Abstract
Rhabdomyosarcomas are characterized by loss of heterozygosity (LOH) at chromosome region 11p15.5, a region known to contain several imprinted genes including insulin-like growth factor 2 (IGF2), H19, and p57KIP2. We analyzed 48 primary tumour samples and found distinct genetic changes at 11p15.5 in alveolar and embryonal histological subtypes. LOH was a feature of embryonal tumours, but at a lower frequency than previous studies. Loss of imprinting (LOI) of the IGF2 gene was detected in 6 of 13 informative cases, all harbouring PAX3-FKHR or PAX7-FKHR fusion genes characteristic of alveolar histology. In contrast, H19 imprinting was maintained in 14 of 15 informative cases and the case with H19 LOI had maintenance of the IGF2 imprint indicating separate mechanisms controlling imprinting of IGF2 and H19. The adult promoter of IGF2, P1, was used in 5 of 14 tumours and its expression was unrelated to IGF2 imprinting status implying a further mechanism of altered IGF2 regulation. The putative tumour suppressor gene p57KIP2 was expressed in 15 of 29 tumours and expression was unrelated to allele status. Moreover, in tumours with p57KIP2 expression, there was no evidence for inactivating mutations, suggesting that p57KIP2 is not a tumour suppressor in rhabdomyosarcoma.
Keywords: rhabdomyosarcoma, imprinting, H19, insulin-like growth factor 2, p57KIP2
Introduction
Genomic imprinting is defined as the differential expression of alleles depending on parent of origin [1]. Deregulation of imprinted genes is increasingly being recognized as a mechanism of tumourigenesis in human cancer. Chromosome region 11p15.5 contains a cluster of imprinted genes and is the most consistent site of allele loss in rhabdomyosarcoma, an embryonal muscle cancer most commonly occurring in childhood [2]. Allele loss at 11p15.5, as demonstrated by the loss of heterozygosity (LOH) of polymorphic markers, was initially reported as being specific for the embryonal histological subtype, whereas characteristic reciprocal translocations t(2;13)(p35;q14) and t(1;13)(q36;p14) are the hallmark of the alveolar subtype [3,4]. These two translocations lead to deregulation of PAX3 and PAX7, respectively, through fusion to the transactivation domain of the human forkhead-like gene (FKHR) gene on chromosome 13q14 [4,5]. The translocations may therefore be referred to collectively as the FKHR disrupting translocations. In Wilms tumour, (another embryonal tumour of childhood), allele loss at 11p15.5 has been shown to be specific for the maternally inherited allele [6], the significance of which is demonstrated by the pattern of imprinting of genes within the region of common allele loss. In particular, the insulin-like growth factor 2 gene (IGF2) is maternally imprinted (paternally expressed), and so maternal allele loss leads to either no change in effective gene dosage, or to increased gene dosage if there is associated paternal duplication. Two neighbouring genes, H19 and p57KIP2, are paternally imprinted [7,8]. Mutation or deletion of the maternally inherited copy of these genes therefore results in loss of all active gene function circumventing the requirement for mutation of the retained paternally inherited copy.
IGF-II is an important fetal growth stimulatory factor which is a ligand for the insulin-like growth factor 1 receptor (IGF-IR) [9]. IGF-IR is a transmembrane tyrosine kinase linked to the RAS-RAF-MAPK cascade and the PI3 kinase cascade, and its activation results in both cell cycle progression and protection from apoptosis [10]. Overexpression in fibroblasts of IGF-I, but not platelet-derived growth factor (PDGF) and epidermal growth factor (EGF), permits growth in serum-free media in the absence of any other growth stimulatory factors [11,12]. Its expression is a requirement for malignant transformation by several dominant oncogenes [13,14]. The IGF2 gene has a complex 5′ upstream region with four different promoters (P1 to P4) of which P2 to P4 are active in embryogenesis and imprinted [15]. In adults, promoter P1-mediated transcription is observed although restricted to liver and chondrocytes where its expression is biallelic [16]. As the different promoters may confer different translational efficiencies on their common open reading frame, alteration in promoter usage has been proposed as a mechanism of regulation of the IGF pathway [17,18].
The H19 gene encodes an RNA molecule with no open reading frame, but with tumour suppressor properties in vitro [19]. Analysis of transgenic mice with deletions of H19 and its 5′ upstream regions indicate that it plays a role in the maintenance of the IGF2 imprint [20,21]. p57KIP2 is a cyclin-dependent kinase inhibitor related to p21CIP1 and p27KIP1, which binds to and inhibits several G1 cyclin/Cdk complexes [22].
The imprinting pattern, preferential maternal allele loss, and in vitro studies of these genes suggest a role for IGF2 as a dominant oncogene in rhabdomyosarcoma and roles for H19 and p57KIP2 as tumour suppressors. Supporting evidence comes from studies of the Beckwith-Wiedemann Syndrome (BWS), a fetal overgrowth and cancer predisposition syndrome. Children with this condition have a high incidence of embryonal tumours including Wilms tumour and rhabdomyosarcoma. The inherited form of BWS has been linked to 11p15.5 and there is preferential maternal transmission [23]. Constitutional unipaternal isodisomy has been described in sporadic BWS indicating the potential importance of maternally imprinted growth promoting genes [24]. Interestingly, constitutional loss of imprinting (LOI) of IGF2 has been demonstrated in patients with Beckwith-Wiedemann Syndrome [25]. Transgenic mice with high level expression of IGF-II [26] or deletion of p57KIP2 [27] share phenotypic features in common with BWS suggesting a role for these genes in overgrowth and associated tumours.
To investigate the potential importance of IGF2, H19, and p57KIP2 in rhabdomyosarcoma of both alveolar and embryonal subtypes, we have analyzed primary tumour material and correlated histological type with presence of characteristic translocations and imprinting status of the IGF2 and H19 genes, as well as screening tumours for p57KIP2 expression and the presence of mutations. We have found different mechanisms of deregulation of IGF2 in rhabdomyosarcoma including disruption of the normal imprint and recruitment of the adult promoter P1. The expression pattern and lack of mutations in p57KIP2 argue against a role for this gene as a tumour suppressor.
