Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2006 Jul;74(7):3756–3764. doi: 10.1128/IAI.00307-06

Bacillus anthracis Phospholipases C Facilitate Macrophage-Associated Growth and Contribute to Virulence in a Murine Model of Inhalation Anthrax

Brian J Heffernan 1, Brendan Thomason 1, Amy Herring-Palmer 1, Lee Shaughnessy 1, Rod McDonald 1, Nathan Fisher 1, Gary B Huffnagle 1, Philip Hanna 1,*
PMCID: PMC1489738  PMID: 16790747

Abstract

Several models of anthrax pathogenesis suggest that early in the infectious process Bacillus anthracis endospores germinate and outgrow into vegetative bacilli within phagocytes before being released into the blood. Here, we define the respective contributions of three phospholipases C (PLCs) to the pathogenesis of B. anthracis. Genetic deletions of the PLCs were made in the Sterne 7702 background, resulting in the respective loss of their activities. The PLCs were redundant both in tissue culture and in murine models of anthrax. Deletion of all three PLC genes was required for attenuation of virulence in mice after intratracheal inoculation. This attenuation may be attributed to the inability of the PLC-null strain to grow in association with the macrophage. Complementation of these defects in both models of anthrax was achieved by expression of the PLC genes in trans. The functional redundancy between PLCs in the virulence of B. anthracis implies that their activities are important for anthrax pathogenesis.


Anthrax results from the introduction of Bacillus anthracis endospores into the body through abrasions in the skin, by the ingestion of contaminated foods, or by inhalation (5). During the establishment of inhalation anthrax, B. anthracis is believed to have a transient intracellular phase in which endospores are engulfed by alveolar phagocytes and are trafficked to regional lymph nodes (12, 28). Endospores germinate in association with the phagocytic cells resulting in the outgrowth of vegetative bacilli, which are eventually released from the phagocyte into the extracellular environment (4, 12). B. anthracis then enters the circulatory and lymphatic systems and grows to high titers, causing massive septicemia, toxemia, and often death.

Nascent B. anthracis bacilli associated with macrophages were shown to express atxA (AtxA), a transcriptional activator of three exotoxin genes (pag, lef, and cya) whose products combine to form two binary A-B exotoxins: lethal toxin (LeTx) and edema toxin (EdTx) (12). LeTx and EdTx are expressed throughout anthrax infections and are key virulence factors required for B. anthracis pathogenesis (5). The structural genes and the transcriptional activator required for the expression of the two exotoxins are encoded on the 185-kb virulence plasmid, pXO1 (21). B. anthracis contains a second virulence plasmid, pXO2, which encodes the genes required for the synthesis of the poly-d-glutamic acid capsule (18). The capsule confers serum resistance and hinders the ability of immune cells to phagocytose the bacilli. B. anthracis strains deficient in the production of either the exotoxins or the capsule are attenuated for virulence.

Despite the importance of the two exotoxins and capsule in the pathogenesis of B. anthracis, they appear to be not absolutely required during the early, intracellular stages of infection. The nonencapsulated, nontoxigenic ΔSterne strain (pXO1 pXO2) replicates in the cytoplasm of cultured macrophages in a manner similar to the isogenic Sterne strain (pXO1+ pXO2) (4, 29). This suggests that chromosomally encoded genes facilitate survival and replication in association with the macrophage. We hypothesized that B. anthracis may utilize phospholipases during these initial events in anthrax pathogenesis. Three genes were annotated on the B. anthracis genome that encodes putative phospholipases C (PLCs) (26). These genes have high homology to B. cereus and Listeria monocytogenes phosphatidylcholine PLC (plcB; PC-PLC; BA0677), sphingomyelinase (smcA; SMase; BA0678), and phosphatidylinositol-specific PLC (plcA; PI-PLC; BA3891) (26).

PLCs hydrolyze the polar head groups from phospholipids. They exhibit a broad range of specificities dependent upon recognition of the polar head group and the hydrophobic moiety. For example, PC-PLC is able to act both on phosphatidylcholine and a variety of other phospholipids, whereas SMase and PI-PLC are restricted to sphingomyelin and phosphatidylinositol, respectively (37). Phospholipases are known to contribute to the pathogenesis of a variety of bacteria by participating in phosphate acquisition, deregulation of cellular signaling, tissue destruction, and degradation of mucus layers (30). In L. monocytogenes, PLCs are used in combination with the pore-forming cytolysin listeriolysin O (LLO) to disrupt phagosomal membranes and aid in the escape of L. monocytogenes into the cytosol (9).

PC-PLC, PI-PLC, and SMase of B. cereus are expressed as part of a regulon under the control of the transcriptional activator PlcR (8). B. anthracis encodes a PlcR homologue that has a C-terminal truncation due to a nonsense mutation but still expresses the regulon, albeit weakly (20). Transcript was detected for plcB, smcA, and plcA in vitro during B. anthracis infections of cultured macrophages (15). In addition, plasma from guinea pigs dying of anthrax displayed higher levels of PLC activity versus culture filtrates of B. anthracis, implying that they may play a role in the disease (45). Recently, it was shown by ectopic expression of each B. anthracis PLC gene in Escherichia coli and L. monocytogenes that the genes encode functional proteins with activities similar to their corresponding B. cereus orthologues (25, 40). In the present study we used a genetic approach to determine the contributions of PLCs to B. anthracis pathogenesis. The genes encoding each PLC were disrupted, both individually and in combination, in order to investigate their functions in vitro using a cultured macrophage model of infection and in vivo with mice challenged via an intratracheal route.

MATERIALS AND METHODS

Growth conditions and strain construction.

