Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2006 Jun 8;6:50. doi: 10.1186/1471-2180-6-50

Investigating the role of small, acid-soluble spore proteins (SASPs) in the resistance of Clostridium perfringens spores to heat

Deepa Raju 1,2, Michael Waters 1,2, Peter Setlow 3, Mahfuzur R Sarker 1,2,
PMCID: PMC1501028  PMID: 16759397

Abstract

Background

Clostridium perfringens type A food poisoning is caused by enterotoxigenic C. perfringens type A isolates that typically possess high spore heat-resistance. The molecular basis for C. perfringens spore heat-resistance remains unknown. In the current study, we investigated the role of small, acid-soluble spore proteins (SASPs) in heat-resistance of spores produced by C. perfringens food poisoning isolates.

Results

Our current study demonstrated the presence of all three SASP-encoding genes (ssp1, 2 and 3) in five surveyed C. perfringens clinical food poisoning isolates. β-Glucuronidase assay showed that these ssp genes are expressed specifically during sporulation. Consistent with these expression results, our study also demonstrated the production of SASPs by C. perfringens food poisoning isolates. When the heat sensitivities of spores produced by a ssp3 knock-out mutant of a C. perfringens food poisoning isolate was compared with that of spores of the wild-type strain, spores of the ssp3 mutant were found to exhibit a lower decimal reduction value (D value) at 100°C than exhibited by the spores of wild-type strain. This effect was restored by complementing the ssp3 mutant with a recombinant plasmid carrying wild-type ssp3, suggesting that the observed differences in D values between spores of wild-type versus ssp3 mutant was due to the specific inactivation of ssp3. Furthermore, our DNA protection assay demonstrated that C. perfringens SASPs can protect DNA from DNase I digestion.

Conclusion

The results from our current study provide evidences that SASPs produced by C. perfringens food poisoning isolates play a role in protecting their spores from heat-damage, which is highly significant and relevant from a food safety perspective. Further detailed studies on mechanism of action of SASPs from C. perfringens should help in understanding the mechanism of protection of C. perfringens spores from heat-damage.

Background

Clostridium perfringens is a gram-positive, spore-forming, anaerobic bacterium that has long been recognized as a significant cause of histotoxic and gastrointestinal (GI) diseases in both humans and animals [1,2]. C. perfringens isolates can be classified into one of five types (A through E) based upon their ability to produce alpha-, beta-, epsilon- and iota-toxin [2]. Although enterotoxin (CPE)-producing C. perfringens type A isolates represent <5% of global C. perfringens population, these bacteria are very important human GI pathogens, causing C. perfringens type A food poisoning and non-food-borne GI diseases [1]. Substantial experimental and epidemiological evidence [1,3] now indicates that CPE plays a major role in the development of GI symptoms in cases of C. perfringens-associated food poisoning and non-food-borne GI diseases. In addition to producing CPE, C. perfringens food poisoning isolates have the ability to form heat-resistant spores, which can survive boiling for an hour or longer [1,4,5]. The possession of high spore heat-resistance facilitates the survival of C. perfringens spores in primary food vehicles (such as meat and poultry products) where, in the presence of appropriate nutrients, dormant spores are reverted to vegetative cells and multiply, and then cause food-borne illness after consumption of these contaminated foods [1].

The molecular basis for C. perfringens spore heat-resistance remains unknown. However, since small, acid-soluble spore proteins (SASPs) from Bacillus subtilis can protect their spores from damage by heat and other environmental factors [6-8], it is very likely that C. perfringens SASPs play a similar role. Spores of Bacillus and Clostridium species contain a number of SASPs of molecular weight 5–7 kDa, which comprise 10–20% of the total spore protein [8]. These proteins are classified into two groups based on their primary sequence, an α/β-type and a ϒ-type [8]. The B. subtilis α/β-type SASPs are encoded by multiple genes and comprise a large protein family whose amino acid sequences are very highly conserved within and between species [8]. The B. subtilis α/β-type SASPs are non-specific DNA binding proteins which saturate the spore chromosome and protect spore DNA from damage caused by heat, UV radiation, and peroxidase [9-12]. Although an enormous number of studies on the role of SASPs in B. subtilis spore resistance have been carried out, nothing is known about the role of C. perfringens SASPs. However, the advance towards understanding the role of SASPs in C. perfringens spore resistance is emerging from some old studies [13-15] which revealed the existence of multiple α/β-type, but not ϒ-type, SASPs in Clostridium species. Three genes (ssp1, 2 and 3) coding for α/β-type SASPs have been cloned and nucleotide sequenced from C. perfringens old strains [16,17]. Interestingly, only these three ssp genes, compared to at-least 7 ssp genes in B. subtilis [8], were identified in the genome of C. perfringens strain 13 [18]. However, the presence and expression of these ssp genes in recent clinical C. perfringens food poisoning isolates and their role in spore heat-resistance remains unknown.

In the current study, we investigated the genetics and expression of ssp genes in C. perfringens clinical food poisoning isolates. Our study also prepared an isogenic ssp3 knock-out mutant of a C. perfringens type A food poisoning isolate. The heat sensitivities of spores produced by ssp3 knock-out mutant was compared with that of spores of the wild type strain. The results from these experiments now provide evidence that C perfringens SASPs play a role in spore heat-resistance.

Results

PCR screening and comparison of ssp ORFs in C. perfringens food poisoning isolates

We first subjected our collection of C. perfringens food poisoning isolates to ssp-specific PCR analysis to determine whether most, or all, cpe-positive food poisoning isolates carry all three ssp genes (ssp1, 2 and 3). Control PCRs were run using template DNA prepared from a known ssp-positive C. perfringens strain 13 [18]. When template DNA isolated from each of our five surveyed clinical C. perfringens food poisoning isolates was subjected to this same ssp PCR analysis, PCR products of 239-, 306-, and 522-bp were invariably obtained (see Fig. 1 for representative results). These results are in consistent with the known presence (Fig. 1) of all three ssp ORFs in the genome of the C. perfringens strain 13 [18].

Figure 1.

Figure 1

ssp PCR analysis of C. perfringens food poisoning isolates. Representative results of a PCR assay with primers designed to amplify ssp1 (A), ssp2 (B) or ssp3 (C) specific PCR products. Results are shown for control strain 13 (a known ssp1, 2 and 3-positive strain) and representative food poisoning isolates SM101 and NCTC8239. Marker indicates the migration of DNA size markers (Gene Ruler™ 1-kb ladder; Fermentas).

The nucleotide sequencing analyzes revealed (data not shown) that no mutations or termination codons were found in the ssp1, 2 or 3 ORF sequences of our five surveyed isolates that encode proteins of 60-, 59- or 60-aa, respectively. The ssp1, 2 or 3 ORF sequences and also the upstream promoter sequences are highly conserved in all our surveyed food poisoning isolates and matches exactly with previously published sequences [16,18].

