Abstract
Background
The increasing levels of Plasmodium falciparum resistance to chloroquine (CQ) in Thailand have led to the use of alternative antimalarials, which are at present also becoming ineffective. In this context, any strategies that help improve the surveillance of drug resistance, become crucial in overcoming the problem.
Methods
In the present study, we have established the in vitro sensitivity to CQ, mefloquine (MF), quinine (QUIN) and amodiaquine (AMQ) of 52 P. falciparum isolates collected in Thailand, and assessed the prevalence of four putative genetic polymorphisms of drug resistance, pfcrt K76T, pfmdr1 N86Y, pfmdr1 D1042N and pfmdr1 Y1246D, by PCR-RFLP.
Results
The percentage of isolates resistant to CQ, MF, and AMQ was 96% (50/52), 62% (32/52), and 58% (18/31), respectively, while all parasites were found to be sensitive to QUIN. In addition, 41 (79%) of the isolates assayed were resistant simultaneously to more than one drug; 25 to CQ and MF, 9 to CQ and AMQ, and 7 to all three drugs, CQ, MF and AMQ. There were two significant associations between drug sensitivity and presence of particular molecular markers, i) CQ resistance / pfcrt 76T (P = 0.001), and ii) MF resistance / pfmdr1 86N (P < 0.001)
Conclusions
i) In Thailand, the high levels of CQ pressure have led to strong selection of the pfcrt 76T polymorphism and ii) pfmdr1 86N appears to be a good predictor of in vitro MF resistance.
Background
Malaria due to Plasmodium falciparum affects 300 million people and claims an estimated 1.5 million lives every year. Our present inability to synthesise a fully protective vaccine means that chemotherapy stands as the only effective measure in the control of the disease. However, in many parts of the world the parasite P. falciparum has become resistant to most drugs presently used [1], seriously undermining efforts for controlling malaria.
Chloroquine (CQ) has long been the drug of choice for the treatment of malaria; however, CQ-resistant parasites are now present in most areas where malaria is endemic [2]. Chloroquine resistance is especially well established in Thailand, after having been first described in that country in the late 1950's [3]. The decline in the efficacy of chloroquine has led to the use of alternative antimalarials, such as antifolates, mefloquine and artemisinin derivatives, but parasite resistance to these drugs is also becoming a real problem [2]. In this context, understanding the genetic basis of drug resistance is essential for implementing rational measures to overcome the problem.
Although significant progress has been made in trying to understand how resistance to CQ may occur, many aspects of it remain unclear, and the genetic mechanisms responsible for mefloquine and quinine resistance are largely unknown. Nevertheless, two main genes have been implicated in quinoline resistance; the pfmdr1 (P. falciparum multi-drug resistance1) and the Pfcrt (P. falciparum chloroquine resistance transporter). There is evidence from the analysis of a genetic cross which indicates that point polymorphisms in the pfmdr1 gene may modulate sensitivity to both mefloquine (MF) and artemisinin in P. falciparum[4]. Furthermore, recent genetic transfection work has suggested that single nucleotide polymorphisms in the pfmdr1 gene encoding changes in aminoacids 1034, 1042 and 1246 can influence parasite responses to mefloquine, quinine and halofantrine as well as to the structurally unrelated drug artemisinin, and modulate sensitivity to chloroquine depending on the genetic background of the parasites strains [5]. However, chloroquine resistance was shown to segregate independently of the pfmdr1 gene, following a genetic cross between a CQ-sensitive parasite, P. falciparum HB3, and a CQ-resistant one, Dd2 [6], and the absence of a clear association between pfmdr1 and chloroquine responses in natural parasite populations [7-15], strongly suggests the involvement of other gene(s). Recently, detailed linkage analysis and fine chromosome mapping of progeny clones of the HB3 × Dd2 cross has allowed the identification of another gene, pfcrt, in which a mutation at aminoacid 76 (pfcrt K76T) is highly correlated with increased CQ tolerance among field parasite isolates of P. falciparum[16-24]. In addition, a causal relationship between pfcrt 76T and chloroquine resistance has been confirmed by genetic transfection experiments [16].
The study of the correlation between drug resistance in natural parasite populations and genetic polymorphisms may allow the development of molecular tools to help predict responses to drugs and, as mentioned above, the pfcrt and pfmdr1 genes have been identified as putative markers of quinoline resistance. In the present work we have investigated possible associations between four molecular markers in these genes and sensitivity to chloroquine, mefloquine, quinine (QUIN) and amodiaquine (AMQ) of P. falciparum parasites collected in Thailand.
Methods
Study site and method of parasite collection
After confirmation of P. falciparum infection by microscopical observation of thin and thick Giemsa-stained blood films, approximately 20 μl of blood were collected by finger-prick from consenting subjects living in 4 different areas of Thailand where malaria is highly endemic; the Tak province (North-western Thailand), Kanchanaburi (Western Thailand: Thai-Myanmar border), Chonburi (Eastern Thailand), Chantaburi and Trat (Eastern Thailand: Thai-Cambodia border). Samples were placed in sterile 1.5 ml micro-centrifuge tubes, together with 0.5 ml of transport medium (10 ml RPMI 1640 complete medium without serum, plus 20 μl of heparin 5000 i.u./ml), carried to Chulalongkorn University of Bangkok on the day of collection, at ambient temperature and placed in in vitro culture, following established procedures [25].