Methods
Tumour Samples and Nucleic Acid Preparation
Tumour samples were snap frozen at the time of surgery or diagnostic biopsy and stored in liquid nitrogen. DNA and RNA were extracted concurrently using Trizol reagent (GIBCO-BRL) in accordance with the manufacturer's instructions. Matched normal DNA was extracted from peripheral mononuclear cells when available using the proteinase K method [28]. Histology reports from tumour samples were reviewed to confirm the diagnosis and establish that the tissues were predominantly neoplastic. Tumours reported to be a mixture of tumour and non-neoplastic tissues were excluded. Alveolar histology was defined by the presence of any amount of classical alveolar architecture or the solid variant alveolar morphology [29].
Reverse Transcriptase-Polymerase Chain Reaction
RNA was reverse-transcribed using random hexamer priming and the enzyme Superscript II (GIBCO-BRL) in accordance with the manufacturer's directions. The PAX3-FKHR and PAX7-FKHR fusion products of the t(2;13)(q35;q14) and t(1;13)(p36;q14) translocations were detected using previously published primers and conditions [30]. A discriminating low cycle number (22 cycles) RT-PCR assay for the housekeeper gene β-actin was used to identify and exclude samples with poor quality RNA or failed cDNA synthesis. In the assessment of IGF2 relative promoter usage, preliminary data indicated that cDNA samples yielding no β-actin product after 22 PCR cycles would not amplify any of the IGF2 products after 35 cycles in tumours known to express IGF-II (data not shown). Actin-negative samples were therefore classified as noninformative, thereby preventing false-negative results for IGF2 promoter usage. The primers and conditions used in analysis of IGF2, H19, and p57KIP2 genes are indicated in Table 1.
Table 1.
PCR Primers and Conditions.
| Primer | Sequence | MgCl Concentration (mM) | Annealing Temperature (°C) |
| p57KIP2 forward 1 | CGTTCCACAGGCCAAGTGCG | ||
| p57KIP2 reverse 1 | GCTGGTGCGCACTAGTACTG | 2.0 | 55 |
| p57KIP2 forward 2 | CGTCCCTCCGCAGCACATCC | ||
| p57KIP2 reverse 2 | CCTGCACCGTCTCGCGGTAG | 1.0 | 55 |
| p57KIP2 forward 3 | CCGGAGCAGCTGCCTAGT | ||
| p57KIP2 reverse 3 | GTCAGCGAGAGGCTCCT | 1.5 | 62 |
| p57KIP2 forward 4 | AGCTGCACTCGGGGATTTC | ||
| p57KIP2 reverse 4 | GCCCTTTAATGCCACGG | 1.5 | 62 |
| p57KIP2 forward 5 | CCGCAGATTTCTTCGCC | ||
| p57KIP2 reverse 5 | TTTGCACTGAGTTTCAGCAGAG | 1.5 | 55 |
| H79 forward | TGCGTCGGAGCTTCCAGACT | ||
| H19 reverse | ACCTGACTCAGGAATCGGCT | 1.0 | 60 |
| IGF2 Apa1 forward | CATCTCCCTTCTCACGGGAA | ||
| IGF2 Apa1 reverse | CCTCCTTTGTGCTTACTGGG | 2.0 | 55 |
| IGF2 CA repeat forward | AATTCCCCATCCTAAAAAGC | ||
| IGF2 CA repeat reverse | TCAGACCATGAAAACATTGG | 1.75 | 55 |
| IGF2 CA forward nested | ACTTTATGCATCCCCGCAGCTACA | ||
| IGF2 CA reverse nested | AGAATCTTAGCGGGACTTTGGCCT | 1.5 | 60 |
| IGF2 promoter 1 forward | AAGAGTCACCACCGAGC | ||
| IGF2 exon 7 reverse | TTCCCATTGGTGCTCTCT | 2.0 | 50 |
| IGF2 promoter 2 forward | TCTCGCTCACCTTCAGCA | ||
| IGF2 exon 7 reverse | TACTGAAGTAGAAGCCGC | 2.0 | 55 |
| IGF2 promoter 3 forward | CCTGGACAATCAGACGAAT | ||
| IGF2 exon 7 reverse | AGGTGAGAAGCACCAGCA | 1.75 | 55 |
| IGF2 promoter 4 forward | AAGAGACTTCCAGCTTCCT | ||
| IGF2 exon 7 reverse | TACTGAAGTAGAAGCCGC | 1.5 | 55 |
| IGF2 exon 8 reverse | GGAAACAGCACTCCTCAA | ||
| IGF2 exon 7 forward | ATGGGGAAGTCGATGCTG | 2.0 | 55 |
Allelotyping
Two CA repeat polymorphisms within the 11p15.5 region and two restriction site polymorphisms in the H19 (Rsa1 in exon) and IGF2 (Apa1 in exon 9) genes were used to determine allele status. The two CA repeat polymorphisms (IGF2 exon 9 and tyrosine hydroxylase) are located within the IGF2/H19 imprinted chromatin domain and therefore accurately reflect allele status of IGF2/H19. PCR products encompassing the CA repeat polymorphism were generated using fluorescently labeled primers and resolved by capillary electrophoresis on an ABI 310 genetic analyser. The large 800-bp IGF2 CA repeat was resolved by polyacrylamide gel electrophoresis on a 377 ABI genetic analyser with the following modifications to the standard protocol; voltage was reduced to 2200 V and the run time increased to 8 hours; formamide concentration was increased to 2%. To validate allelotyping analysis using the undigested 800-bp IGF2 CA repeat PCR product, aliquots of the same DNA were digested with Mvn1 which cuts at a nonpolymorphic site generating 2 CA repeat polymorphisms of approximately 400 bp each. Relative contributions of alleles were assessed by measurement of the area under each peak using Genotyper software (ABI). Tumours were designated retention of heterozygosity (ROH) if relative contributions of alleles differed by less than 20%, and monoallelic if the lesser component contributed 10% or less. The determination of LOH was complicated by the lack of corresponding normal matched DNA for most of the tumour samples. In cases with no evidence for ROH, the probability of allele loss was calculated using the formula P=1-[(1-P1)(1-P2)…(1-Pn)], where P is the overall probability and P1 to Pn are the individual degrees of polymorphism of the alleles analyzed. For example, if three separate markers (IGF2 Apa1, TH, D11S922) display only one allele and the polymorphism frequencies for the markers are 50%, 56% and 90%, respectively (see legend to Table 2 for polymorphism frequencies), the probability of allele loss is 1-[(1-0.5)(1-0.56)(1-0.9)], i.e., 0.97. PCR products containing polymorphic restriction sites were amplified from tumour DNA, digested with the appropriate restriction enzyme, and analyzed on agarose gels. Relative intensities of PCR products were calculated from ethidium-stained agarose gels using software available from the National Institutes of Health. The validity of this approach was confirmed by using a series of standards in which varying degrees of matching leucocyte DNA were added to the tumour DNA from a case with known allele loss. This allowed percentage contribution of alleles to be calculated (Figure 1). This approach was also used using fluorescently labeled primers to confirm that area under the curve of Genescan chromatograms were proportional to relative allele contribution (data not shown).