Evaluation of expression of ssp genes in C. perfringens food poisoning isolates

To examine the expression of ssp genes, the putative promoter regions of ssp1, 2, or 3 from C. perfringens food poisoning isolate SM101 was fused to E. coli gusA. These ssp-gusA fusion constructs were introduced into wild-type SM101 and β-glucuronidase (GUS) activity was measured during vegetative and sporulation growth. A promoter-less gusA construct was used as a negative control to ensure the specificity and reliability of the assay (Data not shown).

When GUS assay was performed on SM101 carrying pSG12 (ssp1-gusA), pSG22 (ssp2-gusA) or pSG32 (ssp3-gusA), no significant expression of ssp1, 2 or 3 was observed in vegetative cells (Fig. 2). However, SM101 carrying ssp1-, 2-or 3-gusA showed GUS activity during sporulation. The ssp1-gusA expression began at ~4 h after induction of sporulation, with maximum specific activity attained at ~12 h after induction of sporulation (Fig. 2). Both ssp2-gusA and ssp3-gusA fusions were expressed beginning at ~2 h after induction of sporulation, with maximum specific activity attained ~6 h after induction of sporulation (Fig. 2). Collectively, these results suggest that all three ssp genes are expressed during sporulation, but not during vegetative growth.

Figure 2.

Figure 2

Expression of ssp1-gusA (A), ssp2-gusA (B) and ssp3-gusA (C) fusions in C. perfringens wild-type SM101 grown in vegetative (□) and sporulation (○) medium, and in spo0A mutant IH101 grown in sporulation medium (Δ). β-glucuronidase activity (in Miller Units) was calculated as previously described [26, 28]. Data represents the average of three independent experiments.

To analyze the sporulation-dependent expression of ssp genes further, we examined the expression of ssp1-, 2- or 3-gusA fusion in a spo0A mutant of C. perfringens. The rationale for using spo0A mutant is that, if ssp expression is truly dependent on sporulation, ssp-gusA fusions would not be expressed in sporulation-deficient spo0A mutant of C. perfringens [19]. The ssp-gusA fusion constructs pSG12 (ssp1-gusA), pSG22 (ssp2-gusA) and pSG32 (ssp3-gusA) were introduced into C. perfringens spo0A mutant strain IH101 and GUS activity was measured during sporulation growth. As shown in Fig 2, no detectable GUS activity was obtained with sporulating cultures of IH101 carrying ssp1-, 2, and 3-gusA fusions, confirming that the expression of ssp genes in C. perfringens are dependent on spo0A expression and sporulation.

SASP production by C. perfringens food poisoning isolates

Having obtained evidence that all three ssp genes are expressed in C. perfringens food poisoning isolates, we next examined whether these isolates can, in fact, produce SASPs. When acid-extracts of spores from representative C. perfringens food poisoning isolates SM101 (Fig. 3) and NCTC8239 (data not shown) were analyzed by polyacrylamide gel electrophoresis at low pH, multiple protein bands were observed. Western blot analysis, using antibodies against SspC of B. subtilis, detected SspC-specific immunoreactivity in acid-extracts of spores from SM101 and NCTC8239 (Fig. 3 and data not shown). These results indicated that C. perfringens food poisoning isolates can produce SASPs.

Figure 3.

Figure 3

Production of SASPs by cpe-positive C. perringens. (A) SASPs, prepared from a representative C. perfringens food poisoning isolate SM101, was separated by polyacrylamide gel electrophoresis at low pH and stained with Coomassie brilliant blue. (B) Western blot of the gel shown in panel A. The blot was probed with antibodies against B. subtilis SspC [13] and developed by chemiluminescence detection to identify immunoreactive species. Arrow indicates the major band that was immunoreactive with B. subtilis SspC antibody.

Creation of ssp knock-out mutants

To evaluate the role of SASPs in spore heat-resistance, we attempted to introduce knock-out mutations into each ssp gene. The mutator plasmid pDR63, pDR27 or pMRS62, carrying mutated allele Δssp1::catP, Δssp2::catP and Δssp3::catP, respectively, was introduced into C. perfringens strain SM101 by electroporation, and EmrCmr transformants were selected. As a positive control of transformation, the C. perfringens-E. coli shuttle plasmid pJIR751 encoding Emr was included. The EmrCmr transformants were obtained at ~1000-fold less frequencies than that of pJIR751-derived Emr transformants, which was expected because mutator plasmids pDR63, pDR27 and pMRS62 have no origin of replication for C. perfringens. The single cross-over event of homologous recombination was confirmed by PCR using each ssp-specific primers (data not shown). One transformant for each mutator plasmid was grown in the absence of both Em and Cm, and a double crossover event between each wild-type ssp and the respective mutated Δssp::catP allele was screened by selecting colonies for Cmr and Ems phenotypes. After screening of ~2,500 colonies from SM101(pMRS62) culture, we obtained one putative clone showing a Cmr and Ems phenotype. This putative ssp3 mutant was designated as DR101. However, no Cmr and Ems clone was obtained after screening of >3,000 colonies from each of SM101(pDR27) and SM101(pDR63) culture. Our three repeated attempts using SM101(pDR63) and SM101(pDR27) transformants from three independent electroporations were failed to isolate spp1 and ssp2 mutant, respectively.

Confirmation of DR101 as ssp3 knock-out mutant

Inactivation of ssp3 in DR101 was first demonstrated by PCR analysis (Fig. 4A) using ssp3-specific primers. An ~4.1-kb fragment carrying ssp3 was amplified from DNA of wild-type strain SM101. In contrast, an ~5.4-kb PCR product was obtained from DNA of mutant strain DR101. These PCR results are consistent with the wild-type ssp3 gene in DR101 having been replaced with the mutated allele, carrying an extra ~1.3-kb catP-containing fragment.

Figure 4.

Figure 4

Molecular analysis of ssp3 knock-out mutant. (A) PCR analysis of the total DNAs from C. perfringens wild-type and ssp3 mutant. Total DNA isolated from wild type SM101 and the ssp3 mutant DR101 strains was subjected to PCR analysis using ssp3-specific primer pair CPP13/CPP16. (B) Southern hybridization analysis of total DNAs from C. perfringens wild-type and ssp3 mutant. Two identical Southern blots were prepared using HpaI-digested DNAs from wild-type (SM101) and ssp3 mutant (DR101) and probed separately with either ssp-specific or catP-specific DIG-labeled probes. The migration of the hybridizing band derived from each strain is indicated between the two blots.