Bacterial strains, plasmids, and phages relevant to the present study are listed in Table 1. E. coli and B. anthracis strains were cultured in Luria-Bertani (LB) medium and brain heart infusion (BHI; Difco) medium, respectively. The medium was supplemented with antibiotics to maintain selection at the following concentrations: ampicillin (100 μg/ml), chloramphenicol (10 μg/ml), erythromycin (1 μg/ml), kanamycin (50 μg/ml), and spectinomycin (100 μg/ml). CCY medium was used for B. anthracis sporulation (34). Endospores were prepared as previous described and stored in 1-ml aliquots of sterile water after a 30-min incubation at 65°C (4). Endospore germination was analyzed at 37°C by measuring the decrease in optical density as described previously (6). Briefly, endospores were suspended in double-distilled H2O to an optical density at 600 nm of about 0.5, and 2× BHI was added at a 1:1 ratio to initiate the germination reaction.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain, plasmid, or phage Relevant genotypea Source or reference
Strains
    B. anthracis
        Sterne 7702 pXO1+ pXO2 24
        ΔSterne pXO1 pXO2 This study, Sterne cured of pXO1
        BJH035 7702, Δlef::Kmr This study
        BJH108 7702, ΔplcB::Spr This study
        BJH109 7702, ΔplcR::Spr This study
        BJH121 7702, ΔplcBsmcA::Spr This study
        BJH217 7702, ΔplcA::Emr This study
        BJH236 7702, ΔsmcA::Spr This study
        BJH238 7702, ΔsmcA::Spr ΔplcA::Emr This study
        BJH249 7702, ΔplcB::Spr ΔplcA::Emr This study
        BJH250 7702, ΔplcBsmcA::Spr ΔplcA::Emr This study
        BJH251 7702, Δlef::Kmr ΔplcBsmcA::Spr ΔplcA::Emr This study
    B. subtilis 168 trpC2 1
    E. coli
        XL1-Blue MRF′ recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)] Stratagene
        DH5α F φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17 (rK mK+) phoA supE44 thi-1 gyrA96 relA1 λ Invitrogen
        One Shot TOP10 FmcrA Δ(mrr-hsdRMS-mcrBC) φ80 lacZΔM15 ΔlacX74 recA1 araD139 Δ(araleu)7697 galU galK rpsL (Strr) endA1 nupG Invitrogen
        One Shot INV110 F′ [traΔ36 proAB lacIqlacZΔM15] rpsL (Strr) thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 Δ(lac-proAB) Δ(mcrC-mrr) 102::Tn10 (Tetr) Invitrogen
        CGSC 6478 GM272 (dam-3 dcm-6) 22
Plasmids
    pUC19 pBR322 derivative lacZα; Apr 43
    pDG641 pJRD184::Emr 11
    pDG783 pSB118::Kmr 11
    pDG1726 pSB119::Spr 11
    pCR-XL-TOPO Plac lacZα ccdB Kmr pUCori Invitrogen
    pHP13 pUC19ori pTA1060ori; Cmr Emr 14
    pKSV7 pUC19ori pE194ori(ts); Apr Cmr 33
    pBH010 pKSV7(Δlef::Kmr) This study
    pBH024 pKSV7(ΔsmcA::Spr) This study
    pBH027 pKSV7(ΔplcBsmcA::Spr) This study
    pBH032 pKSV7(ΔplcB::Spr) This study
    pBH040 pKSV7(ΔplcR::Spr) This study
    pBH093 pKSV7(ΔplcA::Emr) This study
    pBH095 pHP13::plcB smcA plcA This study
Phage CP-51 Generalized transducing phage 35
a

Cmr, chloramphenicol resistance; Tetr, tetracycline resistance; Apr, ampicillin resistance; Spr, spectinomycin resistance; Strr, streptomycin resistance; Emr, erythromycin resistance; Kmr, kanamycin resistance.

Plasmid constructs were made in E. coli XL1-Blue or DH5α backgrounds except for the complementation vector, which was constructed in B. subtilis strain 168 due to the apparent selection against a functional plcB gene in E. coli. Oligonucleotide primers were designed using the genome sequence of the B. anthracis Ames strain. Primer sequences used in the present study are listed in Table 2. The Expand High Fidelity System (Roche) was used for PCR amplification. Deletion constructs were made as previously described (3). Briefly, the gene of interest was cloned into either pUC19 or pCR-XL-TOPO vectors, and the internal portion was deleted through inverse PCR and replaced with an antibiotic cassette. The gene fragment containing the inserted cassette was cloned into the temperature-sensitive shuttle vector pKSV7. The plasmid construct was passaged through a methylation deficient E. coli strain before being transformed into Sterne 7702 as described previously (16, 39). After a series of passages at both nonpermissive and permissive temperatures for pKSV7 replication, a deletion of the target gene was obtained via allelic replacement. Deletions were confirmed by PCR and Southern blot hybridizations. All deletion strains were constructed with the allelic replacement technique except the Δlef ΔplcBsmcAplcA strain. CP-51 transducing phage was utilized in order to introduce Δlef into the ΔplcBsmcAplcA background. Transductions with CP-51 were carried out as described elsewhere (42). A ΔSterne strain was obtained after passage of the Δlef::Kmr mutant at elevated temperatures (41°C) in Casamino Acids medium (36) and screening for the loss of the kanamycin marker. This strain was also confirmed by PCR. The complementation vector was created by cloning plcB, smcA, and plcA, along with at least 500 bp upstream of each start codon into the low-copy vector, pHP13.

TABLE 2.