Parasite phenotyping (micro-tests)
Assessment of P. falciparum susceptibility to CQ, MF, QUIN and AMQ was performed according to the M.I.C. test [26,27], whereby samples were exposed to a range of concentrations of the four drugs, in microtitre culture plates, for 72 hours, with daily changes of medium (in the presence or absence of drugs). After this period, thin film Giemsa-stained preparations from each culture plate well were observed under light microscopy for the presence of parasites. The results were expressed in "minimum inhibiting concentration" (M.I.C.) units, i.e., the lowest drug concentration required to kill all or nearly all parasites (I.C.99) after 72 hours [26,27].
Parasite reference strains of known sensitivity to the drugs concerned were tested in parallel to all field-collected isolates. In this manner, the drug response of each isolate was determined by comparison of the M.I.C. between each sample and the relevant reference strains. Accordingly, samples tested for CQ, MF, QUIN and AMQ responses were clustered into two groups; sensitive (S) or resistant (R) based on sensitivity thresholds established in previous studies [26-29].
Genotyping by PCR-RFLP
Genomic DNA was extracted prior to drug testing, by a standard phenol:chloroform DNA extraction method, precipitated with absolute ethanol and stored in TE Buffer (Tris-EDTA), following established protocols [30]. The resulting DNA was used as template in 50 μl PCR reactions, containing 1 μM of each oligonucleotide primer, 1 × PCR buffer (Promega™), 2.5 mM MgCl2, 0.2 mM dNTP's and 0.025 U/μl of Promega™ Taq DNA polymerase. Accordingly, a fragment of the pfcrt gene containing codon 76 was amplified by PCR using a Nested-PCR approach. For amplification of DNA fragments containing pfmdr1 polymorphisms we used oligonucleotide primers published elsewhere [31], as well as newly designed ones. In this manner, the fragments of the pfmdr1 gene containing codons 86 and 1246 were amplified in a single-step PCR, whereas the sequence of codon pfmdr1 1042 was determined following amplification by semi-nested PCR. All primer sequences and respective PCR conditions are presented in Table 1.
Table 1.
Polymerase Chain Reaction for amplification of fragments containing pfcrt and pfmdr1 gene polymorphisms
| Primer | Sequence (5' → 3') | PCR |
| Pfcrt 76 | ||
| 1st round sense | CAAGAAGGAAGTAAGTATCCAAAAATGG | 94°C, 30''; 56°C, 30''; 60°C, 60''; 45 cycles |
| Antisense | GTAGTTCTTGTAAGACCTATGAAGGC | |
| Nested sense | GCAAAAATGACGAGCGTTATAGAG | 94°C, 30''; 59°C, 30''; 60°C, 60''; 45 cycles |
| Antisense | CTGAACAGGCATCTAACATGGATATAGC | |
| Pfmdr1 86 | ||
| Sense | ATGGGTAAAGAGCAGAAAGAG | 94°C, 30''; 53°C, 30''; 68°C, 60''; 10 cycles, followed by 94°C, 30''; 50°C, 30''; 68°C, 60'', 35 cycles |
| Antisense | CGTACCAATTCCTGAACTCAC | |
| Pfmdr1 1042 | ||
| 1st round sense | TATGTCAAGCGGAGTTTTTGC | 94°C, 30''; 50°C, 30''; 68°C, 60''; 45 cycles |
| Antisense | TCTGAATCTCCTTTTAAGGAC | |
| Semi-nested sense | GTAAATGCAGCTTTATGGG | 94°C, 30''; 50°C, 30''; 68°C, 60''; 45 cycles |
| Antisense | TCTGAATCTCCTTTTAAGGAC | |
| Pfmdr1 1246 | ||
| Sense | CTACAGCAATCGTTGGAGAAA | 94°C, 30''; 53°C, 30''; 68°C, 60''; 10 cycles, followed by 94°C, 30''; 50°C, 30''; 68°C, 60'', 35 cycles |
| Antisense | GCTCTAGCTATAGCTATTCTC |
Restriction enzymes generating RFLPs
Following amplification of the fragments concerned, polymorphisms in the pfcrt and pfmdr1 genes were assessed as follows: pfcrt 76K and pfmdr1 86N were detected by incubation of the corresponding PCR fragments with ApoI (r/aatty), pfmdr1 1042N was detected using AsnI (at/taat), and pfmdr1 1246Y was determined by incubation with EcoRV (gat/atc). Endonucleases ApoI, AsnI and EcoRV had been obtained from New England BioLabs™, Roche Molecular Biochemicals™ and Stratagene™ respectively, and incubations were setup following the manufacturers instructions. Appropriate control DNA of samples with known pfcrt and pfmdr1 sequences was used in parallel with field-collected parasite isolates in every PCR-RFLP protocol; these were 3D7 (genotype pfcrt 76K, pfmdr1 86N, pfmdr1 1042N, pfmdr1 1246D), HB3 (genotype pfmdr1 1042D), Dd2 (genotype pfcrt 76T, pfmdr1 86Y) and 180/92 (genotype pfmdr1 1246Y). The products resulting from restrictions of pfmdr1 1042 were resolved in 8% acrylamide gels, whereas pfmdr1 86, pfmdr1 1246 and pfcrt 76 digests were run on 2% agarose gels, with both types of gels made in 1 × TBE buffer. All gels were stained with ethidium bromide and visualised under UV (ultraviolet) transillumination.
Statistical analysis of the association between pfcrt and pfmdr1 markers and drug responses
We searched for statistically significant associations between sensitivity to each of the drugs among all isolates and the presence of each of the particular markers included in our study by using Fisher's Exact Test (2-tailed) after having arranged the data in 2 × 2 contingency tables (mixed infections were excluded from this analysis). An association between a particular marker and resistance to a given drug was considered to be significant if the P value was found to be lower than 0.05 (P < 0.05).
