Abstract
Fluoroquinolone resistance in Streptococcus pneumoniae isolated from Hong Kong as part of Prospective Resistant Organism Tracking and Epidemiology for the Ketolide Telithromycin 1999/2000 was found to be due to the spread of the Spain23F-1 clone (mainly a Spain23F-1-14 variant). All the isolates were multidrug resistant but were susceptible to quinupristin-dalfopristin, linezolid, and telithromycin. The Spain23F-1 clone also occurred among antimicrobial-susceptible isolates, which suggests that the primary source of this clone may have been Asia rather than Iberia.
The global prevalence of fluoroquinolone resistance among Streptococcus pneumoniae is low at around 1% (4, 5, 9, 13). However, “hot spots” with considerably higher fluoroquinolone resistance rates do occur. Ho and colleagues have previously described high levels of fluoroquinolone resistance in pneumococci from Hong Kong due to well-established mutations in topoisomerase IV and DNA gyrase (6, 7). The same research group, using isolates from a different period, found fluoroquinolone resistance in Hong Kong to be due to a single strain, the Spain23F-1 clone, but the mechanism of fluoroquinolone resistance was not determined (8). Likewise, in the study Prospective Resistant Organism Tracking and Epidemiology for the Ketolide Telithromycin 1999/2000 (PROTEKT 1999/2000), high-level fluoroquinolone resistance was detected in Hong Kong—a total of 10 out of 70 S. pneumoniae isolates were levofloxacin resistant (14% resistance) (4).
We therefore analyzed the genetic relatedness and mechanism of fluoroquinolone resistance for all 10 fluoroquinolone-resistant pneumococci isolated from Hong Kong during the PROTEKT 1999/2000 study plus 38 additional fluoroquinolone-susceptible isolates collected during the same period.
(Preliminary data were presented at the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy in 2002 [abstract C2-703]).
MIC was determined for a number of antibacterial agents based on the NCCLS broth microdilution method (11) by using dried microtiter plates supplied by TREK Diagnostics Ltd., East Grinstead, United Kingdom.
Type II DNA topoisomerase genes gyrA, gyrB, parC, and parE were amplified by using DNA extracted with a High Pure PCR Template Kit (Roche, Lewes, United Kingdom) as a template in 50-μl volumes with 2 units of Platinum Taq in reaction buffer supplied by the manufacturer (Invitrogen, Paisley, United Kingdom), with forward and reverse primers (described in Table 1) at a final concentration of 20 nmol/ml and MgCl2 at a final concentration of 1.5 mM. PCR was carried out at an initial incubation at 95°C for 5 min, followed by 25 cycles of 95°C for 30 s, 54°C for 30 s, and 72°C for 3 min. This was followed by a final elongation step of 72°C for 10 min. Amplified DNA was stored at 4°C until required. Each DNA topoisomerase gene was fully sequenced by using an ABI Prism 3100 Genetic Analyser (Applied Biosystems, Warrington, United Kingdom) with additional internal primers.
TABLE 1.
Primers used to amplify regions of pneumococcal genomic DNA contaning type II topoisomerase genes
| Description | Designation | Sequence (5′ to 3′) |
|---|---|---|
| gyrA forward primer | SPGYRAF | GAGGCTGAAATAGATGGGAATT |
| gyrA reverse primer | SPGYRAR | CTGCTAGGATATTTGTCAGC |
| gyrB forward primer | SPGYRBF | CCAGTATCGTGAATTTAAGACA |
| gyrB reverse primer | SPGYRBR | TCCATTAGACATATCAAACTCC |
| parC forward primer | SPPARCF | TTGTGAGTTTGCTTACTTCAAG |
| parC reverse primer | SPPARCR | GTCATATTCCACTCCTTATTC |
| parE forward primer | SPPAREF | AGAGAATCTCTGCTGAAATTGT |
| parE reverse primer | SPPARER | CACATAGTCATTCACATCCGA |
Pulsed-field gel electrophoresis with SmaI digestion and multilocus sequence typing (MLST) was also carried out as described previously (1, 2). MLST analysis was compared with isolates logged onto the MLST database (http://www.mlst.net). Only fluoroquinolone-resistant pneumococci were serotyped by using standard methods and sera with various reactivities from the Statens Serum Institute (Copenhagen, Denmark).
