane form of TNF-α (mTNF-α) suggests that direct cell-to-cell contact may be important in mediating the effects of this proinflammatory cytokine.
When neutrophils are subjected to Toll-like receptor 4 (TLR4) triggering, intracellular TNF-α is rapidly expressed at the neutrophil surface membrane (3). As a result of increased membrane TNF-α expression, PMN acquire the ability to induce high-level dendritic cell TNF-α expression in a cell contact-dependent manner. Further complexity is added by the finding that lipopolysaccharide (LPS)-triggered neutrophils also induce dendritic cell IL-12 production, but in this case the response involves neutrophil release of presently undefined soluble factors unrelated to TNF-α. Because polymorphonuclear leukocytes also produce several chemokines important in dendritic cell recruitment, we hypothesize that neutrophils may play an important role in dendritic cell activation during infection (2). Such findings are reinforced by recent data indicating near-identical effects using human PMN and dendritic cells (37).
In other studies, we found that Toxoplasma infection results in potent long-lasting suppression of TNF-α release in LPS-triggered macrophages (9, 16). We previously reported that neutrophils release low levels of TNF-α in response to T. gondii, but these studies employed soluble tachyzoite lysate as the stimulus (7, 8). Here, we asked whether parasite infection affected the ability of PMN to upregulate membrane TNF-α in response to LPS. We show that while noninfected peritoneal neutrophils upregulate surface TNF-α expression induced by TLR ligands, this response is downregulated in infected populations. For triggering through TLR4, mobilization of intracellular TNF-α is blocked without affecting increased transcription of the cytokine. As such, this represents a novel mechanism that the parasite employs to manipulate cells of innate immunity.
MATERIALS AND METHODS
Mice.
C57BL/6 strain mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Female mice between 6 and 8 weeks of age were used throughout. Animals were housed in filter-covered isolator cages in the animal facility of the College of Veterinary Medicine at Cornell University, which is accredited by the American Association for Accreditation of Laboratory Care.
Parasites.
Transgenic yellow fluorescent protein (YFP)-expressing parasites of the virulent T. gondii stain RH (kindly provided by D. Roos, University of Pennsylvania) and green fluorescent protein (GFP)-expressing tachyzoites of the type II T. gondii strain PTG (American Type Tissue Culture Collection, Manassas, VA) were maintained by biweekly passage on human foreskin fibroblasts in medium composed of Dulbecco modified Eagle medium (DMEM) (Life Technologies, Gaithersburg, MD) supplemented with 1% fetal calf serum (HyClone Laboratories, Logan, UT), 100 U/ml penicillin, and 100 μg/ml streptomycin (Life Technologies). YFP-expressing RH cultures were supplemented with 1 mM pyrimethamine (Sigma-Aldrich).
Reagents and Ab.
Ultrapure LPS (Escherichia coli strain O111:B4) was purchased from List Biological Laboratories (Campbell, CA). Poly(I:C) and ODN 1829 were obtained from InVivoGen (San Diego, CA). Pam3Cys {N-α-palmitoyl-5-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-l-cysteine} was purchased from EMC Microcollections (Tubingen, Germany). Phycoerythrin (PE)-conjugated goat anti-hamster immunoglobulin G (IgG) antibody (Ab) and allophycocyanin-conjugated rat anti-mouse F4/80 Ab were obtained from Caltag (Burlingame, CA). Peridinin chlorophyll protein (PerCP)-Cy5.5-conjugated Ab specific for Ly6G, PE-conjugated Ab specific for TNF-α (MP6-XT22), purified rat anti-mouse TNF-α (MP6-XT22,) and hamster anti-mouse TNF-α (TN3-19.12) were obtained from BD PharMingen (San Diego, CA). Normal hamster Ig and normal mouse serum (NMS) were purchased from Jackson Immunoresearch (West Grove, PA). Cycloheximide (CHX) was obtained from Calbiochem (La Jolla, CA).
Peritoneal neutrophils.
Mice were injected with 1 ml of 10% thioglycolate (Difco Laboratories, Detroit, MI) intraperitoneally, and 18 h later, peritoneal exudate cells were obtained by lavage with ice-cold phosphate-buffered saline (PBS). Cells were washed in PBS and passed through a 70-μm nylon cell strainer, and erythrocytes in the suspension were lysed using red cell lysis buffer (Sigma). Cells were then washed, resuspended at 2 × 107 cells/ml in buffer composed of Dulbecco's PBS (Life Technology) containing 0.5% bovine serum albumin (Sigma) and 1 mM EDTA (Fisher Scientific), incubated for 15 min at 4°C with rat anti-mouse major histocompatibility complex class II monoclonal antibody (clone M5.114; American Type Culture Collection), and then washed twice with ice-cold PBS. Cells were then incubated at 4°C with goat anti-rat IgG coupled to magnetic beads under gentle mixing conditions. After 30 min, cells were placed in a magnet apparatus (MPC-2; Dynal, Oslo, Norway) to remove major histocompatibility complex class II-positive cells. The procedure was repeated twice, and then the cells were washed in cold PBS and resuspended in DMEM supplemented with 10% fetal calf serum (HyClone, Logan, UT), 100 U/ml penicillin, 100 μg/ml streptomycin (Life Technologies, Grand Island, NY), 5 × 10−5 M 2-mercaptoethanol, 10 mM HEPES (Invitrogen Life Technologies), 100 μM nonessential amino acids (Invitrogen Life Technologies), 1 mM sodium pyruvate (Invitrogen Life Technologies) alone or in the presence of different stimuli at 37°C in 5% CO2. Neutrophils obtained in this manner were routinely 90 to 95% pure and >95% viable as determined by trypan blue exclusion.