Primer sequences

Primer Sequence (5′-3′)a Application Restriction site
plcB5 AACTGCAGAACCAATGCATTGGTTAGTGTGGTCACGTTGACG Amplify plcB from 5′ (deletion construct) PstI
plcB5 TCCCCCCGGGGGGAATCAGCACGCTCACTTTGTC Amplify plcB from 3′ (deletion construct) XmaI
plcB5 TCCCCGCGGGGACAATCGCACGGTTTACAATCC Inverse primer plcB (deletion construct) SacII
plcB4 GAAGATCTTCGGAGATGTAAACCAACCGATG Inverse primer plcB (deletion construct) BglII
smcA6 AACTGCAGAACCAATGCATTGGGAAGATTGGATCCATGGAGC Amplify smcA from 5′ (deletion construct) PstI
smcA6 GGAATTCCTGAGCCCTTGCTTTGTTAGC Amplify smcA from 3′ (deletion construct) EcoRI
smcA5 GACTAGTCTGCGTCCCAATTACATGAACG Inverse primer smcA (deletion construct) SpeI
smcA5 GAAGATCTTCGCATCTGTACGTACAAACCAG Inverse primer smcA (deletion construct) BglII
plcA11 CGGGGTACCCCGAGAGCAAAGTCGAAGTGCTG Amplify plcA from 5′ (deletion construct) KpnI
plcA11 CGGGATCCCGCTTTCCGTAATTCTCCTCCAC Amplify plcA from 3′ (deletion construct) BamHI
plcA11 TCCCCGCGGGGAGATATGAAAGGTGCAGAAGGTTC Inverse primer plcA (deletion construct) SacII
plcA11 GAAGATCTTCGAACGTCCCACTATCATGTG Inverse primer plcA (deletion construct) BglII
lef1 GGGGTACCCCGTAACAGCAATTACTTTGAGTGGTC Amplify lef from 5′ (deletion construct) KpnI
lef1 CGGGATCCCGTTATGCACGTTGAATGTAATAAGC Amplify lef from 3′ (deletion construct) BamHI
lef2 TCCCCGCGGGGAGTCTGTGGGATGTTCCTTAAGC Inverse primer lef (deletion construct) SacII
lef2 GACTAGTCCAATCCATTGGAAGTACCTTG Inverse primer lef (deletion construct) SpeI
plcR1 ACTAGCCCTTTAGAGGAAGC Amplify plcR from 3′ (deletion construct)
plcR2 GCTACTTGCGAAAGAGGGAA Amplify plcR from 5′ (deletion construct)
plcR3 TTGGCGCGCCAAGCTCAATCAACAATTGGCAGG Inverse primer plcR (deletion construct) AscI
plcR3 TCCCCGCGGGGACACTTCCTAATTTTTCTGCGTGC Inverse primer plcR (deletion construct) SacII
kan2 GACTAGTCGAGGATGAAGAGGATGAGGA Amplify kan from 5′ (kanamycin cassette) SpeI
kan1 TCCCCGCGGGGAAAATTCCTCGTAGGCGCTCG Amplify kan from 3′ (kanamycin cassette) SacII
spc3 TTGGCGCGCCAACGATTTTCGTTCGTGAATACATG Amplify spc from 5′ (spectinomycin cassette) AscI
spc1 GAAGATCTTCCGATTTTCGTTCGTGAATACATG Amplify spc from 5′ (spectinomycin cassette) BglII
spc1 GACTAGTCCATATGCAAGGGTTTATTGTTTTCTAAA Amplify spc from 3′ (spectinomycin cassette) SpeI
spc2 TCCCCGCGGGGACATATGCAAGGGTTTATTGTTTTCTAAA Amplify spc from 3′ (spectinomycin cassette) SacII
erm4 TCCCCGCGGGGAAGTCGTTAAACCGTGTGCTC Amplify erm from 5′ (erythromycin cassette) SacII
erm4 GAAGATCTTCCTTTTTTCGCACCAGCGAAAAC Amplify erm from 3′ (erythromycin cassette) BglII
plcB9 TCCCCCCGGGGGGACTTGTTTACGAGCGTGGAAAG Amplify plcB from 5′ (complementation) XmaI
smcA9 AACTGCAGCCAATGCATTGGAACCTTTGCATAACCGGAACAG Amplify smcA from 3′ (complementation) PstI
plcA6 GAAGATCTTCCACCGATGAAAGGGACACTA Amplify plcA from 5′ (complementation) BglII
plcA7 GAAGATCTTCCTTTCCGTAATTCTCCTCCAC Amplify plcA from 3′ (complementation) BglII
a

Restriction sites are underlined.

PLC assay plates.

To detect PLC activity, 5 μl of an overnight B. anthracis culture grown at 37°C in BHI was spotted onto the appropriate assay plate and incubated for 36 h at 37 or 40°C. PC-PLC activity was detected on McClung Toabe agar (75 g/liter; Difco) supplemented with 50% egg yolk enrichment (Difco) to achieve a final concentration of 10% egg yolk. After incubation, colonies were removed by washing the samples to reveal the opaque zones underneath. TSA II 5% sheep blood agar (Difco) was supplemented with 1 mM MgCl2 and 1 mM CaCl2 to detect sphingomyelinase activity. Βeta-hemolytic zones were enhanced upon incubation at elevated temperatures (40°C). PI-PLC activity was evident on BHI agar (15 g/liter) supplemented with 500 μg of 5-bromo-4-chloro-3-indoxyl-myoinositol-1-phosphate (X-PI; Glycosynth)/ml. Strains possessing PI-PLC activity were indicated by blue colonies.

Mouse infections.

An intratracheal model of inhalation anthrax was utilized for virulence studies. Six- to eight-week-old female DBA/2J mice (Jackson Laboratories) were anesthetized by the intraperitoneal injection of ketamine (120 mg/kg) and xylazine (5 mg/kg) and restrained on a surgical board. A small incision was made through the skin above the trachea. A 30-gauge needle was inserted into the trachea, and a 30-μl suspension of B. anthracis endospores was delivered directly into the lungs. After injection, the incision was closed with a cyanoacrylate adhesive. The inoculum doses were 102, 103, 104, and 105 endospores. For infections with the Δlef and Δlef plcBsmcAplcA strains the following inoculum doses were used: 105, 106, 107, 108, and 109 endospores. A total of eight mice per dose were used, and the experiments were repeated twice. Mice were monitored for a period of 2 weeks, with a majority of the mortalities occurring over the first 3 days. B. anthracis strains were recovered from the spleen, blood and/or lungs following mortality and confirmed. The 50% lethal dose (LD50) was estimated by the method of Reed and Muench (27). The mean time to death (MTD) was calculated by averaging the time of death for all individuals that died after receiving 105 endospores. Mice were housed and maintained in a specific-pathogen-free environment in a humane fashion.

Infections of BMM.

Bone marrow-derived macrophages (BMM) obtained from 6- to 8-week-old female BALB/c mice (Jackson Laboratories) were cultured in Dulbecco modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS; Gibco) at 37°C in a 5% CO2 chamber with saturating humidity. BMM were seeded at a concentration of 105 cells per well in 24-well tissue culture plates (Corning) and were challenged at a multiplicity of infection (MOI) of 10 endospores per macrophage. A brief 10-min spin at 100 × g was performed to initiate contact between the endospores and the BMM, followed by a 20-min incubation to allow for the uptake of endospores into the cell. Infections were washed three times with DMEM, and the medium was replaced with a gentamicin-germinant solution to allow for germination and the reduction of extracellular bacteria. The gentamicin-germinant solution consisted of DMEM-10% FBS supplemented with 5 μg of gentamicin/ml and a germinant cocktail of 1 mM alanine, 1 mM serine, and 1 mM inosine. The germinant cocktail facilitated synchronous germination of the extracellular endospores and allowed for killing of the extracellular bacilli with the gentamicin pulse. Greater than 99.9% germination and gentamicin killing was observed in this medium (data not shown). After a 30-min treatment, the monolayers were washed an additional three times with DMEM, and the medium was replaced with DMEM-10% FBS. At the specified time points, the supernatant was aspirated, and the BMM were scraped in the presence of a 0.2% solution of saponin. Recovered samples were serially diluted, and cell-associated viable counts were enumerated by plating CFU. Changes in cell-associated growth were normalized to viable counts at the 0-h time point. For the evaluation of cytotoxicity, infections were done identically as described above except that, at 8 h after gentamicin treatment, supernatants were collected, and the macrophage cytotoxicity was measured by determining the release of lactate dehydrogenase (LDH) with the CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega). The percent cytotoxicity was calculated as 100 × [(experimental LDH release − spontaneous LDH release)/(maximum LDH release − spontaneous LDH release)]. The identical scheme was also carried out for microscopic analysis, except infections were performed in Lab Tek II chamber slides (Nalge Nunc International). Slides were stained by using a HEMA 3 kit (Fisher), and photomicrographs were taken at ×1,000 magnification.