Southern blot analyses showed that a single HpaI-digested DNA fragment from wild-type strain SM101 hybridized with ssp3-specific probe (Fig. 4B). However, two hybridizing bands were observed with DNA from mutant strain, DR101 (Fig. 4B). This profile is consistent with results expected since the ~1.3-kb catP-containing fragment has an internal HpaI site. The catP-specific probe hybridized with an ~15-kb HpaI fragment of DR101 DNA, but as expected, no hybridizing band was observed with DNA from wild type SM101 (Fig. 4B). These results further confirmed that wild-type ssp3 gene in DR101 having been replaced with Δssp3::catP allele.

Sporulation and CPE production by ssp3 mutant

We first compared the sporulation capability of the ssp3 mutant against that of its wild-type. Both the mutant strain DR101 and wild-type strain SM101 exhibited significant sporulation, i.e., refractile endospores were visualized by phase-contrast microscopy after 8 h growth in DS medium (data not shown). When we compared the CPE producing capabilities of the wild-type strain SM101 and ssp3 knock-out mutant DR101, an ~35-kDa CPE-specific immunoreactive band was detected in Western blots of lysates prepared from sporulating cultures of both SM101 and DR101 (data not shown). Quantitative analyses demonstrated similar level of CPE production in both SM101 and DR101 (data not shown).

Comparison of the heat sensitivities of spores produced by C. perfringens food poisoning isolate carrying wild-type versus knock-out ssp3

In order to determine whether ssp3 has any role in spore heat-resistance, we performed experiments to evaluate the heat sensitivities of spores produced by C. perfringens wild-type and ssp3 mutant. Representative thermal death curves obtained at 100°C for heat-shocked sporulating cultures of wild-type SM101 and ssp3 mutant DR101 are shown in Fig. 5. From the Fig. 5 results, we calculated that spores of SM101, carrying the wild-type ssp3 gene, had a D value of ~90 min at 100°C, while spores of DR101, an isogenic ssp3 mutant, had a D value of ~60 min. To further confirm our results, three additional D values at 100°C for heat-shocked sporulating cultures of DR101 and SM101 were determined using three independent thermal death curves (data not shown). These results demonstrated that spores produced by the ssp3 mutant had, on average, approximately 0.5-fold-lower D value at 100°C than spores produced by the wild-type strain (the difference was statistically significant at P = 0.001).

Figure 5.

Figure 5

Thermal death curves for sporulating cultures of wild-type SM101 (●), ssp3 mutant DR101 (□), and complemented DR101(pDR18) (■) strains. The data is the result of a representative experiment; these results were highly reproducible (data not shown).

In order to determine whether the observed differences in D values between spores of SM101 and spores of DR101 was due to the specific inactivation of ssp3, D value was determined at 100°C for heat-shocked sporulating cultures of complemented strain DR101(pDR18). As calculated from Fig. 5, spores produced by DR101(pDR18) had a wild-type level D value i.e., ~90 min at 100°C. This finding was confirmed by three independent experiments. Collectively, our results indicated that the reduced heat-resistance of spores produced by the ssp3 knock-out mutant was caused by the specific inactivation of ssp3.

Protection of plasmid DNA against DNase I

Since B. subtilis SASPs have been shown to bind double-stranded DNA and protect against DNase cleavage [20], we wondered whether C. perfringens SASPs can do the same. We purified total SASPs from C. perfringens SM101 (Fig. 3) and performed SASP-DNA binding assay by measuring the ability of SASPs to protect plasmid (pJIR751) DNA from DNase I digestion. As shown in Fig. 6., when pJIR751 DNA was incubated with DNase I, no DNA band was observed after agarose gel elctrophoresis (lanes 2 and 4), indicating that DNase I is enzymatically active and completely digested the pJIR751 DNA. However, when pJIR751 DNA was incubated with C. perfringens SASPs prior to DNase I treatment, discrete DNA fragments remained after DNase I treatment (lane 3). Furthermore, the incomplete digestion of SASP-treated DNA was not due to the inhibition of DNase I activity by urea because the enzyme was completely functional in the presence of 8 M urea (Fig. 6, lane 4) that was used to dissolve SASPs. Collectively, these results indicated that SASPs protected plasmid DNA against DNase I digestion. Similar results were obtained in our three independent experiments (see Fig. 6 for representative results). This observation indicated that the function of SASPs in C. perfringens food poisoning isolates is similar to that in B. subtilis, i.e., they protect spores from heat-damage by binding to spore DNA.

Figure 6.

Figure 6

Protection of DNA against DNase I digestion by SASPs binding. The pJIR751 DNA was incubated alone (lane 1), with DNase I (lane 2), with SASPs and DNase I (lane 3) or DNase I in the presence of 8 M urea (lane 4). M indicates the migration of DNA size markers (Gene Ruler™ 1-kb ladder; Fermentas). The results are from representative experiments; these results were highly reproducible (data not shown).

Discussion

C. perfringens type A food poisoning, which currently ranks as the third most commonly reported food-borne disease in the United States [1], is caused by enterotoxigenic C. perfringens type A isolates that typically possess high spore heat-resistance [1,4]. The possession of high spore heat-resistance favors the survival of C. perfringens food poisoning isolates during incomplete cooking or inadequate holding of foods, which are the two major factors contributing to C. perfringens type A food-borne illness [1]. However, the molecular basis for C. perfringens spore heat-resistance remains unknown. In the current study, we hypothesized that SASPs produced by C. perfringens food poisoning isolates can play a role in the resistance of their spores to heat.

Our current study demonstrated the presence of all three ssp genes in a large number of clinical C. perfringens food poisoning isolates. Nucleotide sequencing revealed that the ssp ORFs in our surveyed isolates are intact, i.e., no mutations or premature termination codons were detected in the ORFs. Although previous studies [16,17] reported the presence of ssp1, 2 and 3 in C. perfringens laboratory strains, to our knowledge, our study is the first to compare all three ssp ORFs between a large number of clinical cpe-positive C. perfringens food poisoning isolates. The deduced amino acid sequence of SASPs from our surveyed C. perfringens food poisoning isolates are identical to that of the C. perfringens SASPs published earlier [16,17] and homologous to α/β-type SASPs of B. subtilis [8] indicating that the ssp ORFs present in food poisoning isolates are indeed ssp genes.