In some experiments, purified PMN were infected with RH strain tachyzoites and stimulated with LPS 2 h later, and 4 h later, the supernatants were collected for TNF-α enzyme-linked immunosorbent assay.
Flow cytometry.
To analyze surface markers on PMN, Fc receptors were blocked in fluorescence-activated cell sorting buffer (PBS, 1% bovine serum albumin, and 0.1% sodium azide) with 5 μg/ml anti-mouse CD16/CD32 (BD PharMingen) and 10% NMS for 15 min at 0°C, and then the cells were stained with optimal concentrations of PerCP-Cy5.5-conjugated anti-Gr-1 (Ly-6G) in combination with PE-conjugated antisera specific for TNF-α, and allophycocyanin-conjugated anti-F4/80 Ab for 30 min at 0°C. For intracellular cytokine detection, peritoneal cells were blocked as described above, stained with PerCP-Cy5.5-conjugated anti-Gr-1 Ab, allophycocyanin-conjugated anti-F4/80 Ab, and unlabeled anti-TNF-α Ab, and then the cells were fixed in 3% paraformaldehyde (Sigma), 0.1 mM CaCl2, and 0.1 mM MgCl2 for 30 min at 0°C. Cells were subsequently washed in permeabilization buffer (PBS with 0.075% saponin) and incubated for 15 min at 0°C in permeabilization buffer containing 10% NMS, 5% normal goat serum, and 5 μg/ml anti-mouse CD16/CD32. After two washes in permeabilization buffer, unlabeled hamster anti-TNF-α was added, and cells were incubated for 30 min at 0°C. After the cells were washed in permeabilization buffer, PE-conjugated anti-hamster Ab was added, and the cells were incubated for 30 min at 0°C and subsequently washed for flow cytometric analysis. Expression of TLR was examined on purified neutrophils by fixation (3% paraformaldehyde) followed by blocking in 10% normal mouse serum and 10% normal donkey serum. Samples were permeabilized with 0.075% saponin and subjected to intracellular blocking with 10% normal donkey serum. Anti-TLR3 (eBioscience) Ab, anti-TLR4 (Santa Cruz Biotech) Ab, and rat isotype control Ab were added, followed by PE-conjugated donkey anti-rat IgG. Samples were subsequently washed and subjected to flow cytometric analysis. Data were acquired on a FACSCalibur system (10,000 events per sample) and analyzed with CellQuest software (Becton Dickinson Immunocytometry Systems, San Jose, CA).
Reverse transcription-PCR.
RNA was isolated, reverse transcribed, and subjected to PCR amplification as described previously (7). The primer sequences employed were as follows: for β-actin, TGACGGGGGTCACCCACACTGTGCCCATCTA (sense) and CTAGAAGCATTGCGGTGGACGATGGAGGG (antisense); for TNF-α, CAGCCTCTTCTCATTCCTGCTTGTG (sense) and CTGGAAGACTCCTCCCAGGTATAT (antisense); and for CD11b, GACCCAGGT TACCGTCTACTAC (sense) and TTCAGCACTGGGGTCCTTTCAAGC (antisense). The cDNA was amplified 28 cycles, and products were analyzed on a 1.5% agarose gel after staining with ethidium bromide.
Statistical analysis.
The statistical significance of the data was analyzed using mean fluorescence intensity where applicable.
RESULTS
TLR ligands trigger rapid upregulation of transmembrane TNF-α on the surface of peritoneal PMN.
We previously established that TLR4 ligand LPS stimulates rapid mobilization of intracellular TNF-α to the surface of neutrophils (3). In Fig. 1A, we examined the influence of other TLR ligands on upregulation of neutrophil surface membrane TNF-α expression. Flow cytometric analysis revealed virtually identical kinetics of increased mTNF-α in response to LPS and TLR2 ligand Pam3Cys. Our Pam3Cys preparation contained insignificant amounts of contaminating LPS, because it was equally active on cells from C3H/HeJ (LPS nonresponder) mice (data not shown). Transmembrane TNF-α expression was also triggered by TLR9 ligand CpG, but in this case expression kinetics were delayed (Fig. 1A). This may reflect the fact that TLR9 is expressed within the endoplasmic reticulum and must be recruited to lysosome-like compartments during CpG recognition, whereas TLR2 and TLR4 ligand binding occurs at the cell surface (22). In contrast to LPS, Pam3Cys, and CpG, the TLR3 ligand poly(I:C) failed to increase mTNF-α, despite the fact that it is active on macrophages (Fig. 1A and data not shown). This was true at the dose shown in Fig. 1 and at higher doses and extended incubation times (data not shown). Although neutrophils did not upregulate surface TNF-α in response to poly(I:C), the cells expressed TLR3 at levels similar to those of TLR4 (Fig. 1B). This is of interest, because whereas TLR2, -4, and -9 signaling involves intracellular MyD88, TLR3 signal transduction is independent of this adaptor molecule (35).