Table 2.
Allelotyping Data in Rhabdomyosarcoma Tumours.
| Case No. | Translocation | Histology | IGF2 CA Repeat DNA | IGF2 CA Repeat cDNA | IGF2 Apa1 DNA | IGF2 Apa1 cDNA | H19 Rsa1 DNA | H19 Rsa1 cDNA | TH | IGF2 Imprint | H19 Imprint | LOH Probability (%) | ROH Probability (%) | p57KIP2 Expression |
| 3 | t(1;13) | ARMS | A/B | - | -/B | - | A/B | - | - | 100 | ||||
| 4 | t(1;13) | NOS | - | A/- | -/B | -/B | - | - | 2 | 100 | No | |||
| 5 | t(1;13) | ARMS | A/B | - | A/B | A/B | A/B | A/- | - | LOI | ROI | 100 | ||
| 6 | t(1;13) | ARMS | A/- | - | -/B | - | A/- | - | 1 | 94* | 6* | Yes | ||
| 7 | t(1;13) | ARMS | A/B | A/b | A/B | A/B | A/- | - | - | LOI(p) | 100 | |||
| 8 | t(1;13) | ARMS | A/B | - | A/B | - | -B | - | - | 100 | ||||
| 16 | t(2;13) | ARMS | A/B | - | -/B | - | A/- | - | - | 100 | Yes | |||
| 17 | t(2;13) | ARMS | A/B | - | A/- | - | A/B | -/B | - | ROI | 100 | |||
| 23 | t(2;13) | ARMS | - | - | -/B | - | -B | - | - | 75* | 25* | No | ||
| 25 | t(2;13) | ARMS | A/- | - | -/B | - | A/- | - | - | 90* | 10* | No | ||
| 31 | t(2;13) | ARMS | A/B | - | -/B | -/B | A/B | A/- | - | ROI | 100 | |||
| 35 | t(2;13) | ARMS | A/B | - | A/B | A/- | -/B | - | 2 | ROI | 100 | Yes | ||
| 36 | t(2;13) | ERMS | A/B | A/B | A/B | A/B | A/B | -/B | 2 | LOI | ROI | 100 | No | |
| 37 | t(2;13) | ARMS | - | - | A/B | -/B | A/B | A/- | 2 | ROI | ROI | 100 | Yes | |
| 38-T | t(2;13) | NOS | A/- | A/- | -/B | - | A/B | A/- | 2 | ROI | 100 | No | ||
| 38-N | A/- | - | -/B | - | - | - | ||||||||
| 40 | t(2;13) | ARMS | A/B | - | -/B | - | A/- | - | 1 | 100 | Yes | |||
| 41 | t(2;13) | ARMS | A/B | - | -/B | - | a/B | A/- | - | ROI | 100 | No | ||
| 42 | t(2;13) | ARMS | A/B | - | A/B | A/- | -/B | - | 2 | ROI | 100 | Yes | ||
| 43 | t(2;13) | ARMS | A/B | A/b | -/B | - | A/B | - | 2 | LOI(p) | 100 | No | ||
| 44 | t(2;13) | ERMS | A/B | - | A/B | a/B | A/B | -/B | - | LOI(p) | ROI | 100 | ||
| 45 | t(2;13) | ARMS | A/B | - | A/- | - | -/B | - | - | 100 | ||||
| 96 | t(2;13) | ARMS | A/B | - | A/B | A/B | -/B | - | 1 | LOI | 100 | No | ||
| 53 | Neither | ERMS | A/B | A/- | A/- | - | -/B | - | - | ROI | 100 | |||
| 54 | Neither | ERMS | A/B | - | A/- | - | -B | - | 2 | 100 | ||||
| 56 | Neither | ERMS | A/B | - | -/B | - | -B | - | - | 100 | Yes | |||
| 59 | Neither | ERMS | - | - | -/B | - | A/- | - | 1 | 87* | 13* | Yes | ||
| 61 | Neither | ARMS | A/B | - | -/B | - | A/- | - | 1 | 100 | Yes | |||
| 82 | Neither | ERMS | A/B | - | -/B | - | -/B | - | 2 | 100 | No | |||
| 84 | Neither | ERMS | A/- | - | -/B | -/B | A/B | - | 2 | 100 | No | |||
| 85 | Neither | ERMS | A/B | - | - | - | A/B | - | - | 100 | ||||
| 86-T | Neither | ERMS | A/- | - | -/B | - | A/- | - | 1 | 100 | 0 | No | ||
| 86-N | A/B | - | -/B | - | - | - | - | |||||||
| 87 | Neither | ERMS | A/- | A/- | -/B | - | -/B | - | - | 99* | 1* | |||
| 88 | Neither | ARMS | A/B | A/- | A/- | A/- | - | - | - | ROI | 100 | |||
| 91 | Neither | ERMS | A/B | - | -/B | - | A/B | -/B | - | ROI | 100 | |||
| 92 | Neither | ERMS | A/B | A/- | A/B | -/B | A/B | a/B | 1 | ROI | LOI(p) | 100 | Yes | |
| 93-T | Neither | ERMS | a/B | - | A/- | - | -/B | -/B | 1 | 100 | 0 | |||
| 93-N | - | - | - | - | - | - | 2 | |||||||
| 94 | Neither | ERMS | A/B | A/- | A/- | - | A/B | -/B | 2 | ROI | ROI | 100 | Yes | |
| 95 | Neither | PRMS | - | - | -/B | - | -B | - | 1 | 87* | 13* | Yes | ||
| 97 | Neither | PRMS | A/B | - | -/B | - | A/B | -/B | - | ROI | 100 | |||
| 98-T | Neither | ERMS | A/- | - | -/B | - | -/B | - | 2 | 100 | No | |||
| 98-N | A/- | - | -/B | - | - | - | - | |||||||
| 100-T | Neither | ERMS | A/- | - | -/B | - | A/B | A/- | - | ROI | 100 | |||
| 100-N | A/- | - | -/B | - | - | - | 1 | |||||||
| 101 | Neither | PRMS | - | - | -/B | - | A/- | - | 2 | 100 | Yes | |||
| 104 | Neither | NOS | A/B | - | -/B | -/B | A/- | - | - | 100 | Yes | |||
| 107-T | Neither | ARMS | A/- | - | -/B | - | A/B | -/B | 1 | ROI | 100 | No | ||
| 107-N | A/- | - | - | - | - | - | - | |||||||
| 108 | Neither | ERMS | A/B | - | A/B | - | A/B | A/- | - | ROI | 100 | |||
| 109 | Neither | ERMS | A/B | - | - | - | -/B | - | 1 | 100 | ||||