This study report evidences that the ssp genes present in C. perfringens food poisoning isolates are functional. Our GUS assay showed that ssp1, 2 and 3 from a food poisoning isolate SM101 were expressed during sporulation, but not during vegetative growth, and expression begins ~3–4 h after induction of sporulation. These results suggest that the mechanism of regulation of C. perfringens SASPs may be similar as that of B. subtilis. In B. subtilis, SASPs synthesis begins 3–4 h into sporulation, when all three major SASPs are synthesized in parallel [8]. The differential expression of ssp genes (Fig. 2) can not be explained by the differences in ribosome binding sites (rbs) because the putative rbs is highly conserved among the three ssp genes (data not shown). Further support for the sporulation-dependent expression of C. perfringens ssp genes came from our observations that no GUS activity was detected in spo0A mutant IH101 carrying ssp1-, 2- or 3-gusA fusion. Consistent with these expression results, our study also provides evidence that C. perfringens food poisoning isolates can, in fact, produce SASPs. The multiple protein bands obtained in our study from acid extracts of spores produced by food poisoning isolates (Fig. 3) were also observed previously [13] in acid extracts of spores produced by C. perfringens NCTC9268. The identity of these acid-soluble spore proteins as SASPs was confirmed by Western blot analyses using B. subtilis SspC antibody (Fig. 3). The single immunoreactive band observed in Western blot can be explained by the fact that C. perfringens ssp1, 2 and 3 are highly homologous (>90%) to each other and encode similar sized proteins (59–60 aa). Collectively, the presence and expression of ssp genes in C. perfringens food poisoning isolates, which possess high spore heat-resistance as indicated in a previous study [4], significantly strengthen the hypothesis that SASPs are associated with heat-resistance of spores produced by these isolates.

The present study's most significant finding is the presentation of the first genetic evidence that C. perfringens SASPs play a role in heat-resistance of spores produced by C. perfringens. The inactivation of ssp3 significantly affected the heat-resistance of spores produced by a food poisoning isolate SM101. Our findings that i) spores of ssp3 knock-out mutant exhibited lower heat-resistance than that of the spores of wild type and ii) reversion of this effect by complementing the mutant with a recombinant plasmid carrying wild type ssp3, provided direct genetic evidence supporting the strong linkage between the production of SASPs and the resistance of spores to heat. The slight reduction of D value in spores of ssp3 mutant compared to the D value of spores of wild-type can be explained by the presence of the functional ssp1 and ssp2 genes in ssp3 mutant strain DR101. Our DNA protection assay also supports the role of C. perfringens SASPs in spore heat-resistance by demonstrating that C. perfringens SASPs, like B. subtilis SASPs [20], can protect plasmid DNA from DNase I digestion. Further studies on characterization of SASP-DNA binding and the effect of this binding on plasmid topology should help in understanding the mechanism of interaction between DNA and SASPs from C. perfringens.

To our knowledge, this report represents the first successful study involving the construction of a C. perfringens ssp knock-out mutant. The greatest challenge faced in our ssp knock-out study was the lack of an easy screening method for the second cross-over event. Although in our first attempt, using the double-antibiotic selection strategy [3], we were able to isolate ssp3 knock-out mutant, our three similar independent attempts were failed to isolate ssp1 and ssp2 mutant. The reasons for these failures can not be explained by the lack of sufficient amount of homologous DNA in mutator plasmids [21] because, both pDR62 and pDR27 carry at-least 1.4-kb homologous DNA located on either side of the insertionally inactivated ssp gene that should be sufficient to allow double-reciprocal crossover event [19]. It is also unlikely that incorporation of catP in ssp1 or ssp2 can cause polar effect on the downstream gene whose expression is essential for the survival of C. perfringens cells because our nucleotide sequencing analyses (data not shown) demonstrated that neither ssp1 nor ssp2 forms an operon with any downstream gene in the genome of SM101. Therefore, further research is needed to identify the relevant obstacles for isolating ssp1 and ssp2 mutants.

Conclusion

The current study demonstrated that i) all three ssp genes are present and expressed in a large number of clinical C. perfringens food poisoning isolates, ii) ssp3 knock-out mutant of C. perfringens food poisoning isolate possess lower spore-heat resistance compared to that of its parent strain and this effect could be restored by complementing the mutant with wild-type ssp3 gene, and iii) SASPs from C. perfringens food poisoning isolate can protect DNA from DNase I digestion. Collectively, these results support our initial hypothesis that SASPs produced by C. perfringens food poisoning isolates can play a role in resistance of their spores to heat. These findings are highly significant and relevant from a food safety perspective because the possession of high spore heat-resistance favors the survival of C. perfringens food poisoning isolates in primary food vehicles (such as, meat and poultry products) contributing to C. perfringens food-borne illnesses [1]. Further detailed studies on mechanism of action of SASPs from C. perfringens should help in understanding the mechanism of protection of C. perfringens spores from damage caused by heat and other environmental stresses.

Methods

Bacterial strains and growth conditions

C. perfringens strains and plasmids used in this study are listed and described in Table 1. Starter culture (10 ml) of each C. perfringens isolate was prepared by overnight growth at 37°C in fluid thioglycollate broth (FTG) (Difco) as described previously [22]. For DNA isolation, an aliquot (0.2 ml) of each FTG culture was inoculated into 10 ml of TGY broth (3% Trypticase, 2% glucose, 1% yeast extract, 0.1% cysteine [22]) which was then incubated at 37°C for 18 h without shaking. For selecting C. perfringens transformants carrying recombinant plasmids, C. perfringens cultures were plated on Brain Heart Infusion agar plate containing erythromycin (50 μg/ml) or chloramphenicol (20 μg/ml) and incubated at 37°C. Sporulating cultures of C. perfringens were prepared by inoculating 0.2 ml of starter FTG medium culture into 10 ml of Duncan-Strong (DS) sporulating medium [22], which was then incubated for 24 h at 37°C. The presence of sporulating cells in each DS medium culture was confirmed by phase-contrast microscopy [19,23].

Table 1.

Bacterial strains and Plasmids used in this study

Bacterial strain/Plasmid Relevant Characteristicsa Sources or Reference
C. perfringens
 SM101 Electroporatable derivative of food poisoning type A isolate, NCTC8798, carries a chromosomal cpe [28]
 NCTC8239 Food poisoning type A isolate carrying a chromosomal cpe [30]
 FD1041 Food poisoning type A isolate carrying a chromosomal cpe [30]
 NCTC10239 Food poisoning type A isolate carrying a chromosomal cpe [30]
 C1841 Food poisoning type A isolate carrying a chromosomal cpe [30]
 13 Type A, laboratory strain [18]
 IH101 spo0A mutant derivative of SM101 [19]
 DR101 ssp3 mutant derivative of SM101 This study
Plasmids
 pJIR 751 C. perfringens E. coli shuttle vector ; Emr [25]
 pJIR 418 C. perfringens E. coli shuttle vector ; Cmr, Emr [31]
 pMRS104 Suicidal plasmid, no origin of replication for Clostridia; Emr [19]
 pSM104 cpe-gusA in pJIR750; Cmr [26]
 pSM242 sigK-gusA fusion in pJIR750; Cmr S.B. Melville
 pMRS127 sigK-gusA fusion in pJIR751; Emr This study
 pMRS130 pJIR751 carrying promoter-less gusA; Emr This study
 pBH2 ssp3 and 1.9-kb each upstream and downstream region cloned into pCR®-XL-TOPO®. This study
 pSG11 ssp1 promoter in pCR®-XL-TOPO® This study
 pSG12 ssp1-gusA in pMRS127; Emr This study
 pDR13 ssp2 and 1.4-kb each upstream and downstream region cloned into pCR®-XL-TOPO®. This study
 pDR14 NruI site incorporated into ssp2 in pDR13 This study
 pDR17 ssp3 with its promoter in pCR®-XL-TOPO® This study
 pDR18 ssp3 with its promoter in pJIR751; Emr This study
 pSG21 ssp2 promoter in pCR®-XL-TOPO® This study
 pSG22 ssp2-gusA in pMRS127; Emr This study
 pDR26 ssp2::catP in pCR®-XL-TOPO® This study
 pDR27 ssp2::catP in pMRS104; EmrCmr This study
 pSG31 ssp3 promoter in pCR®-XL-TOPO® This study
 pDR 31 ssp1 and 1.5-kb each upstream and downstream region cloned into pCR®-XL-TOPO®. This study
 pSG32 ssp3-gusA in pMRS127; Emr This study
 pMRS60 HpaI site incorporated into ssp3 in pBH2 This study
 pMRS61 ssp3::catP in pMRS60; CmrKmr This study
 pMRS62 ssp3::catP in pMRS104; EmrCmr This study
 pDR61 NruI site incorporated into ssp1 in pDR31 This study
 pDR62 ssp1::catP in pDR61; CmrKmr This study
 pDR63 ssp1::catP in pMRS104; EmrCmr This study