The antibacterial agent susceptibility of the 10 fluoroquinolone-resistant isolates is shown in Table 2. According to NCCLS breakpoints (12), nine were penicillin G resistant and one was penicillin G intermediate. All the isolates were resistant to erythromycin A, tetracycline, and sulfamethoxazole-trimethoprim (i.e., multidrug resistant) but remained susceptible to telithromycin (no NCCLS breakpoint is presently available, but the highest MIC obtained was 0.06 μg/ml), quinupristin-dalfopristin, and linezolid.
TABLE 2.
Antimicrobial susceptibility of 10 fluoroquinolone-resistant S. pneumoniae isolates from Hong Kong
| Isolate no. | MIC (μg/ml)
|
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Cipro- floxacin | Levo- floxacin | Moxi- floxacin | Penicillin G | Erythro- mycin | Tetra- cycline | Sulfamethoxazole- Trimethoprim | Telithro- mycin | Quinupristin- Dalfopristin | Linezolid | |
| P1060004 | >32 | 16 | >4 | 4 | >64 | >16 | >16 | 0.03 | 0.5 | 1 |
| P1060012 | >32 | 16 | 4 | 4 | >64 | >16 | 8 | 0.03 | 0.5 | 1 |
| P1060023 | >32 | 16 | 4 | 4 | >64 | >16 | >16 | 0.03 | 0.5 | 1 |
| P1060024 | >32 | 16 | 4 | 4 | >64 | >16 | >16 | 0.03 | 0.5 | 1 |
| P1060027 | >32 | 16 | 4 | 4 | >64 | 16 | 16 | 0.06 | 0.5 | 1 |
| P1060040 | >32 | 16 | 4 | 4 | >64 | >16 | >16 | 0.06 | 0.5 | 1 |
| P1060003 | >32 | 32 | 4 | 4 | 2 | >16 | 8 | 0.06 | 0.25 | 1 |
| P1060045 | >32 | 16 | 4 | 2 | >64 | >16 | >16 | 0.06 | 0.5 | 1 |
| P1060053 | >32 | 16 | 4 | 2 | >64 | 16 | 8 | 0.03 | 0.5 | 1 |
| P1060195 | >32 | 16 | 4 | 1 | >64 | >16 | 8 | 0.03 | 0.25 | 1 |
It was found that all 10 fluoroquinolone-resistant isolates belonged to the same multilocus sequence type 81, this being the Spain23F-1 clone. Interestingly, nine of these isolates expressed the serotype 14 capsule and should therefore be described more accurately as Spain23F-1-14 (10). These isolates possessed an identical Ser-79-Phe alteration in ParC in combination with Ser-81-Phe in GyrA. Only strain P1060003 retained the “original” serotype 23F capsule and showed a closely related pulsed-field gel electrophoresis pattern that was nonetheless different from that seen with the other fluoroquinolone-resistant isolates (results not shown). Furthermore, P1060003 possessed an additional Asp-435-Asn alteration in ParE and the Ser-81 substitution in GyrA was to Tyr rather than Phe. The possession of three topoisomerase alterations may explain the higher levofloxacin MIC obtained with this isolate (Table 2). P1060003 also differed from the other Spain23F-1clones because it possessed low-level erythromycin A resistance (Table 2), which was determined in a separate study to be due to the macrolide efflux gene mef(A), whereas the other nine fluoroquinolone-resistant isolates possess erm(B) (3). These data suggest, therefore, that there were only two clonal types associated with fluoroquinolone resistance in Hong Kong, with the Spain23F-1-14 variant being most dominant. This confirms the results of Ho et al. (8). We have no way of knowing for sure that identical mutations did not occur independently in each separate isolate of the Spain23F-1 lineage, but, as the mutation rate to fluoroquinolone resistance is perceived as being very low, it would seem most likely that the high resistance in Hong Kong was due to clonal spread. This means that the true mutation rate in Hong Kong may in fact have been lower than 1 in 7 and was possibly nearer to 2 in 70 (2.9%). Furthermore, what has happened in Hong Kong may be unique to that particular community because the development of fluoroquinolone resistance in the global Spain23F-1 clone or variants has not been described elsewhere to date.