RESULTS

B. anthracis expresses three PLCs independently of PlcR and pXO1.

The absence of hemolytic zones on blood agar has been used as a diagnostic to distinguish B. anthracis from other members of the B. cereus group. The gamma-hemolysis is thought to be a consequence of the truncated transcriptional activator PlcR, resulting in the silencing of the PlcR regulon (20). However, low levels of hemolysis have been reported for various B. anthracis strains, in addition to lecithinase activity (13, 19). Earlier reports imply that PLC expression may be induced under strictly anaerobic growth (15). It was postulated that the truncated PlcR may be functional under these conditions, allowing expression of the PLCs. Here, we were able to detect activity for each PLC on assay plates after growth in an aerobic environment and assign a function to the PLC genes through specific genetic deletions (Fig. 1). In contrast to the findings of Klichko et al. (15), no increase in PLC activity was observed on assay plates grown anaerobically versus those grown aerobically (data not shown). Βeta-hemolytic zones were detected on sheep blood agar after 36 h when plates were supplemented with CaCl2 and MgCl2, which have been shown to increase the binding and activation of B. cereus SMase on erythrocytes (38). Hemolysis was further enhanced when blood plates were incubated at 40°C. The hemolysis seen on sheep erythrocytes was attributed to SMase since the lack of hemolytic activity coincided with the deletion of smcA, whereas the disruption of plcB and plcA had no effect on hemolysis (Fig. 1B). The susceptibility of sheep erythrocytes to SMase may be a result of their high sphingomyelin (50%) content and relatively negligible amounts of phosphatidylcholine and phosphatidylinositol. PC-PLC and PI-PLC activities were detected, respectively, on egg yolk agar or BHI agar supplemented with a chromogenic derivative of myoinositol phosphate (i.e., X-PI). Deletion of the plcB gene resulted in the loss of opaque zones beneath colonies on egg yolk agar, signifying the absence of PC-PLC activity (Fig. 1A). Strains containing a deleted plcA gene were white on X-PI plates due to the inability to release the blue chromogen from the myoinositol phosphate derivative as a result of the loss of PI-PLC activity (Fig. 1C). Function was restored in each null strain by complementation of the disrupted gene in trans, and PLC activity was conferred to B. subtilis via ectopic expression of the B. anthracis PLC genes (Fig. 1). In each case, PLC activity was detected 12 to 24 h earlier on the assay plates, suggesting that the PLC genes were overexpressed. To resolve whether the truncated PlcR is still able to mediate expression of the PLC genes, we constructed a plcR-null strain. The ΔplcR strain had PLC activities similar to that of the parental strain under all of the conditions tested, supporting earlier indications that the B. anthracis PlcR is indeed nonfunctional (Fig. 1) (20). In addition, ΔSterne showed no difference in expression of the PLCs, suggesting that the expression of the PLC genes can occur in the absence of both virulence plasmids (Fig. 1).

FIG. 1.

FIG. 1.

PLC activity of B. anthracis. PC-PLC activity was assayed on McClung Toabe agar supplemented with 10% egg yolk enrichment (A), SMase activity was assayed on TSA II 5% sheep blood agar supplemented with 1 mM MgCl2 and 1 mM CaCl2 (B), and PI-PLC activity was assayed on BHI supplemented with 500 μg of X-PI/ml (C). Plates were inoculated with B. anthracis or B. subtilis strains, incubated at 37 or 40°C for 36 h, and monitored for opacity (PC-PLC), hemolysis (SMase), or blue-white screen (PI-PLC).

B. anthracis PLCs are redundant for virulence in a murine model of inhalation anthrax.

Although Sterne strains of B. anthracis are attenuated for virulence in most animal models of anthrax, certain strains of inbred mice remain susceptible (41). In addition, Sterne infections of inbred mice maintain similar characteristics as infections with the fully virulent B. anthracis strains in other species. In the present study, DBA/2J inbred mice were challenged via an intratracheal route with Sterne and isogenic plcB-, smcA-, and plcA-null strains, as well as strains lacking combinations thereof, in order to discern whether PLCs contribute to B. anthracis pathogenesis. Intratracheal infections were utilized as a model for inhalation anthrax since endospores can be reproducibly delivered directly into the lungs via this route (17). The MTD and the lethal dose of endospores required to kill 50% of the mice (LD50) for Sterne infections were consistent with previous findings in similar murine models (41) (Table 3). The disruption of the plcR gene had a minimal effect on the LD50 and no change in the MTD compared to Sterne, further supporting the notion that the truncated PlcR is, in fact, inactive (Table 3). No increase in the LD50 or MTD was observed when mice were infected with strains defective in individual PLC activity. Mice challenged with strains containing disruptions in any two of the three PLC genes showed virtually no distinction from the parental MTD or LD50 values (Table 3). The deletion of all three PLC genes was required for a moderate attenuation of virulence in mice. The LD50 for the ΔplcBsmcAplcA strain was approximately a log higher than Sterne, and the MTD of the triple PLC-null strain was increased by 3 days (Table 3). This defect in virulence can be attributed to the absence of PLC activities since each null strain showed similar germination efficiencies as well as growth rates compared to the isogenic parental (Table 4). Furthermore, we were able to complement this attenuation in virulence by expression of the PLC genes in trans (Table 3). A log increase in LD50 was observed whether the PLCs were disrupted in the Sterne strain or in a Δlef background (Table 3). This suggests that the PLCs and LeTx may exert their functions separately during B. anthracis infections since the disruption of both factors was additive. Collectively, these results indicate that each of the PLCs play a redundant role during mouse infections, since the expression of any one of the three PLCs is sufficient to retain virulence equivalent to the parental Sterne strain.

TABLE 3.

