Nonconjugative Transposition of the vanB-Containing Tn5382-Like Element in Enterococcus faecium

Abstract

The vanB2 operon encoding glycopeptide resistance is an integral part of the putative conjugative transposon Tn5382. Characterization of clinical glycopeptide resistant derivatives from an epidemic ampicillin-resistant Enterococcus faecium strain showed precise chromosomal or plasmid insertions of a vanB2-containing Tn5382-like element. Conjugative transposition of the Tn5382-like element was not demonstrated in retransfer studies.

The 34-kb vanB-containing transposon Tn1549, which is similar to the Tn916-Tn1545 family of conjugative transposons, was recently described (11). Tn1549 appears to be identical to the previously described and partially sequenced transposon Tn5382 (4). It is therefore designated a Tn5382-like element. The vanB2 operon seems to be universally linked to the Tn5382-like element and is the most widespread vanB subtype (7, 8, 15, 16, 17, 19). Conjugative transposons encode the functions for excision to a circular intermediate and intercellular transfer (5). The staggered cleavage of Tn916-Tn1545 during transposition results in the transfer of a coupling sequence from the previous target. The circular intermediates are joined at the ends by mismatched strands that are repaired in enterococci (18), representing sequences from flanking regions on either side of the previous insertion. Transposon-flanking regions thus represent the target sequence on one side and one of the mismatched strands on the other (3, 21). Evidence of Tn5382 transposition has been described previously (4, 11). We present additional data for precise transposition of Tn5382-like elements under natural conditions describing the arrival of the Tn5383-like element in a Norwegian ampicillin-resistant Enterococcus faecium outbreak strain (TUH2-21).

Relevant characteristics of the strains used are listed in Table 1. Isolation of DNA (2, 22), pulsed-field gel electrophoresis (PFGE), Southern hybridization, matings, PCRs, and DNA sequencing (6, 7) were performed as described previously. Amplicons and primer sequences are given in Table 2. Various bacteria were used as templates for PCR probe synthesis: 16S rRNA gene (rDNA) probe from Enterococcus faecalis DS16C2 (10), 23S rDNA from E. faecium ATCC 19434, IS1216V from E. faecium BM4147 (14), Tn5382 from E. faecium C68 (4), and vanB from E. faecalis V583 (9). A chromosomal vanB location was assessed by sequential vanB, 16S rDNA, and 23S rDNA hybridizations of PFGE-separated, I-CeuI (New England Biolabs)-digested DNA. Plasmid vanB localization was examined by sequential vanB and 16S rDNA hybridizations of plasmid DNA. Inverse PCR was performed to characterize Tn5382-flanking sequences. The Tn5382 left and right ends were amplified with internal divergent Tn5382 primers after ligation of DraI-, HinfI-, or HphI/BfaI- and AluI-, DdeI-, or Sau3AI-digested total DNA (1 to 3 μg), respectively. The Sequence Navigator Software Package (Perkin-Elmer) and the Blastn and Blastx local alignment search tools (1) were used for sequence analyses.

TABLE 1.

Bacterial strains used in this study

Strain	Relevant characteristicsa	Reference(s)
E. faecium
TUH2-21	Epidemic human clinical strain; Apr Vms	12
TUH2-18	Clonally related to TUH2-21; chromosomal vanB2; Apr Vmr	6, 12
TUH2-19	Clonally related to TUH2-21; plasmid vanB2; Apr Vmr	12
TUH2-20	Clonally related to TUH2-21; chromosomal vanB2; Apr Vmr	12
TUH2-55	Clonally related to TUH2-21; plasmid vanB2; Apr Vmr	12
BM4105-RF	Recipient strain in transfer studies; Vms Rifr Fusr	20
E. faecalis
JH2-2	Recipient strain in transfer studies; Vms Rifr Fusr	13
UV202	Recombination-deficient derivative of JH2-2	23

^a Ap^r, ampicillin resistant; Vm^s, vancomycin susceptible; Vm^r, vancomycin resistant; Rif^r, rifampicin resistant; Fus^r, fucidic acid resistant. The TUH strains were isolated at Haukeland University Hospital, Bergen, Norway (12).

TABLE 2.

PCR primers used in this study

Amplicon	Primer sequence (5′ - 3′)	Size of amplicon (bp)	Reference
vanB	CAAAGCTCCGCAGCTTGCATG	484	6
	TGCATCCAAGCACCCGATATAC
vanB long	GTTTGATGCAGAGGCAGACGACT	5,959	6
	ACAAGTTCCCCTGTATCCAAGTGG
Tn5382	GTTCTTATTCCGCAGGTGGTGATT	311	4
	ACGCCATGCTATTTACTTCCGGC
Tn5382 left inverse	GCTATGGCAGTTTTCCGTGTG	Variable	This study
	TCGCCTCCTTTCTCTATTTGG
Tn5382 right inverse	GAGGGGGAAATGGTGAGAGGT	Variable	This study
	AACGCTTCTTCATGGCTCTTG
TUH2-18 Tn5382 left	TACTGCCAATGATGTCAACCC	721	This study
	GTTCTTATTCCGCAGGTGGTGATT
TUH2-18 Tn5382 right	GAGGGGGAAATGGTGAGAGGT	413	This study
	ATCCTTTGACGATCATCTTGG
TUH2-18 Tn5382 target	TACTGCCAATGATGTCAACCC	439	This study
	ATCCTTTGACGATCATCTTGG
TUH2-19 Tn5382 left	CCGCAAGGGGATTTTAGTA	677	This study
	GTTCTTATTCCGCAGGTGGTGATT
TUH2-19 Tn5382 right	GAGGGGGAAATGGTGAGAGGT	248	This study
	CCACGGCTACAATAATCACA
TUH2-19 Tn5382 target	CCGCAAGGGGATTTTAGTA	224	This study
	CCACGGCTACAATAATCACA
Tn5382-like junction	GAGGGGGAAATGGTGAGAGGT	701a	This study
	GTTCTTATTCCGCAGGTGGTGATT
IS1216V	AAAGCAATTTCAGCAGGATG	456	This study
	GTACGATGTTCTGTCCCTTG
16S rDNA	TGCATTAGCTAGTTGGTGAGG	726	7
	TCGAATTAAACCACATGCTCC
23S rDNA	CGCATGTACAGGATAGGTAGG	669	This study
	AGGTGGGCTTCACACTTAGAT

^aIncluding 6-bp coupling sequence.

The outbreak due to the ampicillin-resistant strain (TUH2-21) and the four VanB-type strains (TUH2-18, TUH2-19, TUH2-20, and TUH2-55) has been reported previously (12). The vanB2 genotype was confirmed as previously described (6). SmaI PFGE patterns of TUH2-18 and -20 (Fig. 1A, lanes 3 and 4) were closely related to that of TUH2-21 (Fig. 1A, lane 2). The only difference was the replacement of a 270-kb SmaI fragment in TUH2-21 with an approximately 300-kb fragment in TUH2-18 and -20 that hybridized with the vanB (Fig. 1B, lanes 3 and 4) and Tn5382 (Fig. 1C, lanes 3 and 4) probes. Cohybridization of vanB and rDNA probes to I-CeuI PFGE fragments confirmed the chromosomal vanB location (data not shown). Inverse PCR and sequencing showed insertion of the Tn5382-like element in a chromosomal region of TUH2-18 between the putative genes for ribonucleotide reductase and membrane proteins (GenBank accession no. AF289471 and AF289472). TUH2-18 flanking sequences were identical to TUH2-21 and TUH2-19 chromosomal sequences except for six additional base pairs (ATAATT) at the right extremity of the transposon (GenBank accession no. AF289469 to AF289472; Fig. 2A).

FIG. 1.

PFGE of SmaI-digested total DNAs of four vancomycin-resistant strains and the prototype ampicillin-resistant E. faecium outbreak strain (TUH2-21) (A) and corresponding Southern hybridization with a vanB probe (B), a Tn5382 probe (C), and an IS1216V probe (D). Lanes: 1, low-range PFGE marker (New England Biolabs); 2, TUH2-21; 3, TUH2-20; 4, TUH2-18; 5, TUH2-19; 6, TUH2-55.

FIG. 2.

Target sequence at the site of integration of the Tn5382-like transposon into the chromosome of TUH2-18 and in a plasmid in TUH2-19. The nucleotide sequences of the Tn5382-like elements chromosomally located in TUH2-18 (A) and plasmid borne in TUH2-19 (B) were aligned with the target sequence in TUH2-21. Tn5382-like element inverted repeats are in bold letters. The 6-bp coupling sequence is underlined.

Comparative PFGE analysis of TUH2-21, -19, and −55 showed indistinguishable SmaI patterns (Fig. 1A, lanes 2, 5, and 6, respectively). Hybridization of plasmid DNA and I-CeuI PFGE fragments (data not shown) revealed a plasmid-located vanB-containing Tn5382-like element in TUH2-19 and −55, consistent with the observed colocalization of vanB and Tn5382 hybridization signals corresponding to the PFGE wells (lanes 5 and 6, Fig. 1B and C, respectively). Sequencing of inverse PCR products from TUH2-19 revealed insertion of the Tn5382-like element in an IS1216V element (GenBank accession no. AF289475 and AF289476). Hybridization of plasmid DNA (data not shown) provided evidence of the presence of a vanB- and IS1216V-containing plasmid in TUH2-19 and −55. Comigrating IS1216V probe-positive plasmid DNA fragments were observed in TUH2-18, −20, and −21, consistent with an IS1216V-containing plasmid. These data are compatible with the IS1216V signals corresponding to the locations of the wells of the four VanB strains and TUH2-21 (Fig. 1D). The Tn5382-like element-flanking sequences in TUH2-19 were identical to TUH2-21 and −18 plasmid sequences, except for six additional base pairs (AAATTA) at the left extremity of the Tn5382-like element (GenBank accession no. AF289473 to AF289476; Fig. 2B). Taken together, these observations indicate transposition of the Tn5382-like element into a preexisting IS1216V-containing plasmid or a 270-kb SmaI chromosomal fragment in TUH2-21, generating the TUH2-19 and TUH2-18 strains, respectively. The six different additional base pairs of the Tn5382-like element in TUH2-18 and TUH2-19 are linked to the opposite ends of the transposon, indicating introduction of the Tn5382-like element into TUH2-21 by two separate events. Knowing the target sequence for integration in TUH2-21, the additional six base pairs most likely represent flanking sequences from the prior insertion rather than target duplication upon insertion, as earlier hypothesized (4).

Tn5382 junction PCR analysis (Table 2) of TUH2-18 and TUH2-19 revealed the expected 701-bp product indicating the presence of an excised free Tn5382 circular intermediate (results not shown). Unique insertions of the Tn5382-like element (4, 11; this study) and the presence of circular intermediates confirmed by PCR amplification (4, 11; this study) thus suggest that the Tn5382-like element is a functional mobile genetic element in enterococci. However, direct evidence of conjugative transposition of the Tn5382-like element in enterococci has not been demonstrated. Secondary transfer of the Tn5382-like element was therefore attempted with vanB donors (TUH2-18 and TUH2-19) and the recipient E. faecium BM4105-RF or E. faecalis JH2-2 or UV202. The plasmid-associated vanB2 operon (TUH2-19) showed a transfer frequency of about 2 × 10⁻⁵ transconjugants per donor with E. faecium BM4105-RF. Low-frequency (6 × 10⁻⁹) transfer of the chromosomal vanB2 element (TUH2-18) was obtained only with E. faecium BM4105-RF. Molecular analyses of five transconjugants from each experiment did not reveal conjugative transposition of the Tn5382-like element. Rather, the chromosomal Tn5382-like element in TUH2-18 is transferred as an integral part of variable-size DNA elements and the TUH2-19 Tn5382-like element is transferred as part of a mobilizable plasmid (data not shown). The lack of firm evidence that the Tn5382-like element is a conjugative transposon in enterococci stands in contrast to the molecular data presented in references 4 and 11 and in this study, as well as the finding of several open reading frames with significant homology to proteins involved in conjugative transfer at the left end of the transposon (11). Further studies are needed to address the mechanisms of intracellular transposition and conjugative mobilization of the Tn5382-like element in order to understand and control the spread of such determinants.