a. Emr, Cmr, Kmr: resistance to erythromycin, chloramphenicol and kanamycin, respectively.

ssp-specific PCR analysis

Total C. perfringens DNA was isolated from the overnight TGY medium cultures using a previously described protocol [4,24]. The isolated DNA was then subjected to ssp PCR analysis using primers specific for each of the ssp1, 2 or 3 genes as designed based on C. perfringens strain 13 genome sequence [18] (Table 2). Although the SASPs are multigene family proteins and the coding regions of three C. perfringens ssp are very similar, no sequence similarities were found between the flanking regions of these genes [16,18]. Therefore, each PCR primer pairs (Table 2) designed from the flanking region of each of the ssp gene amplified the respective ssp ORF sequences. These PCRs utilized 100 ng of template DNA, 25 pM of each primer, 200 μM deoxynucleoside triphosphates (dNTPs) (Roche), 2.5 mM MgCl2, and 1 U of Taq DNA polymerase (Fermentas) in a total volume of 50 μl. The reaction mixture was placed in a thermal cycler (Techne) for an initial period of 5 min at 94°C, then 28 cycles, each consisting of 1 min at 94°C, 1 min at 43°C (for CPP7/CPP8 and CPP9/CPP10) or 44°C (for CPP11/CPP34), 1 min at 72°C, and followed by an additional period of extension for 10 min at 72°C. After PCR, the presence of an amplified product was analyzed by subjecting an aliquot of each PCR sample to agarose (1.5%) gel electrophoresis.

Table 2.

Primers used in this study

Primers name Primer Sequencea Positionb Gene Usec
CPP 7 5' GCTTACAAATTACCAAAGCC 3' -36 to -17 ssp1 PCR, Se
CPP 8 5' CAGTATTAGCGAAAGGTTTG 3' 83 to 202 ssp1 PCR, Se
CPP 9 5' CTCCTATAATTCCCTCTCAT 3' -105 to -86 ssp2 PCR, Se
CPP10 5' GTAGACTTTAATAGGTTCAGG 3' 180 to 200 ssp2 PCR, Se
CPP11 5' CTGCACATCATAATATTGAAAGG 3' -80 to -58 ssp3 PCR, Se
CPP 13 5' GAGGGTCCTATTGTAGGAGGATT 3' -2010 to -1888 ssp3 MP, SB
CPP 16 5' ATAGCAGGAGGAGCTATTCCAC 3' 2099 to 2120 ssp3 MP, SB
CPP 21 5' CGGAGACCTTAGCTCAAGTTAACGCGGAAGCGTTGGTGGAG 3' 95 to 135 ssp3 SDM
CPP 22 5' CTCCACCAACGCTTCCGCGTTAACTTGAGCTAAGGTCTCCG 3' 95 to 135 ssp3 SDM
CPP 34 5' GCTATGGATCTTATGGAAGG 3' 423 to 442 ssp3 PCR, Se
CPP37 5' CGGCTTCTAGCACATCTTCT 3' -1662 to -1593 ssp2 MP, SB
CPP38 5' TATGTGGAGCAGGAATTGCC 3' 1449 to 1469 ssp2 MP, SB
CPP47 5'GTACCATTCTCAGATTACAATGTCGCGAAGCGTTGGTGGAGAAATGG3' 73 to 113 ssp2 SDM
CPP48 5' CCATTTCTCCACCAACGCTTCGCGACATTGTAATCTGAGAATGGTAC 3' 73 to 113 ssp2 SDM
CPP45 5' CCAGGAAAGTATGGACAAGC -1564 to -1544 ssp1 MP
CPP139 5' CCTCACCATTATCCTCTACAAG 3' 1782 to 1802 ssp1 MP
CPP104 5' GCTAGAGAATTAGGGGTACCTCGCGACCTAAGTTCAAGACAA 3' 60 to 116 ssp1 SDM
CPP105 5' TTGTCTTGAACTTAGGTCGCGAGGTACCCCTAATTCTCTAGC 3' 60 to 116 ssp1 SDM
CPP 57 5' GCGTCGACCTGTTTGAGCTTTTTTC 3' -200 to -213 ssp3 promoter GUS
CPP 58 5' GCTGCAGCCTGGAACTAAATGTTGT 3' 3 to 21 ssp3 promoter GUS
CPP 63 5' GCGTCGACTAGGTGCAGAAGC 3' -219 to -203 ssp1 promoter GUS
CPP 64 5' GCTGCAGCTGGAACTAATGATTTTGAC 3' 3 to 21 ssp1 promoter GUS
CPP 65 5' GCGTCGACGGAACTAAAGCTAAATTTGG 3' -238 to -223 ssp2 promoter GUS
CPP 66 5' GCTGCAGGCTTCTGGTACTAAATGTTGTG 3' 3 to 25 ssp2 promoter GUS

a Restriction sites are marked by underlining.

bThe nucleotide position numbering begins from the first codon and refers to the relevant position within the respective ssp gene sequence [18].

cPCR, polymerase chain reaction; Se, sequencing studies; MP, construction of mutator plasmid; SB, southern blot analysis; SDM, site-directed muatgenesis. GUS, construction of plasmid for β-glucuronidase assay.