| 110 | Neither | ARMS | A/- | - | -/B | -/B | A/B- | - | 1 | 100 | Yes | |||
| 168 | Neither | NOS | A/B | - | - | - | - | - | - | 100 | No | |||
p in brackets indicates partial loss of imprinting. A refers to the larger of two allele and B is the smaller. The column headed TH indicates the number of alleles of the tyrosine hydroxylase CA repeat polymorphism present in tumour DNA. Upper case indicates disproportional representation of an allele relative to its partner (shown in lowercase).“-” indicates an assay which was not performed successfully, either because of insufficient material or poor quality DNA/RNA. If IGF or H19 polymorphisms were noninformative for imprinting, the cDNA assay was not usually performed. The individual polymorphism frequencies are as follows: IGF2 Apa1=50% [38], IGF2 CA repeat 5′ end=60% [39], H19 Rsa1=50% [40], TH CA repeat=56% [41], D11S922=90% [42].
Indicates LOH/ROH results which are statistically inferred.
Figure 1.
Demonstration of relationship between relative amounts of template and ratio of PCR product intensities. C control DNA for completion of Apa1 reaction.
The tumours analyzed generally gave unequivocal data for 11p15.5 allele loss status, showing either two alleles of equal size, or one allele with no detectable contribution from a second allele. An exception was tumour 93 which had a second allele representing less than 10% of the total which was interpreted as indicating the presence of contaminating nontumour DNA or genetic heterogeneity of neoplastic tissue. Case 86, with proven LOH as revealed by comparison of tumour and normal DNA, showed complete absence of the deleted allele in tumour DNA indicating that there was no detectable contaminating normal tissue. All other chromatograms showed two alleles of equivalent intensity as defined in this section, or single alleles, with the exception of case 36 which had three peaks of equal intensity consistent with a triploid karyotype.
Imprinting Analysis
H19 imprinting status was determined using the Rsa1-transcribed polymorphism in exon 5 and PCR primers spanning intron 4. IGF2 imprinting was determined in two ways. Firstly, using the Apa1-transcribed polymorphism in exon 9 and secondly using the transcribed CA repeat in the 3′ untranslated region of exon 9. It was not possible to design intron spanning PCR primers for these two polymorphisms which worked well with tumour RNA. It was therefore necessary to pretreat RNA with DNAse and perform “reverse transcriptase-negative” controls with each RNA sample. The restriction polymorphisms were analyzed by digestion of PCR products and the CA repeat polymorphism was analyzed by Genotyper analysis. Relative allele intensity following restriction digestion of PCR products was proportional to the relative amount of the allele in the DNA or cDNA template (Figure 1). The same relationship between alleles of both DNA and cDNA was established when analyzed by Genescan of fluorescently-labeled PCR products and was independent of PCR cycle number (data not shown).
DNA Sequencing
The p57KIP2 gene was amplified by PCR from tumour genomic DNA. Sequencing of PCR products was performed using rhodamine dyes (Perkin Elmer) and fragments analyzed on ABI 310 and 377 genetic analysers using ABI software. 235 bases between positions 1631 and 1966 of sequence accession number D64137 could not be sequenced, probably because of high GC content. Results were validated by performing sequencing of PCR products in both directions.
Results
Relationship between Allele Loss, Histology, and Presence of Characteristic Translocations
We sought to investigate the hypothesis that alveolar and embryonal rhabdomyosarcoma are characterized by FKHR disrupting translocations and 11p15.5 LOH, respectively. The fusion genes PAX7-FKHR and PAX3-FKHR, corresponding to the characteristic translocations t(1;13)(q36;q14) and t(2;13)(p35;q14), respectively, were assessed using a combination of classical cytogenetics, FISH and RT-PCR (Table 2). Cases numbered between 1 and 91 have been published separately (Anderson et al., submitted).