Results
Responses to drugs
In total, 52 samples were analysed in vitro for their susceptibility to chloroquine, mefloquine and quinine, and 31 for amodiaquine. The results of these tests are presented in Table 2.
Table 2.
Results of in vitro drug tests (CQ-chloroquine; MF-mefloquine; QUIN-quinine; AMQ-amodiaquine; S-sensitive; R-resistant)
| CQ | MF | QUIN | AMQ | CQ+MF only | CQ+AMQ only | MF+AMQ only | CQ+MF+AMQ | |
| S | 4% (2/52) | 38% (20/52) | 100% (52/52) | 42% (13/31) | - | - | - | - |
| R | 96% (50/52) | 62% (32/52) | - | 58% (18/31) | 48% (25/52) | 29% (9/31) | -(0/31) | 23% (7/31) |
Pfcrt and pfmdr1 genotypes
The pfcrt 76 PCR primers amplified a sub-fragment of the gene comprising 479 nucleotides, containing both a monomorphic and a polymorphic ApoI restriction site. In this manner, incubation of this fragment with endonuclease ApoI generated either 3 fragments of 122, 124 and 233 base-pairs (b.p.), or 2 fragments of 233 and 246 b.p., if K or T were present respectively (Figure 1). The PCR of pfmdr1 86 amplified a fragment of 504 b.p., within which the presence of asparagine (N) was determined by incubation with ApoI, originating segments of 255 and 249 b.p., which resolved as a single band in 2% agarose gels (Figure 1). For detection of 1042 polymorphisms (N or D) the 188 b.p. fragment obtained by PCR could be restricted with endonuclease AsnI, after which 3 segments were obtained of 116, 46 and 26 b.p. if 1042N were present in the sample, and two fragments of 162 and 26 b.p. in the presence of the alternative aminoacid (as with pfcrt 76, one of the restriction sites for AsnI within this segment is also monomorphic, therefore always resulting in at least one cut) (Figure 1). Codon 1246 polymorphisms (D or Y) were assayed following incubation of the corresponding 508 b.p. PCR product with EcoRV, which produced 2 fragments of 268 and 240 b.p. if the target DNA contained tyrosine (Y) (Figure 1). All data resulting from this analysis is compiled in Table 3, where allele frequencies for each of the markers are shown.
Figure 1.
Agarose (pfmdr1 86, pfmdr1 1246, pfcrt 76), and acrylamide (pfmdr1 1042) gels showing PCR products and corresponding restriction digests, of control and field-collected samples of P. falciparum. (PCR-RFLP controls – 3D7 (genotype pfcrt 76K, pfmdr1 86N, pfmdr1 1042N, pfmdr1 1246D), HB3 (genotype pfmdr1 1042D), Dd2 (genotype pfcrt 76T, pfmdr1 86Y) and 180/92 (genotype pfmdr1 1246Y); IV, V and VIII – DNA Molecular Weight Markers IV, Bioline; V and VIII, Roche)
Table 3.
Frequencies of allelic polymorphisms in the pfcrt and pfmdr1 genes
| Pfcrt | Pfmdr1 | |||||||||||
| Allele | 76K | 76T | Mixed | 86N | 86Y | Mixed | 1042N | 1042D | Mixed | 1246D | 1246Y | Mixed |
| Frequency | .04 | .83 | .13 | .60 | .23 | .17 | .92 | .08 | 0 | .92 | .02 | .06 |
Association between pfcrt and pfmdr1 markers and responses to drugs
Two significant correlations were detected between the presence of a particular marker and in vitro outcomes (Tables 4 and 5); one between CQ resistance and the presence of pfcrt 76T (P = 0.001) and the other, between MF resistance and the presence of pfmdr1 86N (P < 0.001). There was an evident lack of an association between AMQ responses and all of the markers studied (Table 6), a fact that was corroborated after statistical analysis (data not shown). In addition, since all isolates proved to be quinine sensitive, any correlations between response to this drug and corresponding genotypes could not be established. The data of the in vitro tests for the 4 drugs, and corresponding genotypes is compiled in Table 7.
Table 4.