Cloning and sequencing of the ssp-containing fragments from various cpe-positive isolates

The DNA fragment containing ssp ORFs and an ~200 bp upstream sequence from each of five C. perfringens chromosomal cpe isolates was amplified by PCR as described above. These PCR products were then cloned into pCR®-XL-TOPO® vector using the TOPO® XL cloning kit (Invitrogen). Both strands of the ssp-containing DNA insert present in recombinant pCR®-XL-TOPO® plasmid was then sequenced using M13 forward and reverse primers.

Construction of gusA-fusion plasmids and β-glucuronidase assay

The gusA reporter vector pSM242 (obtained from Dr. Melville as a gift), is a derivative of an E. coli-C. perfringens shuttle vector pJIR750 [25], encoding chloramphenicol resistance (Cmr), contains the following features: i) four tandem terminators to minimize vector-based transcription, ii) multicloning sites located upstream of a promoterless cpe-gusA fusion, iii) the ribosome binding site and the first 13 amino acids of the cpe gene coding region to provide efficient translation [26] and iv) the E. coli gusA [27] as a transcriptional reporter element. Since our C. perfringens spo0A mutant already contained Cmr marker, for our study we first constructed an erythromycin resistant (Emr) derivative of pSM242. An ~2.5-kb EcoRI-HindIII fragment of pSM242 was cloned into EcoRI/HindIII sites of an E. coli-C. perfringens shuttle vector pJIR751 [25], which encodes Emr, to create pMRS127.

The PCR amplified product (~200-bp) carrying the upstream region of each ssp was first cloned into pCR®-XL-TOPO® vector using TOPO®-XL cloning kit (Invitrogen). Briefly, the DNA fragment carrying the promoter region of each of ssp1, 2 or 3 from SM101 (a food poisoning isolate carrying cpe on the chromosome) was amplified by PCR using primers CPP63/CPP64, CPP65/CPP66 and CPP57/CPP58, respectively (Table 2). The SalI site was incorporated in the forward and PstI site in the reverse primers of each primer pairs. These PCR products were then cloned into pCR®-XL-TOPO® vector. The SalI-PstI fragments carrying the promoter regions of ssp1, 2 or 3 from pCR®-XL-TOPO® clones were then re-cloned into the SalI/PstI sites of pMRS127 to create ssp1-, 2- or 3-gusA fusion constructs, pSG12, pSG22 or pSG32, respectively. As a negative control, pMRS130 carrying promoter-less gusA was constructed by cloning of XbaI-SacI fragment from pSM104 [26] into the XbaI/SacI sites of pJIR751. These plasmids were then introduced into C. perfringens wild-type SM101 or spo0A mutant IH101 by electroporation [24] and Emr transformants were selected. The SM101 and IH101 transformants carrying ssp-gusA fusions or promoter-less gusA were grown in vegetative and sporulation conditions and tested for β-glucuronidase (GUS) activity as previously described [26,28].

Extraction of SASPs and Western blotting

C. perfringens SASP was extracted using the protocol as previously described [29]. Briefly, sporulating cells of C. perfringens were sonicated and then centrifuged. The spores were washed several times with distilled water and lyophilized. The dried spores were subjected to dry rupture in a dental amalgamator (Wig-L-Bug) using 0.1 g of glass beads as an abrasive. The spore powder was resuspended in 3% acetic acid solution and then subjected to dialysis (Spectr/por®3, MWCO- 3,500, Spectrum laboratories) against 1% acetic acid solution at 4°C for at least 24 h. The sample was lyophilized and used for analysis by polyacrylamide gel electrophoresis at low pH as previously described [29]. The gel was run at 20 mA with the appropriate electrode polarity since SASPs are positively charged and hence run towards the cathode. The gel was stained with commassie brilliant blue (Bio-Rad) or transferred to a nitrocellulose membrane for Western blotting. The blot was probed with antibodies against B. subtilis SspC [13,29] and developed for chemiluminescence detection (Pierce) to identify immunoreactive species.

Construction of mutator plasmids for ssp1, 2 and 3

ssp1 mutator plasmid: A 3306-bp DNA fragment containing ssp1 ORF and ~1.5-kb each upstream and downstream region was PCR amplified from genomic DNA of SM101 using primers CPP45 and CPP139 (Table 2) and cloned into pCR®-XL-TOPO® (Invitrogen) to create pDR31. The 15-bp (nucleotides 80–94 from ATG) internal deletion as well as a unique NruI site was incorporated in ssp1 in pDR31 by site-directed mutagenesis using Quick Change Mutagenesis System (Qiagen) using primers CPP104 and CPP105 to create pDR61. Plasmid pDR62 was construced by cloning a 1.3-kb SmaI-NaeI fragment of pJIR418, carrying chloramphenicol resistance marker catP, into NruI site of pDR61. The ssp1 mutator plasmid, pDR63, was then constructed by re-cloning the BamHI-XhoI fragment containing Δssp1::catP allele, from pDR62 into BamHI/SalI sites of suicidal plasmid pMRS104.

ssp2 mutator plasmid: A 3081-bp DNA fragment containing ssp2 ORF and ~1.4-kb each upstream and downstream region was PCR amplified from genomic DNA of SM101 using primers CPP37 and CPP38 (Table 2) and cloned into pCR®-XL-TOPO® (Invitrogen) to create pDR13. Plasmid pDR14 was constructed by deleting 15-bp (nucleotides 102–115 from ATG) internal ssp2 fragment as well as incorporating a unique NruI site in ssp2 present in pDR13 by site-directed mutagenesis using Quick Change Mutagenesis System (Qiagen) using primers CPP47 and CPP48. A 1.3-kb SmaI-NaeI fragment of pJIR418, carrying chloramphenicol resistance marker catP, was cloned into NruI site of pDR14 to create plasmid pDR26. The ssp2 mutator plasmid pDR27 was then constructed by re-cloning the BamHI-XhoI fragment containing Δssp2::catP allele, from pDR62 into BamHI/SalI sites of suicidal plasmid pMRS104.

ssp3 mutator plasmid: A 4129-bp DNA fragment, carrying the ssp3 ORF and ~1.9-kb each upstream and downstream region, was PCR amplified from genomic DNA of SM101 using primers CPP13 and CPP16 (Table 2). This PCR fragment was cloned into pCR®-XL-TOPO® (Invitrogen) to create the plasmid pBH2. A unique HpaI restriction site was incorporated into the ssp3 ORF (at position 117 from ATG) present in pBH2 by site-directed mutagenesis using Quick Change Mutagenesis System (Qiagen) using primers CPP21 and CPP22 to create pMRS60. The catP gene was then inserted into the unique HpaI site located within the ssp3 ORF in pMRS60 by digesting pMRS60 with HpaI and ligating with a 1.3-kb SmaI-NaeI fragment containing the catP gene from pJIR418, to create pMRS61. The ssp3 mutator plasmid pMRS62 was then constructed by re-cloning the KpnI-XhoI fragment of pMRS61 into KpnI/SalI sites of suicidal plasmid pMRS104.