A surprisingly high proportion of cases had ROH including 17 of 22 cases with embryonal histology and lacking one of the FKHR disrupting translocations, thereby indicating that the incidence of 11p15.5 LOH in this panel of embryonal rhabdomyosarcomas is, at most, 23%. Of interest to us were four tumours which had embryonal histology (n=2) or nonspecific histological subgroup (n=2), yet harboured a PAX-FKHR fusion. All of these tumours had ROH of 11p15.5 markers. Overall, of 22 cases with one of the PAX-FKHR fusions, there was unequivocal evidence of ROH in 19 and only two cases had a probability of LOH of 90% or more. Four of 22 alveolar tumours lacked one of the translocations, but still had ROH of 11p15.5 and therefore lacked both a translocation and LOH. Therefore, LOH at chromosome 11p15.5 was a relatively rare finding in the embryonal subtype of rhabdomyosarcoma and was not proven to be present in the alveolar form. Because of the general association between alveolar histology and the FKHR disrupting translocations, ROH was also a characteristic feature of translocation-positive cases.
LOI of IGF2 and Retention of Imprinting of H19
We next asked whether disruption of imprinting at 11p15.5 characterized the embryonal tumours with ROH, and whether deregulation at this region extended to alveolar rhabdomyosarcoma with an FKHR disrupting translocation.
Representative results of IGF2 imprinting status are shown in Figure 2. Of 13 tumours informative for IGF2 imprinting, LOI was seen in 6 (46%). No discrepancies were encountered when more than one marker (i.e., IGF2 CA repeat and Apa1 polymorphism) was informative for a particular tumour sample. In three cases with LOI, there was equivalent expression from the two alleles (5,36,96); whereas in the other three cases (7,43,44), there was preferential expression of one allele, and this did not mirror an overrepresentation of that allele at the DNA level. This indicated a partial LOI and was a consistent finding in the three tumours irrespective of PCR cycle number (see Methods section). Of 10 informative tumours with one of the FKHR disrupting translocations, LOI was seen in six including one (case 44) with embryonal histology. All four informative tumours lacking an FKHR disrupting translocation had retention of imprinting (ROI) of IGF2, one of these (case 88) having alveolar histology. All tumours in this study with LOI had one of the FKHR disrupting translocations and there is a significant association between the presence of translocations and LOI (P=0.03, chi-square test).
Figure 2.
Demonstration of IGF2 Apa1 polymorphism with cDNA as template to demonstrate loss of imprinting of cases 5 and 36 and retention of imprinting of cases 35 and 42. Case 6 (which is homozygous for the allele containing the Apa1 site) with DNA as template is included as a control for completion of restriction enzyme digestion; RT+ cDNA made in the presence of reverse transcriptase; RT- control cDNA reaction in which reverse transcriptase is omitted.
Twenty tumours were informative for H19 imprinting. ROI of H19 was seen in 14 of 15 cases where amplification from cDNA was possible. The tumour (case 92) with partial LOI for H19 was retention of IGF2 imprinting indicating that separate mechanisms exist controlling imprinting of IGF2 and H19 in this case.
Use of the Upstream P1 Promoter of IGF2 in Cases with and without LOI
The use of the four different promoters of the IGF2 gene was assessed in rhabdomyosarcoma tumours using an RT-PCR assay (see Figure 3). All tumour samples for which adequate quality RNA was available (see Methods section) had expression from promoters P2, P3, and P4. Expression from promoter P1 was detected in 5 of 14 informative tumours of which one had LOI of IGF2, three had retention of imprinting of IGF2, and one was noninformative for imprinting (Figure 4). The data indicate that transcription from promoter P1 can be monoallelic and that LOI of IGF2 can occur without the recruitment of promoter P1.
Figure 3.
The genomic organization of the IGF2 gene. Exonic sequences encoding the IGF2 protein are common to all transcripts and are shown in light gray. The transcribed, but untranslated 800-bp CA repeat region within exon 9 is shown in white. The positions of the four promoters and the primers used in RT-PCR are indicated by angled and straight arrows, respectively. P1 to P4 indicates promoters 1 to 4. E1 to 9 indicates exons 1 to 9.
Figure 4.
Analysis of IGF2 promoter-specific transcription using RT-PCR. Tumours 36, 42, and 35 are noninformative (no β-actin product). Promoters P2 and P3 gave equivalent intensity signals in all informative cases (not shown). Imprinting of IGF2 and FKHR translocation status is indicated. NT contains neither of the FKHR disrupting translocations. NI, noninformative for IGF2 imprinting, LOI, loss of IGF2 imprinting; ROI, retention of IGF2 imprinting.
Lack of Evidence for Mutation of p57KIP2 in Rhabdomyosarcoma and Lack of Correlation Between Expression and Allele Status
We assessed the potential importance of p57KIP2 as a tumour suppressor in rhabdomyosarcoma in two ways. First, the expression of the gene was assessed in 29 tumours by RT-PCR and correlated with 11p15.5 allelotyping data. Overall, expression of the gene was found in 15 tumours of which 12 had ROH. ROH at 11p15.5 was also seen in 11 of 14 cases with no detectable p57KIP2 expression. The data therefore show no correlation between allele status and p57KIP2 expression and indicate that LOH is not a requirement for loss of expression of p57KIP2. It is, however, possible that tumours with p57KIP2 expression as determined by RT-PCR have loss of function mutations and we therefore screened the expressing tumours for mutations using automated DNA sequencing. This screening encompassed all of the coding sequence with the exception of 235 bases between positions 1631 and 1966, and included the regions where mutations had previously been reported in Beckwith-Wiedemann patients [8,31]. No mutations were found in the 15 tumours analyzed.