Plasmodium falciparum isolates listed according to sensitivity to chloroquine (CQ), with corresponding pfcrt and pfmdr1 markers
| pfmdr1 | |||||
| Isolate | CQ | pfcrt 76 | 86 | 1042 | 1246 |
| T9/94b3 | S | K | Y | N | D |
| TM408 | S | K | N | N | D |
| T101 | R | T | N | N | D |
| T108 | R | T | N | N | D |
| T113 | R | T | N | N | D |
| T115 | R | T | N | N | D |
| T116 | R | T | N | N | D |
| T120 | R | T | Y | N | D |
| T123 | R | T | N | D | D |
| T130 | R | T | N | N | D |
| T131 | R | T | N | N | D |
| T132 | R | T | N | N | D |
| T133 | R | T | N | N | D |
| S3 | R | T | Y | N | D |
| S64 | R | T | Y | N | D |
| S71 | R | T | Y | N | D |
| S90 | R | T | Y | D | D |
| S118 | R | T | Y | N | D |
| S149 | R | T | NY | N | DY |
| S151 | R | KT | NY | N | D |
| S152 | R | T | Y | N | D |
| S153 | R | T | Y | N | D |
| S157 | R | KT | NY | N | D |
| S160 | R | KT | NY | N | DY |
| CH1 | R | T | Y | D | D |
| CH3 | R | T | Y | D | D |
| CH7 | R | T | N | N | D |
| TD2 | R | T | N | N | D |
| TD3 | R | T | N | N | D |
| TD8 | R | T | N | N | D |
| TD14 | R | T | N | N | D |
| TD21 | R | T | N | N | D |
| TD27 | R | T | N | N | D |
| TD49 | R | T | N | N | D |
| TD56 | R | T | N | N | D |
| TD61 | R | KT | N | N | D |
| TD62 | R | T | N | N | D |
| TD64 | R | T | N | N | DY |
| TD79 | R | KT | N | N | D |
| TD134 | R | T | N | N | D |
| TD328 | R | KT | N | N | D |
| TP4 | R | T | Y | N | D |
| TP7 | R | T | NY | N | D |
| TP13 | R | T | NY | nd | D |
| TP17 | R | T | NY | N | D |
| TP18 | R | T | N | N | D |
| TP20 | R | T | NY | N | D |
| TP21 | R | KT | N | nd | D |
| TP26 | R | T | N | N | D |
| TP34 | R | T | N | N | D |
| TP40 | R | T | N | nd | Y |
| RC17 | R | T | NY | N | D |
(S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined; P = 0.001 for the association between CQR and presence of pfcrt 76T, mixed alleles excluded)
Table 5.
Plasmodium falciparum isolates listed according to sensitivity to mefloquine (MF), with corresponding pfcrt and pfmdr1 markers
| pfmdr1 | |||||
| Isolate | MF | pfcrt 76 | 86 | 1042 | 1246 |
| T9/94b3 | S | K | Y | N | D |
| S3 | S | T | Y | N | D |
| S64 | S | T | Y | N | D |
| S71 | S | T | Y | N | D |
| S90 | S | T | Y | D | D |
| S118 | S | T | Y | N | D |
| S149 | S | T | NY | N | DY |
| S151 | S | KT | NY | N | D |
| S152 | S | T | Y | N | D |
| S153 | S | T | Y | N | D |
| S157 | S | KT | NY | N | D |
| S160 | S | KT | NY | N | DY |
| CH1 | S | T | Y | D | D |
| CH3 | S | T | Y | D | D |
| TP4 | S | T | Y | N | D |
| TP7 | S | T | NY | N | D |
| TP13 | S | T | NY | nd | D |
| TP17 | S | T | NY | N | D |
| TP18 | S | T | N | N | D |
| TP40 | S | T | N | nd | Y |
| TM408 | R | K | N | N | D |
| TP20 | R | T | NY | N | D |
| TP21 | R | KT | N | nd | D |
| RC17 | R | T | NY | N | D |
| T108 | R | T | N | N | D |
| T113 | R | T | N | N | D |
| T115 | R | T | N | N | D |
| T130 | R | T | N | N | D |
| T131 | R | T | N | N | D |
| T132 | R | T | N | N | D |
| TD61 | R | KT | N | N | D |
| TD14 | R | T | N | N | D |
| T101 | R | T | N | N | D |
| T116 | R | T | N | N | D |
| T120 | R | T | Y | N | D |
| T123 | R | T | N | D | D |
| T133 | R | T | N | N | D |
| CH7 | R | T | N | N | D |
| TD2 | R | T | N | N | D |
| TD3 | R | T | N | N | D |
| TD8 | R | T | N | N | D |
| TD21 | R | T | N | N | D |
| TD27 | R | T | N | N | D |
| TD49 | R | T | N | N | D |
| TD62 | R | T | N | N | D |
| TD134 | R | T | N | N | D |
| TD328 | R | KT | N | N | D |
| TD56 | R | T | N | N | D |
| TD64 | R | T | N | N | DY |
| TD79 | R | KT | N | N | D |
| TP26 | R | T | N | N | D |
| TP34 | R | T | N | N | D |
(S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined; P < 0.001 for the association between MFR and presence of pfmdr1 86N, mixed alleles excluded)
Table 6.
Plasmodium falciparum isolates listed according to sensitivity to amodiaquine (AQ), with corresponding pfcrt and pfmdr1 markers
| Pfmdr1 | |||||
| Isolate | AQ | pfcrt 76 | 86 | 1042 | 1246 |
| S153 | S | T | Y | N | D |
| S157 | S | KT | NY | N | D |
| S160 | S | KT | NY | N | DY |
| TD3 | S | T | N | N | D |
| TD49 | S | T | N | N | D |
| TD56 | S | T | N | N | D |
| TD62 | S | T | N | N | D |
| TD79 | S | KT | N | N | D |
| TD134 | S | T | N | N | D |
| TD328 | S | KT | N | N | D |
| TP4 | S | T | Y | N | D |
| TP18 | S | T | N | N | D |
| TP26 | S | T | N | N | D |
| T9/94b3 | R | K | Y | N | D |
| TM408 | R | K | N | N | D |
| S3 | R | T | Y | N | D |
| S118 | R | T | Y | N | D |
| S149 | R | T | NY | N | DY |
| S151 | R | KT | NY | N | D |
| S152 | R | T | Y | N | D |
| TD14 | R | T | N | N | D |
| TD61 | R | KT | N | N | D |
| TD64 | R | T | N | N | DY |
| TP7 | R | T | NY | N | D |
| TP13 | R | T | NY | nd | D |
| TP17 | R | T | NY | N | D |
| TP20 | R | T | NY | N | D |
| TP21 | R | KT | N | nd | D |
| TP34 | R | T | N | N | D |
| TP40 | R | T | N | nd | Y |
| RC17 | R | T | NY | N | D |
(S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined)
Table 7.