LD50 and MTD values for mice challenged intratracheally with B. anthracis strains

Strain LD50 MTD (days)a
Sterne 7702 8.26 × 103 2
ΔplcB 1.33 × 104 2
ΔsmcA 8.40 × 103 2
ΔplcA 9.99 × 103 2
ΔplcBsmcA 2.09 × 104 2
ΔplcBplcA 9.55 × 103 2
ΔsmcAplcA 1.23 × 104 2
ΔplcBsmcAplcA 7.71 × 104 5b
ΔplcBsmcAplcA (pBH095) 3.20 × 103 3
Δlef 5.80 × 107 ND
Δlef ΔplcBsmcAplcA 6.23 × 108 ND
ΔplcR 1.68 × 104 2
a

MTD determined for a dose of 105 endospores. ND, no deaths were observed.

b

P < 0.02 compared to Sterne 7702 as determined by the log-rank test.

TABLE 4.

Germination efficiencies and doubling times of B. anthracis strainsa

Strain Mean % decrease in OD600 ± SDb Doubling time (min) ± SDc
Sterne 7702 58.1 ± 0.4 34 ± 2
ΔplcB 54.8 ± 0.5 32 ± 3
ΔsmcA 60.2 ± 0.6 33 ± 1
ΔplcA 59.7 ± 0.2 32 ± 1
ΔplcBsmcA 58.9 ± 0.9 34 ± 2
ΔplcBplcA 58.5 ± 0.1 31 ± 3
ΔsmcAplcA 60.9 ± 0.4 35 ± 3
ΔplcBsmcAplcA 61.8 ± 1.2 30 ± 2
a

Results for experiments, performed in triplicate, are depicted with the standard deviation.

b

Endospore germination in BHI at 30 min was performed as described in Materials and Methods. A decrease of ∼60% in the optical density at 600 nm (OD600) correlates to ∼99% germination as scored by the loss of heat resistance (6).

c

That is, doubling times during exponential growth of B. anthracis strains grown in BHI at 37°C.

Cooperation between the PLCs is necessary for cell-associated growth of B. anthracis in BMM.

During the initial stages of inhalation anthrax, B. anthracis is able to survive the harsh intracellular environment of the alveolar macrophage. We hypothesized that the attenuation in virulence of the ΔplcBsmcAplcA strain in mice may be attributed to decreased abilities to survive the innate killing mechanisms of the macrophage. Cultured BMM were infected with B. anthracis strains defective for PLC activities to determine whether PLCs contribute to B. anthracis survival and replication in association with the macrophage. Tissue culture models of anthrax are complicated by the persistence of extracellular endospores that are difficult to remove even with excessive washes. Endospore germination in this model is not uniform, and therefore treatment with antibiotics, such as gentamicin, is insufficient to completely eliminate extracellular bacteria since endospores are resistant to such insults. In an attempt to control for these parameters, the tissue culture medium was supplemented with a germinant solution consisting of alanine, inosine, and serine after phagocytosis of the endospores. This facilitated the synchronous germination of the extracellular endospores and allowed for gentamicin killing of extracellular bacteria. Greater than 99.9% germination and gentamicin killing of extracellular bacteria was observed in this medium (data not shown).

A decrease in macrophage-associated CFU was observed over the first 2 h of Sterne infections, presumably as a consequence of macrophage-mediated killing of endospores and/or recently germinated bacilli (Fig. 2A). Surviving bacilli began to replicate at around 5 to 6 h after gentamicin treatment, and by 8 h the macrophages were overcome with bacilli (average of 19 bacilli/BMM) (Fig. 2 to 4 and Table 5). The growth kinetics of Sterne in association with BMM was in close agreement with previous reports that utilized time-lapse microscopy to study the replication of B. anthracis during macrophage infections (29). Individual PLC-null strains showed similar growth kinetics in association with macrophages compared to the parental Sterne strain (Fig. 2A). The ΔsmcA and ΔplcA strains caused comparable amounts of macrophage cell death as the Sterne strain, while the deletion of the broad-range phospholipase, PC-PLC, resulted in nearly a 30% decrease in cytotoxicity (Fig. 3). Strains containing disruptions in any two of the three PLCs showed a diminished capacity for cell-associated growth and were less cytotoxic (Fig. 2B and 3). The absence of all three PLC genes resulted in a strain that was the most deficient for macrophage-associated growth and caused limited amounts of cell death (Fig. 2B and 3). At the 8-h time point, ca. 20% of the macrophage-associated LDH was released when challenged with the ΔplcBsmcAplcA strain, a level roughly four times less than the amount for the parental strain. On average, macrophages infected with the triple PLC-null strain contained far fewer bacilli (5 bacilli/BMM) than those infected with the parental Sterne strain (19 bacilli/BMM) (Table 5). Limited amounts of bacterial growth were observed in association with macrophages infected with the ΔplcBsmcAplcA strain even at the later time point (Fig. 2B and 4). The ability to grow and cause cytolysis was restored after complementation of the PLC genes in trans (Fig. 2B and 3). Since each strain germinated and was phagocytosed to a similar extent (Table 4 and data not shown), the differences seen in terms of macrophage survival can be attributed to the PLC activities. Altogether, these results indicate that the PLCs work in cooperation to resist the bactericidal effects of the phagocyte and facilitate growth of B. anthracis in association with BMM.

FIG. 2.

FIG. 2.

Functional cooperation between B. anthracis PLCs is important for growth and/or survival in BMM. BMM obtained from BALB/c mice were challenged with B. anthracis endospores at an input MOI of 10:1 as described in Materials and Methods. Cell-associated growth was determined every 2 h for 8 h after gentamicin treatment. Changes in cell-associated growth were normalized to viable counts at the 0-h time point. Experiments were done in triplicate three separate times, and the average of three representative experiments are depicted here with the standard deviation. The differences in the fold increase in growth at 8 h after gentamicin treatment between the ΔplcBsmcA, ΔplcBplcA, and ΔsmcAplcA strains compared to the Sterne 7702 strain were significant (P < 0.02 as determined by an unpaired two-tailed t test). The differences between the ΔplcBsmcAplcA strain compared to the Sterne 7702, ΔplcB, ΔsmcA, ΔplcA, ΔplcBsmcA, ΔplcBplcA, and ΔsmcAplcA strains were significant (P < 0.02 as determined by an unpaired two-tailed t test at 8 h).

FIG. 4.

FIG. 4.

PLC activity aids the growth of B. anthracis in association with the macrophage. BMM were challenged with B. anthracis endospores as described in Materials and Methods, except that infections were performed in Lab Tek II chamber slides. Slides were stained at 8 h after gentamicin treatment with Wright-Giemsa-like technique and visualized by light microscopy at ×1,000 magnification. Photomicrographs of representative fields are shown.