Discussion
The importance of the chromosome region 11p15.5 in rhabdomyosarcoma was initially established through the recognition of a high degree of allele loss in tumours of the embryonal histological subtype. Subsequent studies have indicated that allele loss is less frequent in embryonal rhabdomyosarcoma and is sometimes seen in alveolar rhabdomyosarcoma which carries one of the characteristic reciprocal translocations t(2;13)(p35;q14) or t(1;13)(q36;q14) [2]. Moreover, alteration of the imprinting pattern of the IGF2 gene within the region of common allele loss has been documented in Wilms tumour and rhabdomyosarcoma cases with ROH of 11p15.5 [32,33]. This has supported the belief that maternal-specific LOH and LOI of IGF2 are alternate pathways contributing to tumourigenesis through upregulation of IGF-II. The data presented here suggest that genetic changes occur which may contribute to overexpression of IGF-II in rhabdomyosarcoma of both histological types both in the presence or absence of the characteristic FKHR disrupting translocations. The implication is that a final common pathway of increased IGF-II expression is a requirement for tumour progression in rhabdomyosarcoma, perhaps through its function as an antiapoptotic survival factor [34]. The tendency is for LOI of IGF2 to occur in alveolar rhabdomyosarcoma and LOH in embryonal tumours. This difference in the pathway of genetic alteration at 11p15.5 may represent differences in gross chromosomal stability associated with the two subtypes as suggested by the comparative genomic hybridization profiles of the tumours [35].
Transcription from the promoter P1 was seen in 5 of 14 tumours and did not correlate with LOI of IGF2 or the presence of alveolar histology and FKHR disrupting translocations. The primary tumour sites with P1 transcription were genitourinary (two cases), limb (two cases), and diaphragm (one case) which, like skeletal muscle, are not tissues where promoter P1 transcription has been reported in adults. Rhabdomyosarcomas are thought to be derived from undifferentiated mesenchymal cells and show varying degrees of myogenic differentiation explaining their presentation at all sites including tissues where skeletal muscle is not normally located. The acquisition of promoter P1 transcription is more likely therefore to represent an oncogenic rather than developmental phenomenon. LOI of IGF2 is one possible mechanism of upregulation of IGF-II function and was detected in 6 of 13 (46%) of tumours in this study which did not have allele loss and were informative for a transcribed polymorphism. Of the five informative cases with biallelic IGF2 expression, additional promoter P1 transcription was seen in two (Figure 4). It is unknown whether transcription from this upstream promoter is associated with increased expression of IGF-II protein in vivo, but the data do indicate that modification of the normal pattern of expression of IGF-II is seen in most rhabdomyosarcoma tumours.
One model which has been proposed for normal regulation of expression of IGF-II is that of competition between IGF2 and H19 promoters for common enhancer elements situated 3′ to H19 [32,36]. Methylation of H19 5′ upstream sequences on the paternally inherited chromosome prevents access of the H19 promoter to this enhancer resulting in expression of IGF-II, but repression of H19. Biallelic expression of IGF2 according to this model is caused by the maternally inherited chromosome adopting the configuration of the paternal copy with repression of H19 expression on both alleles. H19 expression has been assessed in this study by a nonquantitative RT-PCR assay in which differences in expression between tumours may be missed. However, no samples showed absent H19 expression including cases with LOH and IGF2 LOI. The data do not therefore support a reciprocal relationship between IGF-II and H19 expression in rhabdomyosarcoma as has been previously reported in Wilms tumour [32]. Similarly, dissociation between H19 and IGF2 epigenotypes, incompatible with the enhancer competition model, has been described in the tumour predisposing Beckwith-Wiedemann syndrome [37].
The p57KIP2 cyclin-dependent kinase inhibitor is a candidate tumour suppressor gene in rhabdomyosarcoma as it is located at 11p15.5 and imprinted with maternal expression (the chromosome typically lost in rhabdomyosarcoma with 11p15.5 allele loss). However, the data presented here indicate that p57KIP2 is not expressed in 38% of tumours with ROH suggesting either that the gene was not expressed in the mesenchymal stem cell population from which the tumour arose, or that loss of expression was achieved through another mechanism such as epigenetic modification. There is currently no evidence for the latter. The viability and lack of tumour development in p57KIP2 deficient mice suggest a degree of redundancy compatible with lack of expression of p57KIP2 in some mesenchymal cells. No mutations were found in regions of previously described mutations in tumours expressing p57KIP2. Taken together, these data support the view that p57KIP2 is not an important tumour suppressor in rhabdomyosarcoma.
Acknowledgements
We thank the United Kingdom Children's Cancer Study Group (UKCCSG), Colin Cooper and Iona Jeffrey for provision of tumour samples, and Rifat Hamoudi at the Gene Cloning laboratory at the Institute of Cancer Research. Anderson and Pritchard-Jones were funded by the Cancer Research Campaign of the UK.