Number of isolates clustered according to sensitivity to each drug and corresponding pfcrt and pfmdr1 genotypes
| Drug | Pfcrt | Pfmdr1 | |||||||||||
| 76K | 76T | 76KT | 86N | 86Y | 86NY | 1042N | 1042D | 1042ND | 1246D | 1246Y | 1246DY | ||
| CQ | Total | ||||||||||||
| S | 2 | 2 | 0 | 0 | 1 | 1 | 0 | 2 | 0 | 0 | 2 | 0 | 0 |
| R | 50 | 0 | 43 | 7 | 30 | 11 | 9 | 43 | 4 | 0 | 46 | 1 | 3 |
| MF | |||||||||||||
| S | 35 | 2 | 27 | 6 | 2 | 11 | 7 | 29 | 3 | 0 | 32 | 1 | 2 |
| R | 17 | 0 | 16 | 1 | 29 | 1 | 2 | 16 | 1 | 0 | 16 | 0 | 1 |
| QUIN | |||||||||||||
| S | 52 | 2 | 43 | 7 | 31 | 12 | 9 | 45 | 4 | 0 | 48 | 1 | 3 |
| R | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| AMQ | |||||||||||||
| S | 13 | 0 | 9 | 4 | 9 | 2 | 2 | 13 | 0 | 0 | 12 | 0 | 1 |
| R | 18 | 2 | 13 | 3 | 7 | 4 | 7 | 15 | 0 | 0 | 15 | 1 | 2 |
(CQ – chloroquine; MF – mefloquine; QUIN – quinine; AMQ – amodiaquine; S – sensitive; R – resistant; 76KT, 86NY, 1042ND and 1246DY – mixed infections; shaded boxes indicate the two cases where there was a significant association between the presence of a particular marker and drug sensitivity: pfcrt 76T/CQR, P = 0.001 and pfmdr1 86N/MFR, P < 0.001)
Discussion
The increasing failure rates of several antimalarial drugs in the majority of malaria-affected areas means that close monitoring of the epidemiology and dynamics of drug resistance are necessary if we are to implement measures to circumvent the problem. The identification and validation of easy, rapid molecular markers of drug resistance would greatly facilitate this process, and would allow us to overcome difficulties in the use of traditional methods for assaying drug sensitivity.
In Thailand, CQ resistance was first reported more than forty years ago [3], and after ten years, resistance to chloroquine had become so widespread that use of the drug against P. falciparum was abandoned. At present, even though the drug is used only against P. vivax, it is perhaps not surprising to find that most P. falciparum are largely unaffected by CQ. Our in vitro observations show a near total prevalence of CQR (96%) in the present study area, confirming what has been widely reported [1]. Among all CQR isolates tested in our study, the presence of pfcrt 76T was universal (P = 0.001), indicating complete selection of this polymorphism by the drug, a result that is in agreement with recently published work not only from Thai-originated parasites [22], but also from parasites of different areas of the globe [32].
The correlation between pfmdr1 genotypes and quinoline resistance has often generated conflicting results; although it has been suggested that pfmdr1 86Y can be correlated with increased CQ resistance in parasites which originated from different areas of the world [33-36], other field studies have not corroborated these findings [7-15], and the results of a P. falciparum genetic cross indicated that CQR did not depend on the pfmdr1 gene [6]. Our present findings do not implicate pfmdr1 86 in CQ resistance in Thailand, since the presence of both N and Y in our samples was largely independent of their CQ response, indicating that chloroquine does not appear to exert selective pressure on this area of the gene. Interestingly though, pfmdr1 1042D and pfmdr1 1246N, previously associated with increased CQ sensitivity following genetic transfection experiments [5], were largely absent in our samples, possibly suggesting a mechanism of chloroquine resistance that may in part depend on the presence of the alternative polymorphic alleles, pfmdr1 1042N and pfmdr1 1246D, respectively.
Mefloquine was introduced in Thailand in the form of Fansimef (mefloquine-sulfadoxine-pyrimethamine) during 1984 with an initial cure rate of 95%, but MF-resistant P. falciparum parasites have arisen and present a real threat to the control of malaria, especially in the Thai/Cambodia and Thai/Myanmar border areas [37]. In the present work the prevalence of MF resistance was 62%, indicating a worrying trend. A correlation between pfcrt 76T and mefloquine sensitivity would always be difficult to establish, since the near complete presence of this polymorphism is likely to have been selected by chloroquine pressure, whose mechanisms of action and resistance are probably distinct from those of MF. Earlier work from Thailand and other areas of the world has indicated that an increase in the level of mefloquine sensitivity among field isolates of P. falciparum may be correlated with a mutation in codon 86 of the pfmdr1 gene (N86Y) [38-40]. In the present work, the occurrence of pfmdr1 86N was significantly associated with MF resistance as 31/32 resistant isolates carried this polymorphism (P < 0.001), strongly suggesting that 86N is an important event in the generation of MF resistance and may be a useful marker to monitor MF resistance in this country.
Interestingly, although the prevalence of AMQ resistance was high (58%), we did not detect a significant correlation between AMQ responses and any of the markers studied, contrary to what could be expected considering that AMQ is chemically very similar to CQ. These observations indicate that the mechanism of action and/or resistance differ between the two drugs, which may raise interesting questions about the design of new CQ-derivative compounds.