When MLST was determined for the 38 fluoroquinolone-susceptible S. pneumoniae isolates (Table 3), 14 of these isolates had MLST profiles that matched the Spain23F-1 clone (MLST 81) and one was a single-locus variant of this clone (with three nucleotide changes in the gdh gene). The remaining isolates were from a wide range of separate clonal lineages, some of which have not been described before (Table 3). Surprisingly, two of the Spain23F-1 clones (P1060002 and P1060200) were not multidrug resistant (Table 4). One other Spain23F-1 clone (P1060028) was also susceptible to penicillin G but was highly resistant to erythromycin A. As far as we are aware, this study is the first to describe penicillin G- and erythromycin A-susceptible isolates of the Spain23F-1 clone. These data also suggest that, despite the nomenclature, the Spain23F-1 clone may not have originated in Spain but in Hong Kong. Furthermore, antibacterial-susceptible Spain23F-1 may have become dominant in this region during the preantibiotic era and the ability of the Spain23F-1 clone to spread may not be due to antibiotic resistance alone.
TABLE 3.
Multilocus sequence typing characteristics of 38 fluoroquinolone-susceptible S. pneumoniae isolates from Hong Kong
| Matching clonea | No. detected | MLST allele no.
|
Multilocus sequence type | ||||||
|---|---|---|---|---|---|---|---|---|---|
| aroE | gdh | gki | recP | spi | xpt | ddl | |||
| MDR Spain23F-1 | 14 | 4 | 4 | 2 | 4 | 4 | 1 | 1 | 81 |
| Serotype 3 (susceptible) | 5 | 7 | 15 | 2 | 10 | 6 | 1 | 22 | 180 |
| MDR France/Spain9V/14-1 | 3 | 7 | 11 | 10 | 1 | 6 | 8 | 1 | 156 |
| England14-9 | 2 | 1 | 5 | 4 | 5 | 5 | 1 | 8 | 9 |
| UK19A/15B-1 (susceptible) | 2 | 8 | 13 | 14 | 4 | 17 | 4 | 14 | 199 |
| SLV of Vietnam isolate | 2 | 10 | 17 | 4 | 16 | 6 | 1 | 17 | New |
| Oxford23F-1 (susceptible) | 1 | 1 | 8 | 9 | 1 | 6 | 4 | 6 | 311 |
| MDR Taiwan23F-1 | 1 | 15 | 29 | 4 | 21 | 30 | 1 | 14 | 242 |
| MDR Taiwan19F-1 | 1 | 15 | 16 | 19 | 15 | 6 | 20 | 26 | 236 |
| SLV of Spain23F-1 | 1 | 4 | 15 | 2 | 4 | 4 | 1 | 1 | New |
| 2LV of Taiwan8-1 | 1 | 15 | N | 34 | 16 | 9 | 14 | N | New |
| No close matches | 1 | 5 | 31 | 4 | 1 | 9 | N | 5 | New |
| No close matches | 1 | 15 | 22 | 2 | 1 | 6 | 14 | 17 | New |
| No close matches | 1 | 7 | N | 9 | 6 | 25 | 6 | 14 | New |
| No close matches | 1 | 5 | 5 | N | 1 | 6 | 1 | 8 | New |
| No close matches | 1 | 8 | 10 | 2 | 16 | 2 | N | 59 | New |
Abbreviations: MDR, multidrug resistant; SLV, single-locus variant; 2LV, two-locus variant; N, not described in MLST database.
TABLE 4.
Antimicrobial susceptibility of the 14 MLST 81 and 1 MLST 81 single-locus variant fluoroquinolone-susceptible S. pneumoniae isolates from Hong Kong
| Isolate no. | MIC (μg/ml)
|
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Penicillin G | Erythro- mycin | Tetra- cycline | Sulfamethoxazole- Trimethoprim | Telithro- mycin | Quinupristin- Dalfopristin | Linezolid | Cipro- floxacin | Levo- floxacin | Moxi- floxacin | |
| P1060030 | 4 | 4 | 16 | 4 | 0.12 | 0.5 | 1 | 1 | 1 | 0.12 |
| P1060014 | 4 | 2 | >16 | 16 | 0.06 | 0.5 | 2 | 2 | 1 | 0.25 |
| P1060020 | 4 | 2 | >16 | >16 | 0.06 | 0.5 | 1 | 2 | 1 | 0.25 |
| P1060031 | 4 | 2 | >16 | >16 | 0.06 | 0.5 | 1 | 2 | 1 | 0.25 |
| P1060036 | 4 | 2 | >16 | 8 | 0.06 | 0.5 | 1 | 2 | 1 | 0.12 |
| P1060009 | 4 | 2 | >16 | 8 | 0.06 | 0.5 | 2 | 1 | 1 | 0.25 |
| P1060035 | 4 | 2 | >16 | 8 | 0.06 | 0.5 | 1 | 1 | 1 | 0.12 |
| P1060198 | 2 | 4 | >16 | 16 | 0.06 | 0.25 | 1 | 1 | 1 | 0.12 |
| P1060197 | 2 | 2 | >16 | 8 | 0.06 | 0.5 | 1 | 2 | 1 | 0.12 |
| P1060018 | 2 | 2 | >16 | >16 | 0.6 | 0.5 | 1 | 1 | 1 | 0.25 |
| P1060057 | 2 | 1 | >16 | 16 | 0.03 | 0.25 | 1 | 2 | 1 | 0.12 |
| P1060050 | 2 | 1 | >16 | 8 | 0.03 | 0.5 | 1 | 1 | 1 | 0.12 |
| P1060002 | 0.015 | 0.06 | 8 | 0.5 | 0.03 | 1 | 1 | 2 | 1 | 0.25 |
| P1060200 | 0.015 | 0.06 | 8 | 0.5 | 0.008 | 0.5 | 1 | 1 | 1 | 0.12 |
| P1060028a | ≤0.008 | >64 | >16 | 2 | 0.5 | 0.5 | 1 | 2 | 2 | 0.5 |
Single-locus variant of Spain23F-1.
Acknowledgments
We are grateful to our colleagues in Hong Kong for the supply of bacterial isolates as part of the PROTEKT study and the GR Micro PROTEKT team (Chris Dencer, Tania Veltman, Julia Cowen, Imogen Baker, and Nicole Tsa) who performed the initial MIC determinations. We also thank Mark Enright (University of Bath, Bath, United Kingdom) for assistance with the MLST analyses and Stephen Gillespie and colleagues at the Royal Free Hospital, London, United Kingdom, for initial determinations of the serotype of the fluoroquinolone-resistant isolates.
Finally, we acknowledge Aventis for their financial support of the PROTEKT study.
REFERENCES
- 1.Descheemaeker, P., S. Chapelle, C. Lammens, M. Hauchecorne, M. Wijdooghe, P. Vandamme, M. Ieven, and H. Goossens. 2000. Macrolide resistance and erythromycin resistance determinants among Belgian Streptococcus pyogenes and Streptococcus pneumoniae isolates. J. Antimicrob. Chemother. 45:167-173. [DOI] [PubMed] [Google Scholar]
- 2.Enright, M. C., and B. G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144:3049-3060. [DOI] [PubMed] [Google Scholar]
- 3.Farrell, D. J., I. Morrissey, S. Bakker, and D. Felmingham. 2002. Molecular characterisation of macrolide resistance mechanisms among Streptococcus pneumoniae and Streptococcus pyogenes isolated from the PROTEKT 1999/2000 study. J. Antimicrob. Chemother. 50(Suppl. S1):39-47. [DOI] [PubMed] [Google Scholar]
- 4.Felmingham, D., R. R. Reinhart, Y. Hirakata, and A. Rodloff. 2002. Increasing prevalence of antibiotic resistance among isolates of Streptococcus pneumoniae from the PROTEKT surveillance study, and comparative in vitro activity of the ketolide, telithromycin. J. Antimicrob. Chemother. 50(Suppl. S1):25-37. [DOI] [PubMed] [Google Scholar]
- 5.Felmingham, D., and R. N. Grüneberg. 2000. The Alexander Project 1996-1997: latest susceptibility data from this international study of bacterial pathogens from community-acquired lower respiratory tract infections. J. Antimicrob. Chemother. 45:191-203. [DOI] [PubMed] [Google Scholar]
- 6.Ho, P.-L., T.-L. Que, D. N.-C. Tsang, T.-K. Ng, K.-H. Chow, and W.-H. Seto. 1999. Emergence of fluoroquinolone resistance among multiply resistant strains of Streptococcus pneumoniae in Hong Kong. Antimicrob. Agents Chemother. 43:1310-1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ho, P. L., W. C. Yam, T. L. Que, D. N. C. Tsang, W. H. Seto, T. K. Ng, and W. S. Ng. 2001. Target site modifications and efflux phenotype in clinical isolates of Streptococcus pneumoniae from Hong Kong with reduced susceptibility to fluoroquinolones. J. Antimicrob. Chemother. 47:655-658. [DOI] [PubMed] [Google Scholar]
- 8.Ho, P. L., R. W. H. Yung, D. N. C. Tsang, T. L. Que, M. H. Ho, W. H. Seto, T. K. Ng, W. C. Yam, and W. W. S. Ng. 2001. Increasing resistance of Streptococcus pneumoniae to fluoroquinolones: results of a Hong Kong multicentre study in 2000. J. Antimicrob. Chemother. 48:659-665. [DOI] [PubMed] [Google Scholar]
- 9.Hoban, D. J., G. V. Doern, A. C. Fluit, M. Roussel-Delvallez, and R. N. Jones. 2001. Worldwide prevalence of antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis in the SENTRY Antimicrobial Surveillance Program, 1997-1999. Clin. Infect. Dis. 32(Suppl. 2):S81-S93. [DOI] [PubMed] [Google Scholar]
- 10.McGee, L., L. McDougal, J. Zhou, B. G. Spratt, F. C. Tenover, R George, R. Hakenback, W. Hryniewich, W. Lefévre, A. Tomasz, and K. P. Klugman. 2001. Nomenclature of major antimicrobial-resistant clones of Streptococcus pneumoniae defined by the pneumococcal molecular epidemiology network. J. Clin. Microbiol. 39:2565-2571. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.National Committee for Clinical Laboratory Standards. 1997. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 4th ed., approved standard. NCCLS document M7-A4. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 12.National Committee for Clinical Laboratory Standards. 2001. Performance standards for antimicrobial susceptibility testing, 11th informational supplement. NCCLS document M100-S11. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 13.Sahm, D. F., M. E. Jones, M. L. Hickey, D. R. Diakun, S. V. Mani, and C. Thornsberry. 2000. Resistance surveillance of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis isolated in Asia and Europe, 1997-1998. J. Antimicrob. Chemother. 45:457-466. [DOI] [PubMed] [Google Scholar]