Abbreviations
- FKHR
human forkhead-like gene
- IGF2
insulin-like growth factor 2 gene
- LOH
loss of heterozygosity
- LOI
loss of imprinting
- ROH
retention of heterozygosity
- ROI
retention of imprinting
References
- 1.Iwasa Y. The conflict theory of genomic imprinting: how much can be explained? Curr Top Dev Biol. 1998;40:255–293. doi: 10.1016/s0070-2153(08)60369-5. [DOI] [PubMed] [Google Scholar]
- 2.Visser M, Sijmons C, Bras J, Arceci RJ, Godfried M, Valentijn LJ, Voute PA, Baas F. Allelotype of pediatric rhabdomyosarcoma. Oncogene. 1997;15(11):1309–1314. doi: 10.1038/sj.onc.1201302. [DOI] [PubMed] [Google Scholar]
- 3.Scrable H, Witte D, Shimada H, Seemayer T, Sheng WW, Soukup S, Koufos A, Houghton P, Lampkin B, Cavenee W. Molecular differential pathology of rhabdomyosarcoma. Genes Chromosomes Cancer. 1989;1(1):23–35. doi: 10.1002/gcc.2870010106. [DOI] [PubMed] [Google Scholar]
- 4.Davis RJ, D'Cruz CM, Lovell MA, Biegel JA, Barr FG. Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer Res. 1994;54(11):2869–2872. [PubMed] [Google Scholar]
- 5.Galili N, Davis RJ, Fredericks WJ, Mukhopadhyay S, Rauscher FJd, Emanuel BS, Rovera G, Barr FG. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet. 1993;5(3):230–235. doi: 10.1038/ng1193-230. [DOI] [PubMed] [Google Scholar]
- 6.Moulton T, Chung WY, Yuan L, Hensle T, Waber P, Nisen P, Tycko B. Genomic imprinting and Wilms' tumor. Med Pediatr Oncol. 1996;27(5):476–483. doi: 10.1002/(SICI)1096-911X(199611)27:5<476::AID-MPO15>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
- 7.Bartolomei MS, Zemel S, Tilghman SM. Parental imprinting of the mouse H19 gene. Nature. 1991;351(6322):153–155. doi: 10.1038/351153a0. [DOI] [PubMed] [Google Scholar]
- 8.Hatada I, Ohashi H, Fukushima Y, Kaneko Y, Inoue M, Komoto Y, et al. An imprinted gene p57KIP2 is mutated in Beckwith-Wiedemann syndrome. Nat Genet. 1996;14(2):171–173. doi: 10.1038/ng1096-171. [DOI] [PubMed] [Google Scholar]
- 9.Werner H, Le Roith D. The insulin-like growth factor-I receptor signaling pathways are important for tumorigenesis and inhibition of apoptosis. Crit Rev Oncog. 1997;8(1):71–92. doi: 10.1615/critrevoncog.v8.i1.40. [DOI] [PubMed] [Google Scholar]
- 10.Harrington EA, Bennett MR, Fanidi A, Evan GI. c-Myc-induced apoptosis in fibroblasts is inhibited by specific cytokines. EMBO J. 1994;13(14):3286–3295. doi: 10.1002/j.1460-2075.1994.tb06630.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Pietrzkowski Z, Sell C, Lammers R, Ullrich A, Baserga R. Roles of insulin like growth factor 1 (IGF-1) and the IGF-1 receptor in epidermal growth factor-stimulated growth of 3T3 cells. Mol Cell Biol. 1992;12(9):3883–3889. doi: 10.1128/mcb.12.9.3883-3889.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pietrzkowski Z, Lammers R, Carpenter G, Soderquist AM, Limardo M, Phillips PD, Ullrich A, Baserga R. Constitutive expression of insulin-like growth factor 1 and insulin-like growth factor 1 receptor abrogates all requirements for exogenous growth factors. Cell Growth Differ. 1992;3(4):199–205. [PubMed] [Google Scholar]
- 13.Sell C, Rubini M, Rubin R, Liu JP, Efstratiadis A, Baserga R. Simian virus 40 large tumor antigen is unable to transform mouse embryonic fibroblasts lacking type 1 insulin-like growth factor receptor. Proc Natl Acad Sci USA. 1993;90(23):11217–11221. doi: 10.1073/pnas.90.23.11217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sell C, Dumenil G, Deveaud C, Miura M, Coppola D, DeAngelis T, Rubin R, Efstratiades A, Baserga R. Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. Mol Cell Biol. 1994;14(6):3604–3612. doi: 10.1128/mcb.14.6.3604-3612.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.van Dijk MA, van Schaik FM, Bootsma HJ, Holthuizen P, Sussenbach JS. Initial characterization of the four promoters of the human insulin-like growth factor II gene. Mol Cell Endocrinol. 1991;81(1–3):81–94. doi: 10.1016/0303-7207(91)90207-9. [DOI] [PubMed] [Google Scholar]
- 16.Ekstrom TJ, Cui H, Li X, Ohlsson R. Promoter-specific IGF2 imprinting status and its plasticity during human liver development. Development. 1995;121(2):309–316. doi: 10.1242/dev.121.2.309. [DOI] [PubMed] [Google Scholar]
- 17.Vu TH, Hoffman AR. Promoter-specific imprinting of the human insulin-like growth factor-II gene. Nature. 1994;371(6499):714–717. doi: 10.1038/371714a0. [DOI] [PubMed] [Google Scholar]
- 18.De Moor CH, Jansen M, Bonte EJ, Thomas AA, Sussenbach JS, Van den Brande JL. Influence of the four leader sequences of the human insulin-like-growth-factor-2 mRNAs on the expression of reporter genes. Eur J Biochem. 1994;226(3):1039–1047. doi: 10.1111/j.1432-1033.1994.t01-1-01039.x. [DOI] [PubMed] [Google Scholar]
- 19.Hao Y, Crenshaw T, Moulton T, Newcomb E, Tycko B. Tumour-suppressor activity of H19 RNA. Nature. 1993;365(6448):764–767. doi: 10.1038/365764a0. [DOI] [PubMed] [Google Scholar]
- 20.Leighton PA, Ingram RS, Eggenschwiler J, Efstratiadis A, Tilghman SM. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature. 1995;375(6526):34–39. doi: 10.1038/375034a0. [DOI] [PubMed] [Google Scholar]
- 21.Ripoche MA, Kress C, Poirier F, Dandolo L. Deletion of the H19 transcription unit reveals the existence of a putative imprinting control element. Genes Dev. 1997;11(12):1596–1604. doi: 10.1101/gad.11.12.1596. [DOI] [PubMed] [Google Scholar]