Quinine is one of the most effective drugs for the treatment of malaria in Thailand. Although the efficacy of this drug has been reduced, it has not yet become a serious problem, since the combination with tetracycline increases its cure rate. In fact, P. falciparum quinine sensitivity was total in all regions covered by our study, showing that despite its adverse side effects, quinine can still be used as a reliable resource of malaria therapy in Thailand. The reasons for the long-lasting efficacy of quinine may be manyfold, but its explanations lie outside the scope of this article. Most importantly, quinine may prove especially valuable in the treatment of multi-drug resistant Falciparum malaria, which we found to be largely present in our study as 41 out of 52 isolates were found to be resistant to more than one compound and 7 were unaffected by all drugs (CQ, MF and AMQ) except quinine.
Conclusions
Taken together, our results seem to be suggesting that CQ and MF are the major selective forces on the pfcrt and pfmdr1 genes, whereby the presence of pfcrt 76T, and possibly pfmdr1 1042N and pfmdr1 1246D in Thai-originated parasites has been selected by chloroquine pressure. The pfmdr1 86N mutation seems to be important only for mefloquine resistance, and may represent a useful marker for monitoring resistance in this country, although its validation may require in vivo correlates and the analysis of a larger number of samples.
Authors' contributions
DL carried out a proportion of the parasite phenotyping, performed the molecular analysis of the majority of the samples and contributed for the elaboration of the manuscript. KR performed the molecular typing of a number of the isolates. FN participated in the parasite's phenotyping and genotyping. AS performed parasite collection and did a proportion of the micro-tests. JPG, VR and PC, conceived the study, participated in its design and co-ordination and were involved in phases of the experimental work.
Competing interests
None declared.
Acknowledgments
Acknowledgements
Dinora Lopes, Fátima Nogueira, José Pedro Gil, Virgilio do Rosário and Pedro Cravo were funded by the Ministério da Ciência e Tecnologia, Portugal. This work was partially supported by Fundação para a Ciência e Tecnologia (FCT), project PRAXIS XXI P/SAU/14070/98. Dinora Lopes and Pedro Cravo are grateful to David Walliker, Paul Hunt and Hamza Babiker from the Institute of Cell, Animal and Population Biology, University of Edinburgh, for excellent scientific advice and support. The work in Thailand was supported by malaria grants from Institute of Health Research, Faculty of Science, Chulalongkorn University. We thank the Malaria Division, Ministry of Health (Bangkok) and especially the staff of the Malaria Clinics for their co-operation.
Contributor Information
Dinora Lopes, Email: dmlopes@ihmt.unl.pt.
Kanchana Rungsihirunrat, Email: Kanchana.R@Chula.ac.th.
Fátima Nogueira, Email: fnogueira@ihmt.unl.pt.
Aree Seugorn, Email: Aree.S@Chula.ac.th.
José Pedro Gil, Email: pedro.gil@ks.se.
Virgilio E do Rosário, Email: cmdt@ihmt.unl.pt.
Pedro Cravo, Email: pcravo@ihmt.unl.pt.
References
- White NJ. Drug resistance in malaria. Br Med Bull. 1998;54:703–715. doi: 10.1093/oxfordjournals.bmb.a011721. [DOI] [PubMed] [Google Scholar]
- Peters W. Drug resistance in malaria parasites of animals and man. Adv Parasitol. 1998;41:1–62. doi: 10.1016/s0065-308x(08)60421-2. [DOI] [PubMed] [Google Scholar]
- Harinasuta T, Migasen S, Boonag D. Chloroquine resistance in Plasmodium falciparum in Thailand. UNESCO First Regional Symposium on Scientific Knowledge of Tropical Parasites, Singapore University, Singapore. 1962.
- Duraisingh MT, Jones P, Sambou I, Von Seidlein L, Pinder M, Warhurst DC. The tyrosine-86 of the pfmdr1 gene of Plasmodium falciparum is associated with increased sensitivity to the anti-malarials mefloquine and artemisinin. Mol Biochem Parasitol. 2000;108:13–23. doi: 10.1016/S0166-6851(00)00201-2. [DOI] [PubMed] [Google Scholar]
- Reed MB, Saliba KJ, Caruana SR, Kirk K, Cowman AF. Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature. 2000;403:906–909. doi: 10.1038/35002615. [DOI] [PubMed] [Google Scholar]
- Wellems TE, Panton LJ, Gluzman IY, Rosário VE, Gwadz RW, Walker-Jonah A, Krogstad DJ. Chloroquine resistance not linked to mdr-like genes in a Plasmodium falciparum cross. Nature. 1990;345:253–255. doi: 10.1038/345253a0. [DOI] [PubMed] [Google Scholar]
- Awad-el-Kariem FM, Miles MA, Warhurst DC. Cloroquine-resistant Plasmodium falciparum isolates from the Sudan lack two mutations in the pfmdr1 gene thought to be associated with chloroquine resistance. Trans R Soc Trop Med Hyg. 1992;86:587–589. doi: 10.1016/0035-9203(92)90140-8. [DOI] [PubMed] [Google Scholar]
- Wilson C, Volkman S, Thaithong S, Martin R, Kyle D, Milhous W, Wirth D. Amplification of Pfmdr1 associated with mefloquine and halofantrine resistance in Plasmodium falciparum from Thailand. Mol Biochem Parasitol. 1993;57:151–160. doi: 10.1016/0166-6851(93)90252-S. [DOI] [PubMed] [Google Scholar]