FIG. 1.
Surface expression of transmembrane TNF-α on neutrophils following stimulation with different microbial factors. (A) Thioglycolate-elicited peritoneal exudate cells were cultured with medium alone (thin broken lines) or in the presence of 10 μg/ml Pam3Cys, 100 μg/ml poly(I: C), 1 μg/ml LPS, or 5 μM CpG (thick lines). Cells were collected at the indicated times and stained for flow cytometric analysis. The data show surface TNF-α expression profiles gated on Gr-1high F4/80low cells. (B) Expression levels of thioglycolate-elicited neutrophil TLR3 and TLR4 in nonstimulated PMN. Neutrophils were isolated (85% purity) and examined for TLR expression by flow cytometry. Broken line, isotype control; solid line, anti-TLR staining.
T. gondii interferes with TLR ligand-induced upregulation of mTNF-α on peritoneal neutrophils.
We next tested the influence of live Toxoplasma on the ability of neutrophils to respond to TLR ligand stimulation. In this set of experiments, we in vitro infected cells isolated from the peritoneal cavities of thioglycolate-injected mice and then 2 h later reisolated cells for flow cytometric analysis. As shown in Fig. 2, using transgenic YFP-expressing tachyzoites, it was possible to unambiguously identify and select for analysis infected versus noninfected Gr-1high F4/80low neutrophils.
FIG. 2.
Toxoplasma-infected and noninfected neutrophils can be distinguished by flow cytometric analysis. Thioglycolate-elicited peritoneal exudate cells were subjected to in vitro infection with transgenic YFP-expressing RH strain tachyzoites (3:1 ratio of parasites to cells). After 2 h, cells were labeled with PerCP-Cy5.5-conjugated anti-Gr-1 Ab and allophycocyanin-conjugated anti-F4/80 Ab. Cells were gated on the Gr-1high F4/80low population, then among this population T. gondii-infected and noninfected (NI) cells were examined. This gating strategy was employed to determine TNF-α expression profiles shown in Fig. 3, 4, and 6.
To determine whether infection with Toxoplasma tachyzoites altered the ability of neutrophils to upregulate mTNF-α, we incubated peritoneal exudate cells with tachyzoites from the highly virulent type I parasite strain RH expressing YFP (Fig. 3A) or from the less virulent type II strain PTG expressing GFP (Fig. 3B). Two hours later, we stimulated the cells with LPS or Pam3Cys for 1 h or with CpG for 4 h and then stained for flow cytometric analysis. The data in Fig. 3 show mTNF-α expression on infected compared to noninfected Gr-1-positive PMN. As demonstrated in Fig. 1, the data in Fig. 3A show that the expression of mTNF-α in cells exposed to TLR ligands was increased relative to cells incubated in medium alone (in each histogram, red line versus thin black line, respectively). When the cells were incubated with RH strain parasites alone, there was a minor increase in mTNF-α in parasite-positive cells that did not occur in noninfected neutrophils in the same population (green line in each histogram). Interestingly, upregulation of mTNF-α was severely reduced when RH-positive cells were subjected to TLR4 (LPS), TLR2 (Pam3Cys), and TLR9 (CpG) triggering (blue line in each histogram). Notably, in the same population of cells, those neutrophils that remained uninfected maintained responsiveness to TLR triggering (blue lines). To determine whether this was a unique property of the RH parasite strain, the same experiment was performed with GFP-labeled PTG tachyzoites (Fig. 3B). The results are similar to those obtained employing the RH strain, but the suppressive effects of PTG appeared to be less severe than those mediated by the virulent parasite strain.
FIG. 3.
T. gondii infected PMN are defective in their ability to upregulate surface expression of TNF-α in response to TLR triggering. Thioglycolate-elicited peritoneal cells were incubated in the presence of medium alone (thin black lines) or exposed to fluorochrome-labeled T. gondii parasites of (A) RH strain and (B) PTG strains (green lines). A 3:1 ratio of parasite:cells was used. After 2 h of exposure to parasites, cells were stimulated with LPS (1 h), Pam3Cys (1 h), or CpG (4 h) (blue lines). Cells incubated in the presence of TLR ligands only are represented by red histograms. The profiles shown are gated on Gr-1high F4/80low cells. Noninfected (NI) cells are shown for comparison. This experiment was repeated twice with essentially identical results.