TABLE 5.

Distribution of bacilli per macrophage during B. anthracis infections

Strain Avg no. of bacilli/macrophage ± SEMa No. of infected macrophages containingb:
1 to 5 bacilli 6 to 15 bacilli 16 to 30 bacilli 31 to 50 bacilli >50 bacilli
Sterne 7702 19 ± 2.8 15 14 12 4 5
ΔsmcA 15 ± 2.4 16 15 14 3 2
ΔplcA 14 ± 1.7 16 16 13 4 1
ΔplcB 14 ± 2.3 17 19 8 4 2
ΔsmcAplcA 12 ± 1.2* 18 19 10 3 0
ΔplcBsmcA 11 ± 1.4* 20 17 10 3 0
ΔplcBplcA 11 ± 1.0* 18 17 14 1 0
ΔplcBsmcAplcA 5 ± 0.6† 33 17 0 0 0
a

*, P < 0.05 compared to Sterne 7702 as determined by an unpaired two-tailed t test; †, P < 0.02 compared to Sterne 7702, ΔsmcA, ΔplcA, ΔplcB, ΔsmcAplcA, ΔplcBsmcA, and ΔplcBplcA as determined by the unpaired two-tailed t test.

b

A total of 50 macrophages containing bacilli were counted for each strain at 8 h after gentamicin treatment.

FIG. 3.

FIG. 3.

B. anthracis PLC-null strains are less cytotoxic to macrophages. BMM were challenged with B. anthracis endospores at an input MOI of 10:1 as described in Materials and Methods. Supernatants were collected at 8 h after gentamicin treatment and assayed for cytotoxicity by scoring for the release of the cytoplasmic LDH. Experiments were done in triplicate, and the average of three representative experiments are depicted here with the standard deviation. The differences between ΔplcBsmcA, ΔplcBplcA, and ΔsmcAplcA strains compared to the Sterne 7702 strain were significant (P < 0.02 as determined by an unpaired two-tailed t test). The differences between the ΔplcBsmcAplcA strain compared to the Sterne 7702, ΔplcB, ΔsmcA, ΔplcA, ΔplcBsmcA, ΔplcBplcA, and ΔsmcAplcA strains were significant (P < 0.05 as determined by an unpaired two-tailed t test).

DISCUSSION

Anthrax is a disease that proceeds through discrete stages. While B. anthracis is considered an extracellular pathogen at later stages of anthrax, its brief intracellular phase during the establishment stage of an infection is believed to be critical. The results presented in this study identified three PLCs as virulence factors that work together to contribute to the pathogenesis of B. anthracis and, specifically, implicate their activities as important during the early-stage interactions with the macrophage.

PC-PLC, SMase, and PI-PLC activity was detected on assay plates after 36 h and was limited to the area directly beneath the colonies, indicating that PLC expression was weak under the conditions tested (Fig. 1). In B. anthracis, the plcR gene has a point mutation that results in a 73-amino-acid truncation in PlcR, which may explain the muted expression of the PLC genes. Indeed, increased PLC activity is observed following ectopic expression of a full-length plcR gene from B. thuringiensis (20). Further evidence that the truncated PlcR is nonfunctional is presented in this study. The deletion of the plcR gene did not affect PLC expression or the virulence of B. anthracis in a murine model of anthrax (Fig. 1 and Table 3). Expression of the PLCs was also not dependent on the presence of the pXO1 virulence plasmid and therefore, presumably, on the regulation by AtxA (Fig. 1). Consistent with these findings was that survival and growth in association with the macrophage was reported as an AtxA-independent process (4).

Functional redundancy and synergy between PLCs is not unique to B. anthracis pathogenesis. Lysis of human erythrocytes requires the combined efforts of B. cereus PC-PLC and SMase (7). During murine challenges with L. monocytogenes PLC-null strains, the redundant nature of the PLCs is apparent. Deletions of either L. monocytogenes plcA or plcB alone resulted in a 2- to 10-fold increase in LD50, while disruption of both rendered the bacterium 500-fold less virulent (2, 32). In B. anthracis, we found that one functional PLC was sufficient to retain virulence in a murine model of anthrax (Table 3). Only after all three PLC genes were disrupted was there a moderate decrease in virulence (Table 3).

Anthrax LeTx, present in all PLC-null strains tested, is a major virulence determinant of B. anthracis that could potentially be working in conjunction with the PLCs during anthrax infections. To address this possibility, all three PLC genes were disrupted in a lethal factor-null strain and scored for virulence. A 3-log increase in LD50 was observed in mice infected with the Δlef strain relative to the isogenic Sterne strain (Table 3). This is comparable to previous reports (23) and highlights the importance of this toxin during Sterne infections of mice. A log increase in LD50 was observed in both the Sterne and the isogenic Δlef background after disruption of plcB, smcA, and plcA (Table 3). The additive decrease in virulence following the disruption of these factors suggests that B. anthracis might utilize the PLCs and the LeTx separately during infections.

Cooperation between the PLCs was also evident in the in vitro macrophage model of infection. Single PLC-null strains had growth kinetics similar to those of the parental strain and displayed only a slight reduction in cytotoxicity, while strains lacking any two of the three PLCs showed intermediate phenotypes in terms of growth and cytolysis (Fig. 2 and 3). Disruption of all three PLC genes, however, resulted in pronounced differences in both bacterial growth in association with the macrophages and the ability to cause host cell death (Fig. 2B and 3). The growth of the ΔplcBsmcAplcA strain at the later time points, although limited, suggests that B. anthracis maintains still other means to survive and replicate in association with the macrophage even in the absence of the PLCs. Recently, an orthologue of the L. monocytogenes pore-forming cytolysin LLO was characterized in B. anthracis termed anthrolysin O (31), which, in addition to other membrane active toxins encoded by the B. anthracis genome, may contribute to macrophage-associated survival and replication.

The growth defect observed for the triple PLC-null strain during macrophage challenges may be attributed to a defect in escape from phagocytic vacuoles after B. anthracis phagocytosis by the macrophage. PC-PLC, PI-PLC, and SMase activities have been shown to aid in the escape of L. monocytogenes and L. ivanovii from phagocytic vacuoles during tissue culture infections (10, 32). However, the PLCs may also be important at other points in the infection. Recently, PI-PLC was shown to decrease the ability of dendritic cells (DC) to respond to TLR ligand stimulation, thus downmodulating the immune system (44). PLC ability to interact with host cell immunity could be an important contribution to the disease at all stages of infection, but this awaits further investigation.