Isolation of ssp knock-out mutants

The mutator plasmids pDR63, pDR27 and pMRS62 were used to transform, by electroporation [24], C. perfringens isolate SM101 to Erythromycin (Em) (50 μg/ml) and Chloramphenicol (Cm) (20 μg/ml) resistance. One transformant for each plasmid was grown in TGY broth without any antibiotics and colonies sensitive to Em, but resistant to Cm were selected as previously described [3,19].

Southern blot analysis

The ssp3-specific DNA probe was prepared using a 4129-bp DNA fragment, carrying ssp3 and ~1.9-kb each upstream and downstream region. This DNA fragment was amplified by PCR from genomic DNA of SM101 using primers CPP13 and CPP16 (Table 2). The catP probe was produced using a 517-bp EcoRV-HpaI fragment, containing internal catP gene sequences, from pJIR418. These ssp3- and catP-containing DNA fragments were labeled using a Random Primed DNA Labeling system (Roche). Total DNA from wild type and ssp3 mutant strains was digested with HpaI and two identical Southern blots were prepared using this digested DNA and hybridized, separately, with probes specific for the ssp3 or catP. The hybridized probe was detected using a DIG-chemiluminescence detection system utilizing CSPD® [disodium 3-(4-methoxyspiro[1]-4-yl)phenyl phosphate] ready-to-use substrate (Roche) as previously described [3,4].

CPE Western blot analysis

C. perfringens strains grown in DS or FTG medium were sonicated until >95% of all cells were lysed (lysis was continuously monitored by phase-contrast microscopy). After sonication, each culture lysate was analyzed for the presence of CPE by Western blot analysis using a CPE antibody as previously described [4,22].

Determination of D values for C. perfringens spores

The heat sensitivities of C. perfringens spores was determined as described previously [4]. Briefly, DS medium cultures prepared and grown for 24 h as described above were heat shocked at 75°C for 20 min which killed the remaining vegetative cells and facilitated spore germination. A 0.1 ml aliquot of each heat-shocked DS medium culture was then serially diluted with sterile FTG medium and each dilution was plated onto Brain Heart Infusion (BHI) agar plates to establish the number of viable spores per milliliter of DS medium culture at the start of heating (i.e., the zero time point of the experiment).

The remainder of each heat-shocked DS medium culture was then heated at 100°C for time period ranging from 30 min to 90 min. At each time point, a 0.1-ml aliquot was withdrawn and diluted with FTG broth. The dilutions were then plated on BHI agar plates, which were incubated anaerobically at 37°C for 24 h. Colonies which developed from germinated spores that survived heating were counted to determine the number of viable colony forming unit (CFU) that were present per milliliter of each heated DS medium culture at each time point. The CFU values were then graphed to determine decimal reduction value (D value) (i.e., the time that a culture had to be kept at a given temperature to obtain a 90% reduction in viable cell numbers) for spores of each isolate tested.

Assay of SASP-nucleic acid binding

The binding of C. perfringens SASPs to nucleic acid was assessed by measuring the ability of SASP to protect nucleic acid from nuclease digestion as previously described [20]. Briefly, SASPs was prepared from C. perfringens SM101 spores as described above and quantified using the Bradford protein assay kit (Bio-Rad). 3 μg of plasmid pJIR751 DNA was incubated in 25 μl of 10 mM Tris-acetate (pH 7.0) -1 mM EDTA with 3 μg of SASPs (1:1 ratio). After 1 h at 37°C, 3 μl of DNase I buffer was added, followed by 2 μl of DNase I (Farmentas). The solution was incubated a further 10 min at 37°C, and then 100 μl of 1.25% sodium dodecyl sulfate (SDS)-25 mM EDTA was added, followed by 13 μl of 5 M NaCl and 350 μl of ethanol to precipitate the DNA. The precipitated DNA was dissolved in 10 μl of water and subjected to agarose (1.5%) gel electrophoresis. The presence or absence of DNA was observed under UV illumination after staining with ethidium bromide.

Statistical analyses

Statistical analyses were performed with student's t test.

Authors' contributions

DR carried out most of the experiments, and participated in the discussions on the study design, analyses and interpretation of the data, and in the writing of the manuscript. MW carried out experiments related to isolation of SASPs from C. perfringens. PS participated as a consultant and hosted MW in his laboratory to learn basic techniques for isolation of SASPs. MRS, as a principal author of this manuscript, participated in the planning and designing of the experiments and writing of the manuscript.

Acknowledgments

Acknowledgements

This research was supported by a grant from the N. L. Tartar Foundation of Oregon State University and by USDA grant 2002-02281 from the Ensuring Food Safety Research Program (all to M.R.S). We are grateful to Dr. B. A. McClane, University of Pittsburgh School of Medicine, for providing us with CPE antibody. We thank Nahid Mahfuz for her technical assistance.

Contributor Information

Deepa Raju, Email: rajud@onid.orst.edu.

Michael Waters, Email: mswaters@usc.edu.

Peter Setlow, Email: setlow@nso2.uchc.edu.

Mahfuzur R Sarker, Email: sarkerm@oregonstate.edu.

References

  1. McClane BA. Clostridium perfringens. In: M. P. Doyle LRBTJM, editor. Food microbiology: fundamentals and frontiers. 2nd. Washington, D.C., ASM Press; 2001. pp. 351–372. [Google Scholar]
  2. McDonel JL. Toxins of Clostridium perfringens type A, B, C, D, and E. In: Drews FDH, editor. Pharmacology of bacterial toxins. Oxford, United Kingdom, Pergamon Press; 1986. pp. 477–517. [Google Scholar]
  3. Sarker MR, Carman RJ, McClane BA. Inactivation of the gene (cpe) encoding Clostridium perfringens enterotoxin eliminates the ability of two cpe-positive C. perfringens type A human gastrointestinal disease isolates to affect rabbit ileal loops. Mol Microbiol. 1999;33:946–958. doi: 10.1046/j.1365-2958.1999.01534.x. [DOI] [PubMed] [Google Scholar]
  4. Sarker MR, Shivers RP, Sparks SG, Juneja VK, McClane BA. Comparative experiments to examine the effects of heating on vegetative cells and spores of Clostridium perfringens isolates carrying plasmid genes versus chromosomal enterotoxin genes. Appl Environ Microbiol. 2000;66:3234–3240. doi: 10.1128/AEM.66.8.3234-3240.2000. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  5. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev. 2000;64:548–572. doi: 10.1128/MMBR.64.3.548-572.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Setlow P. Mechanisms for the prevention of damage to DNA in spores of Bacillus species. Ann Rev Microbiol. 1995;49:29–54. doi: 10.1146/annurev.mi.49.100195.000333. [DOI] [PubMed] [Google Scholar]
  7. Setlow P. Small, acid-soluble proteins of Bacillus species: structure, synthesis, genetics, function and degradation. Ann Rev Microbiol. 1988;42:319–338. doi: 10.1146/annurev.mi.42.100188.001535. [DOI] [PubMed] [Google Scholar]
  8. Fairhead H, Setlow B, Setlow P. Prevention of DNA damage in spores and in vitro by small, acid-soluble proteins from Bacillus subtilis. J Bacteriol. 1993;175:1367–1374. doi: 10.1128/jb.175.5.1367-1374.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Mason JM, Setlow P. Essential role of small, acid-soluble spore proteins in resistance of Bacillus subtilis spores to UV light. J Bacteriol. 1986;167:174–178. doi: 10.1128/jb.167.1.174-178.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Setlow B, Setlow P. Binding of small, acid-soluble spore proteins to DNA plays a significant role in the resistance of Bacillus subtilis spores to hydrogen peroxide. Appl Environ Microbiol. 1993;59:3418–3423. doi: 10.1128/aem.59.10.3418-3423.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Setlow B, Setlow CA, Setlow P. Killing bacterial spores by organic hydroperoxidases. J Ind Microbiol. 1997;18:384–388. doi: 10.1038/sj.jim.2900399. [DOI] [Google Scholar]
  12. Cabrera-Mattinez RM, Mason JM, Setlow B, Waites WM, Setlow P. Purification and amino acid sequence of two small, acid-soluble proteins from Clostridium bifermentans spores. FEMS Microbiol Lett. 1989;61:139–144. doi: 10.1016/0378-1097(89)90185-7. [DOI] [PubMed] [Google Scholar]
  13. Granum PE, Richardson M, Bolm H. Isolation and amino acid sequence of an acid soluble spore protein from Clostridium perfringens. FEMS Microbiol Lett. 1987;42:225–230. [Google Scholar]
  14. Setlow P, Waites WM. identification of several unique low molecular weight basic proteins in dormant spores of Clostridium bifermentans and their degradation during spore germination. J Bacteriol. 1976;127:1015–1017. doi: 10.1128/jb.127.2.1015-1017.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cabrera-Martine RM, Setlow P. Cloning and nucleotide sequence of three genes coding for small, acid-soluble proteins of Clostridium perfringens spores. FEMS Microbiol Lett. 1991;77:127–132. doi: 10.1016/0378-1097(91)90539-m. [DOI] [PubMed] [Google Scholar]
  16. Holck A, Bolm H, Granum PE. Cloning and sequencing of the genes encoding acid-soluble spore proteins from Clostridium perfringens. Gene. 1990;92:107–111. doi: 10.1016/0378-1119(90)90169-R. [DOI] [PubMed] [Google Scholar]
  17. Shimizu T, Ohtani K, Hirakawa H, Ohshima K, Yamashita A, Shiba T, Ogasawara N, Hattori M, Kuhara S, Hayashi H. Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater. Proc Natl Acad Sci U S A. 2002;99:996–1001. Epub 2002 Jan 15.. doi: 10.1073/pnas.022493799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Huang IH, Waters M, Grau RR, Sarker MR. Disruption of the gene (spo0A) encoding sporulation transcription factor blocks endospore formation and enterotoxin production in enterotoxigenic Clostridium perfringens type A. FEMS Microbiol Lett. 2004;233:233–240. doi: 10.1016/j.femsle.2004.02.014. [DOI] [PubMed] [Google Scholar]
  19. Setlow B, Dongxu S, Setlow P. Interaction between DNA and alpha/beta-type small. acid-soluble spore proteins: a new class of DNA-binding protein. J Bacteriol. 1992;174:2312–2322. doi: 10.1128/jb.174.7.2312-2322.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Awad MM, Bryant AE, Stevens DL, Rood JI. Virulence studies on chromosomal alpha-toxin and theta-toxin mutants constructed by allelic exchange provide genetic evidence for the essential role of alpha-toxin in Clostridium perfringens-mediated gas gangrene. Mol Microbiol. 1995;15:191–202. doi: 10.1111/j.1365-2958.1995.tb02234.x. [DOI] [PubMed] [Google Scholar]
  21. Kokai-Kun JF, Songer JG, Czeczulin JR, Chen F, McClane BA. Comparison of Western immunoblots and gene detection assays for identification of potentially enterotoxigenic isolates of Clostridium perfringens. J Clin Microbiol. 1994;32:2533–2539. doi: 10.1128/jcm.32.10.2533-2539.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Collie RE, Kokai-kun JF, McClane BA. Phenotypic characterization of enteropathogenic Clostridium perfringens isolates from non-food-borne human gastrointestinal diseases. Anaerobes. 1998;4:69–79. doi: 10.1006/anae.1998.0152. [DOI] [PubMed] [Google Scholar]
  23. Czeczulin JR, Collie RE, McClane BA. Regulated expression of Clostridium perfringens enterotoxin in naturally cpe-negative type A, B, and C isolates of C. perfringens. Infect Immun. 1996;64:3301–3309. doi: 10.1128/iai.64.8.3301-3309.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Bannam TL, Rood JI. Clostridium perfringens-Escherichia coli shuttle vectors that carry single antibiotic resistance determinants. Plasmid. 1993;29:233–235. doi: 10.1006/plas.1993.1025. [DOI] [PubMed] [Google Scholar]
  25. Melville SB, Labbe RG, Sonenshein AL. Expression from the Clostridium perfringens cpe promoter in Clostridium perfringens and Bacillus subtilis. Infect Immun. 1994;62:5550–5558. doi: 10.1128/iai.62.12.5550-5558.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jefferson RA, Burges SM, Hirsh D. b-Glucuronidase from E. coli as a gene-fusion marker. Proc Natl Acad Sci U S A. 1986;83:8447–8451. doi: 10.1073/pnas.83.22.8447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Zaho Y, Melville SB. Identifaction and characterization of sporulation-dependent promoter upstream of the enterotoxin gene (cpe) of Clostridium perfringens. J Bacteriol. 1998;180:136–142. doi: 10.1128/jb.180.1.136-142.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nicholson WL, Setlow P. Sporulation, germination and outgrowth. In: Cutting CRHSM, editor. Molecular biological methods for Bacillus. Chichester, John Wiley and Sons; 1990. pp. 391–450. [Google Scholar]
  29. Collie RE, McClane BA. Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal diseases. J Clin Microbiol. 1998;36:30–36. doi: 10.1128/jcm.36.1.30-36.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sloan J, Warner TA, Scott PT, Bannam TL, Berryman DI, Rood JI. Construction of a sequenced Clostridium perfringens-Escherichia coli shuttle plasmid. Plasmid. 1992;27:207–219. doi: 10.1016/0147-619x(92)90023-4. [DOI] [PubMed] [Google Scholar]

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES