Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Original citation: J. Clin. Invest. 109:1405–1415 (2002). doi:10.1172/JCI200215681
Citation for this corrigendum: J. Clin. Invest. 109:1211 (2002). doi:10.1172/JCI200215681C
The authors would like to correct an error in the Methods section. The primer sequences used to amplify cbfa1 in the PCR reaction were TGGCAGCACGCTATTAAATC (forward) and TCTGCCGCTAGAATTCAAAA (reverse), instead of the primers listed in the published article.