We also examined accumulation of TNF-α in supernatants of infected PMN subjected to LPS triggering. As shown in Fig. 4, parasites blocked LPS-induced release of neutrophil TNF-α. Nevertheless, the inhibitory effect of Toxoplasma was partial (approximately 55%). This was true even at the very high ratios of parasites to cells where the vast majority of PMN were infected.
FIG. 4.

Toxoplasma partially blocks LPS-induced secretion of neutrophil TNF-α. Purified thioglycolate-elicited neutrophils were infected with the indicated ratios of tachyzoites to cells, and 2 h later, the cells were stimulated with LPS. After 4 h, supernatants were collected for TNF-α enzyme-linked immunosorbent assay. Bar M, cells cultured in medium alone; bar L, uninfected cells cultured with LPS. Cells infected with tachyzoites alone produced <0.3 ng/ml over all parasite doses. This experiment was repeated three times with essentially identical results.
T. gondii blocks neutrophil surface membrane expression of intracellular TNF-α but does not prevent LPS-induced increases in mRNA levels.
We previously identified pools of intracellular TNF-α and newly synthesized cytokine as two LPS-inducible sources of mTNF-α (3). Therefore, the parasite-induced block in TLR-induced mTNF-α could result from interference with one or both of these TNF-α sources. To address this issue, we incubated cells in the presence of the protein synthesis inhibitor cycloheximide prior to culture with LPS. Under these conditions, any increase in mTNF-α must result from mobilization of preformed cytokine rather than from its de novo synthesis.
As shown in Fig. 5, in the absence of CHX, RH tachyzoites partially blocked surface expression of TNF-α in infected neutrophils (Fig. 5A) but had no effect on noninfected (Fig. 5B) neutrophils (red line, LPS; blue line, RH plus LPS). However, T. gondii infection completely blocked the ability of LPS to upregulate mTNF-α in the presence of CHX (Fig. 5C). As expected, in noninfected neutrophils, the parasite did not affect the levels of LPS-induced mTNF-α (Fig. 5D).
FIG. 5.
T. gondii blocks protein synthesis-independent mobilization of intracellular TNF-α to the cell surface. Thioglycolate-elicited peritoneal exudate cells were incubated in medium alone (Med) (A and B) or in the presence of 10 μg/ml cycloheximide (CHX) (C and D) for 30 min. Next, RH strain parasites (3:1 ratio of tachyzoites to cells) were added to the cultures, and after 2 h, the cultures were subjected to LPS stimulation. After 1 h, cells were collected for flow cytometric analysis. The profiles shown are gated on Gr-1high F4/80low cells. Green histogram, mTNF-α expression in the absence of LPS; red histogram, control profile showing mTNF-α expression in response to LPS alone; blue histogram, cells cultured with parasites followed by LPS stimulation. Noninfected (NI) cells are shown for comparison. Data are representative of three different experiments.
The findings in Fig. 5 point to preformed intracellular pools of TNF-α as a target of manipulation by T. gondii. To support this result, we measured TNF-α mRNA expression levels in noninfected and infected neutrophils subjected to LPS triggering. In this experiment purified PMN were preinfected with RH strain tachyzoites and then 1, 2, and 4 h later cells were subjected to 60 min of stimulation with LPS. Using conditions where >85% of neutrophils were infected, RH alone failed to elicit increases in TNF-α mRNA at any time point (Fig. 6A). In contrast, stimulation with LPS alone resulted in increased transcripts for TNF-α (Fig. 6A, lane LPS). Most importantly, preinfection with T. gondii for 1 to 4 h did not affect the ability to upregulate TNF-α mRNA levels in response to LPS. This result provides independent evidence that the parasite interferes with mobilization of intracellular pools of the cytokine, rather than blocking de novo TNF-α synthesis. We also examined LPS-induced CD11b mRNA upregulation and found that it, too, was unaffected by T. gondii infection (Fig. 6B).
FIG. 6.
T. gondii does not interfere with LPS-induced upregulation of TNF-α mRNA. Thioglycolate-elicited purified peritoneal PMN were incubated in medium alone (Med) or in the presence of RH strain tachyzoites for the indicated times. Next, parasite-exposed cells were stimulated with LPS for 1 h. As a positive control, purified peritoneal PMN were triggered with LPS for 1 h in the absence of T. gondii (LPS lanes). RNA was subsequently isolated and reverse transcribed, and the resulting cDNA was amplified with primers specific for TNF-α (Α) and CD11b (B). An internal control (β-actin) was amplified for comparison. Results are representative of two independent experiments.
TNF-α is retained in intracellular form in infected cells.
We next stimulated PMN with LPS and then assessed intracellular TNF-α levels in infected versus noninfected cells. We previously reported that within 10 min of LPS stimulation, the intracellular pool of this cytokine decreased, and we confirm here that LPS stimulation decreases the mean fluorescence intensity of cells stained for intracellular TNF-α (Fig. 7A, LPS). When intracellular TNF-α was assessed in parasite-infected neutrophils, there was no change in intracellular TNF-α levels (Fig. 7A, RH). Furthermore, LPS stimulation of RH-infected PMN failed to result in decreased intracellular TNF-α (Fig. 7A, RH+LPS). In contrast, when noninfected PMN in the same population were assessed for intracellular TNF-α, the presence of parasites did not alter the ability of LPS to decrease the level of intracellular cytokine (Fig. 7B, LPS versus RH+LPS). Taken together, the data argue that neutrophils infected with T. gondii cannot mobilize intracellular pools of TNF-α to the surface membrane when the cells are activated by TLR4 ligand LPS. In contrast, the ability of LPS to upregulate transcription of TNF-α is unaffected by the parasite.
FIG. 7.
T. gondii prevents intracellular TNF-α from translocating to the cell surface of peritoneal PMN. Intracellular TNF-α was examined in thioglycolate-elicited cells by blocking surface TNF-α using an unlabeled rat anti-mouse TNF-α Ab, then fixing and permeabilizing cells, followed by staining with a hamster anti-mouse TNF-α Ab to reveal intracellular expression of TNF-α. The bar graphs show the differences in the mean fluorescence intensity (ΔmFI) of parasite- and LPS-exposed cells relative to unstimulated cells. The profiles shown are gated on (A) infected Gr1high F4/80low and (B) noninfected Gr1high F4/80low cells. The cells were exposed to different treatments as follows: LPS, cells were exposed to LPS for 10 min; RH, cells were cocultured with parasites for 2 h; RH+LPS, cells were exposed to RH for 2 h followed by 10 min of stimulation with LPS. Noninfected (NI) cells are shown for comparison. This experiment was repeated twice with essentially identical results.
DISCUSSION
The cytokine TNF-α is an important pleiotropic mediator that displays protective effects through its ability to activate innate immunity, as well as pathological effects when its production is dysregulated (19). Gene knockout studies in mice have demonstrated that TNF-α is required for long-term survival during Toxoplasma infection, although its expression is dispensable during acute infection (31, 38). In the context of oral T. gondii infection, TNF-α mediates immunopathology in the small intestine that underlies tissue necrosis and death in susceptible mouse strains (23, 34).
The results of the present study demonstrate that PMN infected with the protozoan T. gondii are unable to mobilize intracellular TNF-α pools to the cell surface during TLR4 triggering. Direct infection was required for this inhibitory effect, because noninfected neutrophils upregulated TNF-α in a mixed population of infected and noninfected cells. Nevertheless, the parasite did not prevent LPS-induced upregulation of TNF-α gene transcription. Furthermore, when de novo protein synthesis was blocked with cycloheximide, tachyzoites completely blocked TLR-induced TNF-α surface expression in contrast to less complete effects seen in the absence of the drug. The combined results argue that TLR4-stimulated neutrophils increase mTNF-α through mechanisms involving both increased gene transcription and surface mobilization of intracellular cytokine and that Toxoplasma targets the latter pathway for disassembly. The data in Fig. 3 suggest that T. gondii infection has similar effects on triggering and signaling through TLR2 and TLR9. Whether this is the case and whether signaling through other neutrophil TLRs is similarly affected are currently under investigation.
TNF-α is expressed in the surface membrane-bound form prior to enzymatic cleavage and release, suggesting that the cytokine and its receptors, TNF receptor I (TNFRI) and TNFRII, may be important in directing cell-to-cell interactions. In this regard, we recently showed that triggering mouse neutrophils with TLR4 ligand LPS rapidly mobilizes intracellular stores of TNF-α to the cell surface (3). Neutrophil expression of mTNF-α induces strong cell contact-dependent dendritic cell activation, suggesting that such interactions may be important during initiation of innate immunity.
The TNF-α expressed in membrane-associated form on the cell surface is functionally distinct from the cytokine released from the cell. For example, while soluble TNF-α is the predominant form driving autoimmune inflammation, the membrane-bound cytokine is sufficient to support secondary lymphoid organ ultrastructure (29). Transmembrane TNF-α is the primary ligand for TNFRII (18). Because mTNF-α also signals through TNFRI, cooperativity between the receptors leads to cellular responses stronger than those induced by the soluble cytokine. In this regard, we recently reported that neutrophil mTNF-α was an extremely potent activator of dendritic cells, displaying an activity superior to that of soluble TNF-α (2, 3). Recently, it was found that membrane and soluble TNF display disparate effects during Mycobacterium tuberculosis infection in mice in that mTNF-α alone could induce cell migration and granuloma formation and early resistance but that long-term control of this pathogen required soluble TNF (30). The effects of membrane versus soluble TNF-α during Toxoplasma infection remain to be investigated.