- Cremer G, Basco LK, Le Bras J, Camus D, Slomianny C. Plasmodium falciparum: detection of P-glycoprotein in chloroquine-susceptible and chloroquine-resistant clones and isolates. Exp Parasitol. 1995;81:1–8. doi: 10.1006/expr.1995.1086. [DOI] [PubMed] [Google Scholar]
- Basco L, de Pecoulas PE, Le Bras J, Wilson CM. Plasmodium falciparum: molecular characterisation of multi-drug resistant Cambodian isolates. Exp Parasitol. 1996;82:97–103. doi: 10.1006/expr.1996.0013. [DOI] [PubMed] [Google Scholar]
- Bhattacharya PR, Biswas S, Kabilan L. Alleles of the Plasmodium falciparum pfmdr1 gene appear not to be associated with chloroquine resistance in India. Trans R Soc Trop Med Hyg. 1997;91:454–455. doi: 10.1016/s0035-9203(97)90283-2. [DOI] [PubMed] [Google Scholar]
- von Seidlein L, Duraisingh MT, Drakeley CJ, Bailey R, Greenwodd BM, Pinder M. Polymorphisms in the pfmdr1 gene and chloroquine resistance in Plasmodium falciparum in the Gambia. Trans R Soc Trop Med Hyg. 1997;91:450–453. doi: 10.1016/s0035-9203(97)90281-9. [DOI] [PubMed] [Google Scholar]
- Povoa MM, Adagu IS, Oliveira SG, Machado RL, Miles MA, Warhurst DC. Pfmdr1 Asn1042Asp and Asp1246Tyr polymorphisms, thought to be associated with chloroquine resistance, are present in chloroquine-resistant and sensitive Brazilian field isolates of Plasmodium falciparum. Exp Parasitol. 1998;88:64–68. doi: 10.1006/expr.1998.4195. [DOI] [PubMed] [Google Scholar]
- Bhattacharya PR, Pillai CR. Strong association, but incomplete correlation between chloroquine resistance and allelic variation in the pfmdr1 gene of Plasmodium falciparum isolates from India. Ann Trop Med Parasitol. 1999;93:679–684. doi: 10.1080/00034989957916. [DOI] [PubMed] [Google Scholar]
- Chaiyaroj SC, Buranakiti A, Angkasekwinai P, Looressuwan S, Cowman AF. Analysis of mefloquine resistance and amplification of pfmdr1 in multidrug-resistant Plasmodium falciparum isolates from Thailand. Am J Trop Med Hyg. 1999;61:780–783. doi: 10.4269/ajtmh.1999.61.780. [DOI] [PubMed] [Google Scholar]
- Fidock DA, Nomura T, Talley AT, Cooper RA, Dzekunov S., Ferdig MT, Ursos LM, Sidhu AS, Naude B, Deitsch K., Su XZ, Wootton JC, Roepe PD, Wellems TE. Mutations in the Plasmodium falciparum. Digestive vacuole transmembrane protein Pfcrt and evidence for their role in chloroquine resistance. Mol Cell. 2000;6:861–871. doi: 10.1016/s1097-2765(05)00077-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Babiker A, Pringle SJ, Abdel-Muhsin A, Mackinnon M, Hunt P, Walliker D. High level of chloroquine resistance in Sudanese isolates of Plasmodium falciparum is associated with mutations in the chloroquine resistance transporter gene pfcrt and the multi-drug resistance gene pfmdr1. J Inf Dis. 2001;183:1535–1538. doi: 10.1086/320195. [DOI] [PubMed] [Google Scholar]
- Djimdé A, Doumbo OK, Steketee RW, Plowe CV. Application of a molecular marker for surveillance of chloroquine-resistant malaria. Lancet. 2001;358:890–891. doi: 10.1016/S0140-6736(01)06040-8. [DOI] [PubMed] [Google Scholar]
- Djimdé A, Doumbo OK, Cortese JF, Kayentao K, Doumbo S, Diourte Y, Dicko , Su XZ, Nomura T, Fidock DA, Wellems TE, Plowe CV, Coulibaly D. A molecular marker for chloroquine-resistant falciparum malaria. New Engl J Med. 2001;344:257–263. doi: 10.1056/NEJM200101253440403. [DOI] [PubMed] [Google Scholar]
- Dorsey G, Kamya MR, Singh A, Rosenthal PJ. Polymorphisms in the Plasmodium falciparum pfcrt and pfmdr1 genes and clinical response to chloroquine in Kampala, Uganda. J Inf Dis. 2001;183:1417–1420. doi: 10.1086/319865. [DOI] [PubMed] [Google Scholar]
- Durand R, Jafari R, Vauzelle J, Delabre JF, Jesic Z, Le Bras J. Analysis of pfcrt point mutations and chloroquine susceptibility in isolates of Plasmodium falciparum. Mol Biochem Parasitol. 2001;114:95–102. doi: 10.1016/S0166-6851(01)00247-X. [DOI] [PubMed] [Google Scholar]
- Labbé AC, Bualombai P, Pillai DR, Zhong KJY, Vanisaveth V, Hongvanthong B, Looareesuwan S, Kain KC. Molecular markers for chloroquine-resistant Plasmodium falciparum malaria in Thailand and Laos. Ann Trop Med Parasitol. 2001;95:781–788. doi: 10.1080/00034980120103414. [DOI] [PubMed] [Google Scholar]
- Maguire JD, Susanti AI, Krisin , Sismadi P, Fryauff DJ, Baird JK. The T76 mutation in the pfcrt gene of Plasmodium falciparum and clinical chloroquine resistance phenotypes in Papua, Indonesia. Ann Trop Med Parasitol. 2001;95:559–572. doi: 10.1080/00034980120092516. [DOI] [PubMed] [Google Scholar]
- Pillai DR, Labbé AC, Vanisaveth V, Hongvangthong B, Pomphida S, Inkathone S, Zhong KJY, Kain KC. Plasmodium falciparum malaria in Laos: chloroquine treatment outcome and predictive value of molecular markers. J Inf Dis. 2001;183:789–795. doi: 10.1086/318836. [DOI] [PubMed] [Google Scholar]
- Thaithong S, Seugorn A, Beale GH. Culturing Plasmodium falciparum from finger-prick samples of infected blood. Trans R Soc Trop Med Hyg. 1994;88:490. doi: 10.1016/0035-9203(94)90445-6. [DOI] [PubMed] [Google Scholar]
- Thaithong S, Beale GH. "Malaria Parasites". Chulalongkorn University research report Series, No 1. 1992.