- 22.Lee MH, Reynisdottir I, Massague J. Cloning of p57KIP2, a cyclin-dependent kinase inhibitor with unique domain structure and tissue distribution. Genes Dev. 1995;9(6):639–649. doi: 10.1101/gad.9.6.639. [DOI] [PubMed] [Google Scholar]
- 23.Ping AJ, Reeve AE, Law DJ, Young MR, Boehnke M, Feinberg AP. Genetic linkage of Beckwith-Wiedemann syndrome to 11p15. Am J Hum Genet. 1989;44(5):720–723. [PMC free article] [PubMed] [Google Scholar]
- 24.Weksberg R, Squire JA. Molecular biology of Beckwith-Wiedemann syndrome. Med Pediatr Oncol. 1996;27(5):462–469. doi: 10.1002/(SICI)1096-911X(199611)27:5<462::AID-MPO13>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
- 25.Weksberg R, Shen DR, Fei YL, Song QL, Squire J. Disruption of insulin-like growth factor 2 imprinting in Beckwith-Wiedemann syndrome. Nat Genet. 1993;5(2):143–150. doi: 10.1038/ng1093-143. [DOI] [PubMed] [Google Scholar]
- 26.Sun FL, Dean WL, Kelsey G, Allen ND, Reik W. Transactivation of IGF2 in a mouse model of Beckwith-Wiedemann syndrome. Nature. 1997;389(6653):809–815. doi: 10.1038/39797. [DOI] [PubMed] [Google Scholar]
- 27.Zhang P, Liegeois NJ, Wong C, Finegold M, Hou H, Thompson JC, Silverman A, Harper JW, De Pinho RA, Elledge SJ. Altered cell differentiation and proliferation in mice lacking p57KIP2 indicates a role in Beckwith-Wiedemann syndrome. Nature. 1997;387(6629):151–158. doi: 10.1038/387151a0. [DOI] [PubMed] [Google Scholar]
- 28.Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, editors. Current Protocols in Molecular Biology. John Wiley and Sons Inc.; 1998. p. 2.2.1. [Google Scholar]
- 29.Tsokos M, Webber BL, Parham DM, Wesley RA, Miser A, Miser JS, Etcubanas E, Kinsella T, Grayson J, Glatstein E. Rhabdomyosarcoma. A new classification scheme related to prognosis. Arch Pathol Lab Med. 1992;116(8):847–855. [PubMed] [Google Scholar]
- 30.Anderson J, Renshaw J, McManus A, Carter R, Mitchell C, Adams S, Pritchard-Jones K. Amplification of the t(2; 13) and t(1; 13) translocations of alveolar rhabdomyosarcoma in small formalin-fixed biopsies using a modified reverse transcriptase polymerase chain reaction. Am J Pathol. 1997;150(2):477–482. [PMC free article] [PubMed] [Google Scholar]
- 31.O'Keefe D, Dao D, Zhao L, Sanderson R, Warburton D, Weiss L, Anyane-Yeboa K, Tycko B. Coding mutations in p57KIP2 are present in some cases of Beckwith-Wiedemann syndrome but are rare or absent in Wilms tumors. Am J Hum Genet. 1997;61(2):295–303. doi: 10.1086/514854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Steenman MJ, Rainier S, Dobry CJ, Grundy P, Horon IL, Feinberg AP. Loss of imprinting of IGF2 is linked to reduced expression and abnormal methylation of H19 in Wilms' tumour. Nat Genet. 1994;7(3):433–439. doi: 10.1038/ng0794-433. [DOI] [PubMed] [Google Scholar]
- 33.Zhan S, Shapiro DN, Helman LJ. Activation of an imprinted allele of the insulin-like growth factor II gene implicated in rhabdomyosarcoma. J Clin Invest. 1994;94(1):445–448. doi: 10.1172/JCI117344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Bernasconi M, Remppis A, Fredericks WJ, Rauscher FJ, III, Schafer BW. Induction of apoptosis in rhabdomyosarcoma cells through down-regulation of PAX proteins. Proc Natl Acad Sci USA. 1996;93(23):13164–13169. doi: 10.1073/pnas.93.23.13164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Weber-Hall S, Anderson J, McManus A, Abe S, Nojima T, Pinkerton R, Pritchard-Jones K, Shipley J. Gains, losses, and amplification of genomic material in rhabdomyosarcoma analyzed by comparative genomic hybridization. Cancer Res. 1996;56(14):3220–3224. [PubMed] [Google Scholar]
- 36.Banerjee S, Smallwood A. A chromatin model of IGF2/H19 imprinting. Nat Genet. 1995;11(3):237–238. doi: 10.1038/ng1195-237. [DOI] [PubMed] [Google Scholar]
- 37.Joyce JA, Lam WK, Catchpoole DJ, Jenks P, Reik W, Maher ER, Schofield PN. Imprinting of IGF2 and H19: lack of reciprocity in sporadic Beckwith-Wiedemann syndrome. Hum Mol Genet. 1997;6(9):1543–1548. doi: 10.1093/hmg/6.9.1543. [DOI] [PubMed] [Google Scholar]
- 38.Tadokoro K, Fujii H, Inoue T, Yamada M. Polymerase chain reaction (PCR) for detection of Apal polymorphism at the insulin like growth factor II gene (IGF2) Nucleic Acids Res. 1991;19(24):6967. doi: 10.1093/nar/19.24.6967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ranier S, Dobry CJ, Feinberg AP. Transcribed dinucleotide repeat polymorphism in the IGF2 gene. Hum Mol Genet. 1994;3(2):386. doi: 10.1093/hmg/3.2.386. [DOI] [PubMed] [Google Scholar]
- 40.Zhang Y, Tycko B. Monoallelic expression of the human H19 gene. Nat Genet. 1992;1(1):40–44. doi: 10.1038/ng0492-40. [DOI] [PubMed] [Google Scholar]
- 41.Besnard-Guerin C, Cavenee WK, Newsham I. A new highly polymorphic DNA restriction site marker in the 5′ region of the human tyrosine hydroxylase gene (TH) detecting loss of heterozygosity in human embryonal rhabdomyosarcoma. Hum Genet. 1994;93(3):349–350. doi: 10.1007/BF00212038. [DOI] [PubMed] [Google Scholar]
- 42.James MR, Richard CW, III, Schott JJ, Yousry C, Clark K, Bell J, Terwilliger JD, Hazan J, Dubay C, Vignal A. A radiation hybrid map of 506 STS markers spanning human chromosome 11. Nat Genet. 1994;8(1):70–76. doi: 10.1038/ng0994-70. [DOI] [PubMed] [Google Scholar]