We and others have reported the ability of T. gondii to suppress responses in bone marrow-derived macrophages and dendritic cells (9, 13, 25). Release of LPS triggered TNF-α, and IL-12 is prevented in both cell types. Infection of immature dendritic cells also renders the cells unable to attain a maturation status required for T-cell activation (25). For macrophages, the suppressive effects of Toxoplasma involve cytokine-independent activation of signal transducer and activator of transcription 3 (STAT3), possibly acting in part through inhibition of NF-κB and p38 mitogen-activated protein kinase (MAPK) activity (9, 10, 21, 33). The results reported here show for the first time parasite-induced suppression of PMN responsiveness. Nonetheless, unlike the effects of T. gondii on macrophages, the parasite does not block de novo TNF-α synthesis in neutrophils, instead targeting mobilization of intracellular cytokine.
At present, we cannot distinguish whether Toxoplasma specifically blocks mobilization of preformed TNF-α or whether the parasite blocks exocytosis of both preformed and newly synthesized cytokine. Nevertheless, the data in Fig. 5 suggest that surface expression of preformed TNF-α may be specifically targeted. This is because the parasite completely blocks LPS-triggered mTNF-α expression under conditions where de novo protein synthesis is blocked. In addition, the inability to completely block LPS-induced TNF-α release is also consistent with a mechanism of PMN TNF-α secretion that is not affected by the parasite. Further experiments are required to definitively address this issue.
Although we find that T. gondii blocks mobilization of preformed TNF-α to the neutrophil surface, our previous studies demonstrated neutrophil release of TNF-α in response to the parasite (2, 8). However, our previous studies were performed on supernatants from overnight cultures of parasites and cells. Therefore, TNF-α secretion could result from an alleviation in the block in release of newly synthesized cytokine in long-term culture. Additionally, many of our previous studies employed soluble tachyzoite lysates (8, 12), a situation clearly distinct from the live tachyzoites that were employed in the present study. We also found that TNF-α-dependent PMN activation of dendritic cells was consistently more efficient when neutrophils were subjected to triggering with low tachyzoite numbers (2). The latter suggests that uninfected PMN respond to secreted parasite molecules or products of infected cells and that parasite-infected cells per se are targeted for suppression.
Why Toxoplasma would inhibit TLR signaling leading to neutrophil TNF-α mobilization is currently a matter for speculation. This may be a means by which the parasite avoids TNF-α induction mediated by its own TLR ligands that it is known to express (40). Alternatively, it is possible that infection-induced exposure to bacterial TLR ligands requires the parasite to block responses to endotoxins and other inflammatory bacterial products.
The finding that Toxoplasma-infected neutrophils cannot mobilize preformed pools of intracellular TNF-α to the cell surface raises the possibility that the parasite has the capacity to generally block neutrophil exocytosis of preformed mediators. In this regard, PMN are well-known to harbor granules rich in potent microbicidal molecules, such as myeloperoxidase, cathepsin G, and neutrophil elastase (26, 32). These mediators are rapidly released into the extracellular milieu or fuse with phagocytic vacuoles upon microbial stimulation. Inhibition of surface expression of preformed TNF-α may reflect a general parasite-induced blockade in mobilization of neutrophil granules and as such could represent a major defensive strategy of the parasite.
Acknowledgments
This work was supported by National Institutes of Health grant AI47888.
We thank L. Kim, B. Butcher, and C. Egan for insightful discussions and C. Egan for assistance with flow cytometry.
Editor: J. F. Urban, Jr.
REFERENCES
- 1.Alexander, J., and C. A. Hunter. 1998. Immunoregulation during toxoplasmosis. Chem. Immunol. 70:81-102. [DOI] [PubMed] [Google Scholar]
- 2.Bennouna, S., S. K. Bliss, T. J. Curiel, and E. Y. Denkers. 2003. Cross-talk in the innate immune system: neutrophils instruct early recruitment and activation of dendritic cells during microbial infection. J. Immunol. 171:6052-6058. [DOI] [PubMed] [Google Scholar]
- 3.Bennouna, S., and E. Y. Denkers. 2005. Microbial antigen triggers rapid mobilization of TNF-α to the surface of mouse neutrophils transforming them into inducers of high level dendritic cell TNF-α production. J. Immunol. 174:4845-4851. [DOI] [PubMed] [Google Scholar]
- 4.Black, R. A. 2002. Tumor necrosis factor-alpha converting enzyme. Int. J. Biochem. Cell Biol. 34:1-5. [DOI] [PubMed] [Google Scholar]
- 5.Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack, M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, N. Nelson, N. Boiani, K. A. Schooley, M. Gerhart, R. Davis, J. N. Fitzner, R. S. Johnson, R. J. Paxton, C. J. March, and D. P. Cerretti. 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385:729-733. [DOI] [PubMed] [Google Scholar]
- 6.Bliss, S. K., B. A. Butcher, and E. Y. Denkers. 2000. Rapid recruitment of neutrophils with prestored IL-12 during microbial infection. J. Immunol. 165:4515-4521. [DOI] [PubMed] [Google Scholar]
- 7.Bliss, S. K., A. J. Marshall, Y. Zhang, and E. Y. Denkers. 1999. Human polymorphonuclear leukocytes produce IL-12, TNF-α, and the chemokines macrophage-inflammatory protein-1α and -1β in response to Toxoplasma gondii antigens. J. Immunol. 162:7369-7375. [PubMed] [Google Scholar]
- 8.Bliss, S. K., Y. Zhang, and E. Y. Denkers. 1999. Murine neutrophil stimulation by Toxoplasma gondii antigen drives high level production of IFN-γ-independent IL-12. J. Immunol. 163:2081-2088. [PubMed] [Google Scholar]
- 9.Butcher, B. A., L. Kim, P. F. Johnson, and E. Y. Denkers. 2001. Toxoplasma gondii tachyzoites inhibit proinflammatory cytokine induction in infected macrophages by preventing nuclear translocation of the transcription factor NFκB. J. Immunol. 167:2193-2201. [DOI] [PubMed] [Google Scholar]
- 10.Butcher, B. A., L. Kim, A. Panopoulos, S. S. Watowich, P. J. Murray, and E. Y. Denkers. 2005. IL-10-independent STAT3 activation by Toxoplasma gondii mediates suppression of IL-12 and TNF-α in host macrophages. J. Immunol. 174:3148-3152. [DOI] [PubMed] [Google Scholar]
- 11.Cassatella, M. A. 1999. Neutrophil-derived proteins: selling cytokines by the pound. Adv. Immunol. 73:369-509. [DOI] [PubMed] [Google Scholar]
- 12.Del Rio, L., B. A. Butcher, S. Bennouna, S. Hieny, A. Sher, and E. Y. Denkers. 2004. Toxoplasma gondii triggers myeloid differentiation factor 88-dependent IL-12 and chemokine ligand 2 (monocyte chemoattractant protein 1) responses using distinct parasite molecules and host receptors. J. Immunol. 172:6954-6960. [DOI] [PubMed] [Google Scholar]
- 13.Denkers, E. Y., B. A. Butcher, L. Del Rio, and L. Kim. 2004. Manipulation of mitogen-activated protein kinase/nuclear factor-κB-signaling cascades during intracellular Toxoplasma gondii infection. Immunol. Rev. 201:191-205. [DOI] [PubMed] [Google Scholar]
- 14.Denkers, E. Y., L. D. Del Rio, and S. Bennouna. 2003. Neutrophil production of IL-12 and other cytokines during microbial infection. Chem. Immunol. Allergy 83:95-114. [DOI] [PubMed] [Google Scholar]
- 15.Denkers, E. Y., and R. T. Gazzinelli. 1998. Regulation and function of T-cell-mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. 11:569-588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Denkers, E. Y., L. Kim, and B. A. Butcher. 2003. In the belly of the beast: subversion of macrophage proinflammatory signaling cascades during Toxoplasma gondii infection. Cell. Microbiol. 5:75-83. [DOI] [PubMed] [Google Scholar]
- 17.Dubey, J. P. 1998. Advances in the life cycle of Toxoplasma gondii. Int. J. Parasitol. 28:1019-1024. [DOI] [PubMed] [Google Scholar]
- 18.Grell, M., E. Douni, H. Wajant, M. Lohden, M. Clauss, B. Maxeiner, S. Georgopolous, W. Lesslauer, G. Kollias, K. Pfizenmaier, and P. Scheurich. 1995. The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80 kDa tumor necrosis factor receptor. Cell 83:793-802. [DOI] [PubMed] [Google Scholar]
- 19.Hehlgans, T., and K. Pfeffer. 2005. The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology 115:1-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hill, D., and J. P. Dubey. 2002. Toxoplasma gondii: transmission, diagnosis and prevention. Clin. Microbiol. Infect. 8:634-640. [DOI] [PubMed] [Google Scholar]
- 21.Kim, L., B. A. Butcher, and E. Y. Denkers. 2004. Toxoplasma gondii interferes with lipopolysaccharide-induced mitogen-activated protein kinase activation by mechanisms distinct from endotoxin tolerance. J. Immunol. 172:3003-3010. [DOI] [PubMed] [Google Scholar]
- 22.Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, and D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 5:190-198. [DOI] [PubMed] [Google Scholar]
- 23.Liesenfeld, O., H. Kang, D. Park, T. A. Nguyen, C. V. Parkhe, H. Watanabe, T. Abo, A. Sher, J. S. Remington, and Y. Suzuki. 1999. TNF-α, nitric oxide and IFN-γ are all critical for development of necrosis in the small intestine and early mortality in genetically susceptible mice infected perorally with Toxoplasma gondii. Parasite Immunol. 21:365-376. [DOI] [PubMed] [Google Scholar]
- 24.Luft, B. J., and J. S. Remington. 1992. Toxoplasmic encephalitis in AIDS. Clin. Infect. Dis. 15:211-222. [DOI] [PubMed] [Google Scholar]
- 25.McKee, A. S., F. Dzierszinski, M. Boes, D. S. Roos, and E. J. Pearce. 2004. Functional inactivation of immature dendritic cells by the intracellular parasite Toxoplasma gondii. J. Immunol. 173:2632-2640. [DOI] [PubMed] [Google Scholar]
- 26.Reeves, E. P., H. Lu, H. L. Jacobs, C. G. Messina, S. Bolsover, G. Gabella, E. O. Potma, A. Warley, J. Roes, and A. W. Segal. 2002. Killing activity of neutrophils is mediated through activation of proteases by K+ flux. Nature 416:291-297. [DOI] [PubMed] [Google Scholar]
- 27.Remington, J. S., R. McLeod, and G. Desmonts. 1995. Toxoplasmosis, p. 140-267. In J. S. Remington and J. O. Klein (ed.), Infectious diseases of the fetus and newborn infant. W. B. Saunders Co., Philadelphia, Pa.