- Thaithong S, Beale GH, Chutmongkonkul M. Susceptibility of Plasmodium falciparum to five drugs: an in vitro study of isolates mainly from Thailand. Trans R Soc Trop Med Hyg. 1983;77:228–231. doi: 10.1016/0035-9203(83)90080-9. [DOI] [PubMed] [Google Scholar]
- Congpuong K, Sirtichaisinthop J, Tippawangkosol P, Suprakrob K, Na-Bangchang K, Tan-ariya P, Karbwang J. Incidence of antimalarial pretreatment and drug sensitivity in vitro in multidrug-resistant Plasmodium falciparum infection in Thailand. Trans R Soc Trop Med Hyg. 1998;92:84–6. doi: 10.1016/s0035-9203(98)90967-1. [DOI] [PubMed] [Google Scholar]
- Creasey A, Fenton B, Walker A, Thaithong S, Oliveira S, Mutambu S, Walliker D. Genetic diversity of Plasmodium falciparum shows geographical variation. Am J Trop Med Hyg. 1990;42:403–413. doi: 10.4269/ajtmh.1990.42.403. [DOI] [PubMed] [Google Scholar]
- Sambrook J, Fritsch EF, Maniatis T. Cold Spring Harbour Laboratory. second. Cold Spring Harbour, New York; 1989. "Molecular Cloning: A Laboratory Manual". [Google Scholar]
- Cox-Singh J, Singh B, Alias A, Abdullah MS. Assessment of the association between three pfmdr1 point mutations and chloroquine resistance in vitro of Malaysian Plasmodium falciparum isolates. Trans R Soc Trop Med Hyg. 1995;89:436–437. doi: 10.1016/0035-9203(95)90045-4. [DOI] [PubMed] [Google Scholar]
- Wellems TE, Plowe CV. Chloroquine-resistant malaria. J Inf Dis. 2001;184:770–776. doi: 10.1086/322858. [DOI] [PubMed] [Google Scholar]
- Foote SJ, Kyle DE, Martin RK, Oduola AM, Forsyth K, Kemp DJ, Cowman AF. Several alleles of the multidrug-resistance gene are closely linked to chloroquine resistance in Plasmodium falciparum. Nature. 1990;345:255–258. doi: 10.1038/345255a0. [DOI] [PubMed] [Google Scholar]
- Basco L, Le Bras J, Rhoades Z, Wilson C. Analysis of Pfmdr1 and drug susceptibility in fresh isolates of Plasmodium falciparum from Subsaharan Africa. Mol Biochem Parasitol. 1995;74:157–166. doi: 10.1016/0166-6851(95)02492-1. [DOI] [PubMed] [Google Scholar]
- Duraisingh M, Drakeley C, Muller O, Bailey R, Snounou G, Targett G, Greenwood B, Warhurst D. Evidence for selection for the tyrosine-86 allele of the Pfmdr1 gene of Plasmodium falciparum by chloroquine and amodiaquine. Parasitology. 1997;114:205–211. doi: 10.1017/S0031182096008487. [DOI] [PubMed] [Google Scholar]
- Adagu IS, Warhurst DC. Association of cg2 and pfmdr1 genotypes with chloroquine resistance in field samples of Plasmodium falciparum from Nigeria. Parasitology. 1999;119:343–348. doi: 10.1017/S0031182099004862. [DOI] [PubMed] [Google Scholar]
- Wernsdorfer W. Epidemiology of drug resistance in malaria. Acta Trop. 1994;56:143–156. doi: 10.1016/0001-706X(94)90060-4. [DOI] [PubMed] [Google Scholar]
- Mungthin M, Bray PG, Ward AS. Phenotypic and genotypic characteristics of recently adapted isolates of Plasmodium falciparum from Thailand. Am J Trop Med Hyg. 1999;60:469–74. doi: 10.4269/ajtmh.1999.60.469. [DOI] [PubMed] [Google Scholar]
- Price RN, Cassar C, Brockman A, Duraisingh M, Van Vugt M, White NJ, Nosten F, Krishna S. The pfmdr1 gene is associated with a multidrug-resistant phenotype in Plasmodium falciparum from the western border of Thailand. Antimicrob Agents Chemother. 1999;43:2943–2949. doi: 10.1128/aac.43.12.2943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duraisingh MT, Roper C, Walliker D, Warhurst DC. Increased sensitivity to the antimalarials mefloquine and artemisinin is conferred by mutations in the pfmdr1 gene of Plasmodium falciparum. Mol Microbiol. 2000;36:955–961. doi: 10.1046/j.1365-2958.2000.01914.x. [DOI] [PubMed] [Google Scholar]