To summarize, B. anthracis produces three PLCs that are redundant in their ability to aid in macrophage-associated cell growth and cause lethality in mice. Deletion of plcB, smcA, and plcA was required for attenuation of B. anthracis in an inhalation anthrax model. Infections with cultured BMM indicate that the attenuation in mice may be attributed to a growth deficiency of the ΔplcBsmcAplcA strain in association with macrophages. We were able to complement this defect in both macrophage and murine challenges. The functional redundancy between PLCs implies that survival in association with the macrophage is critical for B. anthracis pathogenesis. Further understanding of the interactions between B. anthracis and its host could lead to better ways to treat the disease.

Acknowledgments

This study was supported in part by HHS contract N266200400059C/N01-AI-40059, by NIH grant AI08649, and by the Great Lakes and the Southeast Regional Centers of Excellence for Biodefense and Emerging Infections.

Editor: D. L. Burns

REFERENCES

  • 1.Burkholder, P. R., and N. H. Giles. 1947. Induced biochemical mutations in Bacillus subtilis. Am. J. Bot. 34:345-348. [PubMed] [Google Scholar]
  • 2.Camilli, A., L. G. Tilney, and D. A. Portnoy. 1993. Dual roles of plcA in Listeria monocytogenes pathogenesis. Mol. Microbiol. 8:143-157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cendrowski, S., W. MacArthur, and P. Hanna. 2004. Bacillus anthracis requires siderophore biosynthesis for growth in macrophages and mouse virulence. Mol. Microbiol. 51:407-417. [DOI] [PubMed] [Google Scholar]
  • 4.Dixon, T. C., A. A. Fadl, T. M. Koehler, J. A. Swanson, and P. C. Hanna. 2000. Early Bacillus anthracis-macrophage interactions: intracellular survival and escape. Cell. Microbiol. 2:453-463. [DOI] [PubMed] [Google Scholar]
  • 5.Dixon, T. C., M. Meselson, J. Guillemin, and P. C. Hanna. 1999. Anthrax. N. Engl. J. Med. 341:815-826. [DOI] [PubMed] [Google Scholar]
  • 6.Fisher, N., and P. Hanna. 2005. Characterization of Bacillus anthracis germinant receptors in vitro. J. Bacteriol. 187:8055-8062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gilmore, M. S., A. L. Cruz-Rodz, M. Leimeister-Wächter, J. Kreft, and W. Goebel. 1989. A Bacillus cereus cytolytic determinant, cereolysin AB, which comprises the phospholipase C and sphingomyelinase genes: nucleotide sequence and genetic linkage. J. Bacteriol. 171:744-753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gohar, M., O. A. Øksard, N. Gilois, V. Sanchis, A. B. Kolstø, and D. Lereclus. 2002. Two-dimensional electrophoresis analysis of the extracellular proteome of Bacillus cereus reveals the importance of the PlcR regulon. Proteomics 2:784-791. [DOI] [PubMed] [Google Scholar]
  • 9.Goldfine, H., T. Bannam, N. C. Johnston, and W. R. Zückert. 1998. Bacterial phospholipases and intracellular growth: the two distinct phospholipases C of Listeria monocytogenes. J. Appl. Microbiol. 84:7S-14S. [DOI] [PubMed] [Google Scholar]
  • 10.González-Zorn, B., G. Domínguez-Bernal, M. Suárez, M. T. Ripio, Y. Vega, S. Novella, and J. A. Vázquez-Boland. 1999. The smcL gene of Listeria ivanovii encodes a sphingomyelinase C that mediates bacterial escape from the phagocytic vacuole. Mol. Microbiol. 33:510-523. [DOI] [PubMed] [Google Scholar]
  • 11.Guerout-Fleury, A. M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic resistance cassettes for Bacillus subtilis. Gene 167:335-336. [DOI] [PubMed] [Google Scholar]
  • 12.Guidi-Rontani, C., M. Weber-Levy, E. Labruyère, and M. Mock. 1999. Germination of Bacillus anthracis spores within alveolar macrophages. Mol. Microbiol. 31:9-17. [DOI] [PubMed] [Google Scholar]
  • 13.Guttmann, D. M., and D. J. Ellar. 2000. Phenotypic and genotypic comparisons of 23 strains from the Bacillus cereus complex for a selection of known and putative Bacillus thuringiensis virulence factors. FEMS Microbiol. Lett. 188:7-13. [DOI] [PubMed] [Google Scholar]
  • 14.Haima, P., S. Bron, and G. Venema. 1987. The effect of restriction on shotgun cloning and plasmid stability in Bacillus subtilis Marburg. Mol. Gen. Genet. 209:335-342. [DOI] [PubMed] [Google Scholar]
  • 15.Klichko, V. I., J. Miller, A. Wu, S. G. Popov, and K. Alibek. 2003. Anaerobic induction of Bacillus anthracis hemolytic activity. Biochem. Biophys. Res. Commun. 303:855-862. [DOI] [PubMed] [Google Scholar]
  • 16.Koehler, T. M., Z. Dai, and M. Kaufman-Yarbray. 1994. Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription from one of two promoters. J. Bacteriol. 176:586-595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lyons, C. R., J. Lovchik, J. Hutt, M. F. Lipscomb, E. Wang, S. Heninger, L. Berliba, and K. Garrison. 2004. Murine model of pulmonary anthrax: kinetics of dissemination, histopathology, and mouse strain susceptibility. Infect. Immun. 72:4801-4809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Makino, S., C. Sasakawa, I. Uchida, N. Terakado, and M. Yoshikawa. 1988. Cloning and CO2-dependent expression of the genetic region for encapsulation from Bacillus anthracis. Mol. Microbiol. 2:371-376. [DOI] [PubMed] [Google Scholar]
  • 19.McGaughey, C. A., and H. P. Chu. 1948. The egg-yolk reaction of aerobic sporing bacilli. J. Gen. Microbiol. 2:334-340. [Google Scholar]
  • 20.Mignot, T., M. Mock, D. Robichon, A. Landier, D. Lereclus, and A. Fouet. 2001. The incompatibility between the PlcR- and AtxA-controlled regulons may have selected a nonsense mutation in Bacillus anthracis. Mol. Microbiol. 42:1189-1198. [DOI] [PubMed] [Google Scholar]