- 28.Romani, L., A. Mencacci, E. Cenci, G. Del Sero, F. Bistoni, and P. Puccetti. 1997. An immunoregulatory role for neutrophils in CD4+ T helper subset selection in mice with candidiasis. J. Immunol. 158:2356-2362. [PubMed] [Google Scholar]
- 29.Ruuls, S. R., R. M. Hoek, V. N. Ngo, T. McNeil, L. A. Lucian, M. J. Janatpour, H. Korner, H. Scheerens, E. M. Hessel, J. G. Cyster, L. M. McEvoy, and J. D. Sedgwick. 2001. Membrane-bound TNF supports secondary lymphoid organ structure but is subservient to secreted TNF in driving autoimmune inflammation. Immunity 15:533-543. [DOI] [PubMed] [Google Scholar]
- 30.Saunders, B. M., S. Tran, S. Ruuls, J. D. Sedgwick, H. Briscoe, and W. J. Britton. 2005. Transmembrane TNF is sufficient to initiate cell migration and granuloma formation and provide acute, but not long-term, control of Mycobacterium tuberculosis infection. J. Immunol. 174:4852-4859. [DOI] [PubMed] [Google Scholar]
- 31.Schluter, D., L.-Y. Kwok, S. Lutjen, S. Soltek, S. Hoffmann, H. Korner, and M. Deckert. 2003. Both lymphotoxin-α and TNF are crucial for control of Toxoplasma gondii in the central nervous system. J. Immunol. 170:6172-6182. [DOI] [PubMed] [Google Scholar]
- 32.Segal, A. W. 2005. How neutrophils kill microbes. Annu. Rev. Immunol. 23:197-223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Shapira, S. S., K. Speirs, A. Gerstein, J. Caamano, and C. A. Hunter. 2002. Suppression of NF-κB activation by infection with Toxoplasma gondii. J. Infect. Dis. 185:S66-S72. [DOI] [PubMed] [Google Scholar]
- 34.Suzuki, Y., A. Sher, G. Yap, D. Park, L. Ellis Neyer, O. Liesenfeld, M. Fort, H. Kang, and E. Gufwoli. 2000. IL-10 is required for prevention of necrosis in the small intestine and mortality in both genetically resistant BALB/c and susceptible C57BL/6 mice following peroral infection with Toxoplasma gondii. J. Immunol. 164:5375-5382. [DOI] [PubMed] [Google Scholar]
- 35.Takeda, K., and S. Akira. 2005. Toll-like receptors in innate immunity. Int. Immunol. 17:1-14. [DOI] [PubMed] [Google Scholar]
- 36.Tsuda, Y., H. Takahashi, M. Kobayashi, T. Hanafusa, D. N. Herndon, and F. Suzuki. 2004. Three different neutrophil subsets exhibited in mice with different susceptibilities to infection by methicillin-resistant Staphylococcus aureus. Immunity 21:215-226. [DOI] [PubMed] [Google Scholar]
- 37.van Gisbergen, K. P., M. Sanchez-Hernandez, T. B. Geijteenbeek, and Y. van Kooyk. 2005. Neutrophils mediate immune modulation of dendritic cells through glycosylation-dependent interactions between Mac-1 and DC-SIGN. J. Exp. Med. 201:1281-1292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yap, G. S., T. Scharton-Kersten, H. Charest, and A. Sher. 1998. Decreased resistance of TNF receptor p55- and p75-deficient mice to chronic toxoplasmosis despite normal activation of inducible nitric oxide synthase in vivo. J. Immunol. 160:1340-1345. [PubMed] [Google Scholar]
- 39.Yap, G. S., and A. Sher. 1999. Cell-mediated immunity to Toxoplasma gondii: initiation, regulation and effector function. Immunobiology 201:240-247. [DOI] [PubMed] [Google Scholar]
- 40.Yarovinsky, F., D. Zhang, J. F. Anderson, G. L. Bannenberg, C. N. Serhan, M. S. Hayden, S. Hieny, F. S. Sutterwala, R. A. Flavell, S. Ghosh, and A. Sher. 2005. TLR11 activation of dendritic cells by a protozoan profilin-like protein. Science 308:1626-1629. [DOI] [PubMed] [Google Scholar]