  • 21.Okinaka, R. T., K. Cloud, O. Hampton, A. R. Hoffmaster, K. K. Hill, P. Keim, T. M. Koehler, G. Lamke, S. Kumano, J. Mahillon, D. Manter, Y. Martinez, D. Ricke, R. Svensson, and P. J. Jackson. 1999. Sequence and organization of pXO1, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J. Bacteriol. 181:6509-6515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Palmer, B. R., and M. G. Marinus. 1994. The dam and dcm strains of Escherichia coli: a review. Gene 143:1-12. [DOI] [PubMed] [Google Scholar]
  • 23.Pezard, C., P. Berche, and M. Mock. 1991. Contribution of individual toxin components to virulence of Bacillus anthracis. Infect. Immun. 59:3472-3477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pezard, C., E. Duflot, and M. Mock. 1993. Construction of Bacillus anthracis mutant strains producing a single toxin component. J. Gen. Microbiol. 139:2459-2463. [DOI] [PubMed] [Google Scholar]
  • 25.Pomeramtsev, A. P., K. V. Kalnin, M. Osorio, and S. H. Leppla. 2003. Phosphatidylcholine-specific phospholipase C and sphingomyelinase activities in bacteria of the Bacillus cereus group. Infect. Immun. 71:6591-6606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Read, T. D., S. N. Peterson, N. Tourasse, L. W. Baillie, I. T. Paulsen, K. E. Nelson, H. Tettelin, D. E. Fouts, J. A. Eisen, S. R. Gill, E. K. Holtzapple, O. A. Okstad, E. Helgason, J. Rilstone, M. Wu, J. F. Kolonay, M. J. Beanan, R. J. Dodson, L. M. Brinkac, M. Gwinn, R. T. DeBoy, R. Madpu, S. C. Daugherty, A. S. Durkin, D. H. Haft, W. C. Nelson, J. D. Peterson, M. Pop, H. M. Khouri, D. Radune, J. L. Benton, Y. Mahamoud, L. Jiang, I. R. Hance, J. F. Weidman, K. J. Berry, R. D. Plaut, A. M. Wolf, K. L. Watkins, W. C. Nierman, A. Hazen, R. Cline, C. Redmond, J. E. Thwaite, O. White, S. L. Salzberg, B. Thomason, A. M. Friedlander, T. M. Koehler, P. C. Hanna, A. B. Kolsto, and C. M. Fraser. 2003. The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423:81-86. [DOI] [PubMed] [Google Scholar]
  • 27.Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty per- cent endpoints. Am. J. Hyg. 27:493-497. [Google Scholar]
  • 28.Ross, J. M. 1957. The pathogenesis of anthrax following the administration of spores by the respiratory route. J. Pathol. Bacteriol. 73:485-494. [Google Scholar]
  • 29.Ruthel, G., W. J. Ribot, S. Bavari, and T. A. Hoover. 2004. Time-lapse confocal imaging of development of Bacillus anthracis in macrophages. J. Infect. Dis. 189:1313-1316. [DOI] [PubMed] [Google Scholar]
  • 30.Schmiel, D. H., and V. L. Miller. 1999. Bacterial phospholipases and pathogenesis. Microbes Infect. 1:1103-1112. [DOI] [PubMed] [Google Scholar]
  • 31.Shannon, J. G., C. L. Ross, T. M. Koehler, and R. F. Rest. 2003. Characterization of anthrolysin O, the Bacillus anthracis cholesterol-dependent cytolysin. Infect. Immun. 71:3183-3189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Smith, G. A., H. Marquis, S. Jones, N. C. Johnston, D. A. Portnoy, and H. Goldfine. 1995. The two distinct phospholipases C of Listeria monocytogenes have overlapping roles in escape from a vacuole and cell-to-cell spread. Infect. Immun. 63:4231-4237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Smith, K., and P. Youngman. 1992. Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74:705-711. [DOI] [PubMed] [Google Scholar]
  • 34.Stewart, G. S., K. Johnstone, E. Hagelberg, and D. J. Ellar. 1981. Commitment of bacterial spores to germinate: a measure of the trigger reaction. Biochem. J. 198:101-106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Thorne, C. B. 1968. Transduction in Bacillus cereus and Bacillus anthracis. Bacteriol. Rev. 32:358-361. [PMC free article] [PubMed] [Google Scholar]
  • 36.Thorne, C. B., and F. C. Belton. 1957. An agar-diffusion method for titrating Bacillus anthracis immunizing antigen and its application to a study of antigen production. J. Gen. Microbiol. 17:505-516. [DOI] [PubMed] [Google Scholar]
  • 37.Titball, R. W. 1998. Bacterial phospholipases. J. Appl. Microbiol. 84:127S-137S. [PubMed] [Google Scholar]
  • 38.Tomita, M., R. Tagchi, and H. Ikezawa. 1991. Sphingomyelinase of Bacillus cereus as a bacterial hemolysin. J. Toxicol. Tox. Rev. 10:169-207. [Google Scholar]
  • 39.Weiner, M. A., and P. C. Hanna. 2003. Macrophage-mediated germination of Bacillus anthracis endospores requires the gerH operon. Infect. Immun. 71:3954-3959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wei, Z., P. Schnupf, M. A. Poussin, L. A. Zenewicz, H. Shen, and H. Goldfine. 2005. Characterization of Listeria monocytogenes expressing anthrolysin O and phosphatidylinositol-specific phospholipase C from Bacillus anthracis. Infect. Immun. 73:6639-6646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Welkos, S. L., T. J. Keener, and P. H. Gibbs. 1986. Differences in susceptibility of inbred mice to Bacillus anthracis. Infect. Immun. 51:795-800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Welkos, S. L., and R. Marrero. 1996. Pathogenesis and host resistance to infection: a model system and an analysis of capsule synthesis and regulation by Bacillus anthracis, p. 209-256. In K. W. Adolph (ed.), Microbial genome methods. CRC Press, Inc., Boca Raton, Fla.
  • 43.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. [DOI] [PubMed] [Google Scholar]
  • 44.Zenewicz, L. A., Z. Wei, H. Goldfine, and H. Shen. 2005. Phosphatidylinositol-specific phospholipase C of Bacillus anthracis down-modulates the immune response. J. Immunol. 174:8011-8016. [DOI] [PubMed] [Google Scholar]
  • 45.Zwartouw, H. T., and H. Smith. 1956. Non-identity of the phospholipase of Bacillus anthracis with the anthrax toxin. J. Gen. Microbiol. 15:261-265. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES