Frequency of Mutation to Rifampin Resistance in Streptococcus pneumoniae Clinical Strains: hexA and hexB Polymorphisms Do Not Account for Hypermutation

Abstract

The frequency of mutation to rifampin resistance of 200 clinical Streptococcus pneumoniae isolates was examined. Two peaks were observed in the distribution, with mode frequencies of 2.5 × 10⁻⁷ (20% of isolates) and 2.5 × 10⁻⁸. The hexA and hexB gene entire sequences were analyzed in 13 isolates. Sequences from both hypermutable and “normomutable” strains were conserved relative to that of the R6 S. pneumoniae control strain. The phenotypic Hex system proficiency, in terms of transforming efficiency, was also maintained irrespective of the variations in mutation frequency values.

Streptococcus pneumoniae resistance to antibiotics commonly used in therapy, such as beta-lactam agents, fluoroquinolones, cotrimoxazole, macrolides (to a limited extent), and, as is expected, oxazolidinones, is ultimately of mutational origin (16). S. pneumoniae is frequently challenged by adverse ecological changes, including frequent exposure to antibiotics and the host immune system (3, 11), and it is known that bacterial stress promotes the emergence and selection of hypermutable variants (7, 12). Hypermutation in S. pneumoniae has been described to be the result of inactivation of the hexA and hexB genes in the Hex repair system, which is responsible for mutation avoidance through the correction of errors resulting from nucleotide misincorporation during replication (4, 8). Even though the increase in mutation frequency, on average, rarely exceeds 10-fold that of the wild-type proficient control strain (4, 8, 10), the hex-deficient variants have a clear advantage to acquire adaptive mutations leading to antibiotic resistance (10).

In this study, the alleged presence of hypermutable variants of S. pneumoniae was examined by determining the proportion of rifampin-resistant colonies with regard to the total viable cell count (overall rifampin mutation frequency) in a 5-year (1995 to 1999) Spanish collection of 200 clinical isolates from different geographical origins. With this aim, three to five colonies from an overnight culture in 5% sheep blood agar plates (Oxoid Ltd., Basingstoke, United Kingdom) were resuspended in 10 ml of brain heart infusion broth (Oxoid) and incubated for 6 to 8 h at 35°C. A sample of 100 μl was diluted for total viable count determination on antibiotic-free medium. The remaining culture was centrifuged for 10 min at 2,500 × g. The pellet was resuspended in 500 μl of brain heart infusion broth and seeded on 5% sheep blood agar plates containing 2 μg of rifampin/ml (Sigma Chemical Co., St Louis, Mo.). Mutation frequency values are reported as the number of rifampin-resistant colonies (detected after 48 h of incubation in a 5% CO₂ atmosphere) as a proportion of total viable count. The results corresponded to the mean value obtained in duplicate experiments, each with duplicate colony counts.

The results indicated that there was a considerable range of variation in frequencies of mutation to rifampin resistance among the studied population, although these frequencies rarely exceeded 10-fold that of the Hex-proficient control strain. Previously reported results (10), confirmed in this study, show that mutation frequencies to rifampin resistance for the R800 (DNA repair-proficient R6 derivative [ami⁺ aliA⁺ aliB⁺ hex⁺]) and R310 (DNA repair-deficient R800 hexA::_syn spc derivative) control strains (1) are 2.6 × 10⁻⁸ and 1.06 × 10⁻⁷, respectively (fourfold difference). A bimodal distribution emerged when mutation frequencies were plotted versus the percentage of strains presenting a given mutation frequency (Fig. 1a). The two main peaks corresponded to mutation frequencies of 2.5 × 10⁻⁷ and 2.5 × 10⁻⁸ (10-fold difference). Of the tested strains, 21.5% corresponded to the first peak and 56.5% to the second one. The mutation frequency of 8.5% of the strains was higher than 2.5 × 10⁻⁷. Values lower than 10⁻⁸ were infrequent. Among the most divergent strains, although representing a low number, the overall mutation frequencies differed by nearly 1,000-fold, ranging from 1 × 10⁻⁶ to 6 × 10⁻¹⁰. Additionally, mutation frequencies for rifampin resistance did not seem to correlate with the penicillin susceptibility status, as identical bimodal distribution was observed when strains were split into penicillin-susceptible, -intermediate, and -resistant groups (Fig. 1b).

FIG. 1.

Percentage of strains exhibiting a given mutation frequency to rifampin resistance among all 200 S. pneumoniae clinical isolates studied (a) and among penicillin-susceptible (Pen^S), -intermediate (Pen^I), and -resistant (Pen^R) subgroups of the isolates studied. The dotted lines in panel a show mutation frequencies of R800 (hexA-proficient) and R310 (hexA-deficient) S. pneumoniae control strains.

A sample of 13 isolates characterized by macrorestriction patterns by pulsed-field gel electrophoresis analysis (15) (Table 1) was selected for further studies. Eight strains belonged to the group with a mean mutation frequency of ≥2 × 10⁻⁷ (putative hypermutable), and five strains were chosen among those exhibiting a mean mutation frequency of ≤6 × 10⁻⁸ (Table 1). hexA and hexB genes were PCR amplified by using sets of primers (Table 2) that comprised internal fragments covering the whole genes. Purified PCR products (QIAquick PCR purification kit; Qiagen GmbH, Hilden, Germany) were then submitted for entire sequencing of both strands.

TABLE 1.

Representative data of the 13 selected S. pneumoniae strains

Sample	Range of mutation frequency	Penicillin MIC (μg/ml)	PFGE typea	Sero- type	Sample type
1	1.5-1.6 (× 10−8)	0.12	A	18 F	Blood
2	3.4-3.5 (× 10−8)	0.25	B	19	Blood
3	6.0-6.3 (× 10−10)	2	C	14	Nasal
4	5.9-6.1 (× 10−8)	≤0.01	D	24	Ocular
5	4.4-4.8 (× 10−8)	0.5	E	23 F	Sputum
6	2.1-2.5 (× 10−7)	1	E2	23 F	Nasal
7	4.2-4.6 (× 10−7)	0.12	E3	23 F	BALF
8	3.0-3.3 (× 10−7)	1	B1	19	Blood
9	4.7-5.0 (× 10−7)	0.5	C1	14	Blood
10	4.3-4.7 (× 10−7)	≤0.01	G	18 C	BALF
11	3.5-3.8 (× 10−7)	0.06	G1	23 A	Nasal
12	5.0-5.3 (× 10−7)	≤0.01	H	3	Blood
13	1.0-1.2 (× 10−6)	1	E1	23 F	CSFb

^aPFGE, pulsed-field gel electrophoresis. Data from reference 15.

^bCSF, cerebrospinal fluid.

TABLE 2.

Primers used for PCR amplification of hexA and hexB genes

Primer	Sequence (5′ → 3′)
hexA primers
A1 (bp 880-902)	CCGGAATTCATGGAAGATCGTTTGCTAGAT
A2 (bp 1984-1963)	CAAGCGCTCAATGTCATAAACA
A3 (bp 1437-1456)	TGGATTTCACGCTGGTTTGT
A4 (bp 2637-2616)	CGAATCAAATGCTGGGTTTCA
A5 (bp 2408-2428)	GCGACGCTGAAAAACTCAGAA
A6 (bp 3594-3573)	CCGGAATTCTGTTTGTGTGATGTTATTCTA
hexB primers
B1 (bp 403-420)	CCGGAATTCGGCTCCTATGTGGTGGAG
B2 (bp 1574-1554)	TCTTTGAGTGGGAGAATAGTT
B3 (bp 1407-1427)	GCAAGAGGTGCGGATTTCCAA
B4 (bp 2520-2499)	CCGGAATTCTCAAGGTTTTTGAACACCTGAT

The analysis of the hexA sequence of each of the 13 selected strains revealed changes in 21 sites among the 2,534 nucleotides of the gene relative to those of the S. pneumoniae R6 control strain (Table 3). Nucleotide changes implied 12 global amino acid replacements in the 13 strains (range, 1 to 4 changes per strain); the rest of the changes were synonymous transitions or transversions. The influence, if any, of replaced amino acids on HexA protein structure or function is unknown. The polymorphic sites resulting from the nucleotide changes observed gave rise to nine polymorphic patterns. However, taken as a whole, the hexA sequence is highly conserved among strains with no deletions or insertions.

TABLE 3.

Sequence analysis of hexA and hexB genes of the 13 selected S. pneumoniae strains

DNA sequence		Sequence positiona	Amino acid change	Presence of base changes in clinical strain no.b:
R6	Clinical strainc			1	2	3	4	5	6	7	8	9	10	11	12	13
hexA
CTC	CTT	78	—d										*
GAT	AAT	280	Asp→Asn			*						*
CCA	CCC	336	—												*	*
TCC	GCC	388	Ser→Ala			*						*	*
GAA	CAA	514	Glu→Gln						*
GCA	GGA	656	Ala→Gly							*
CAG	CGG	674	Gln→Arg	*										*
CGC	CGA	729	—			*						*
GGC	GGT	1035	—		*		*	*	*	*	*					*
ACT	GCT	1126	Thr→Ala	*									*	*
CTA	TTA	1129	—										*
GCA	GAA	1145	Ala→Glu										*
CTG	CTA	1407	—											*
GGC	GGT	1569	—	*
CGA	CAA	1667	Arg→Gln										*
GTC	GTT	2232	—											*
ATC	ATA	2283	—											*
TTG	TTT	2307	Leu→Phe							*
GCA	ACA	2323	Ala→Thr											*	*
CAA	AAA	2389	Gln→Lys												*
CAG	CAT	2412	Gln→His	*
hexB
GCA	GCG	48	—										*	*	*
GGA	GGG	54	—			*	*	*	*	*		*
TTG	CTG	613	—	*							*
TCC	TCT	714	—		*	*	*	*	*	*	*	*
TTG	TTA	717	—		*	*	*	*	*	*	*	*
ATC	ATT	777	—	*									*	*
TTT	TTC	815	—		*	*	*	*	*	*	*	*			*
GAG	GAA	1053	—		*						*
TTC	TTT	1338	—		*						*
AGC	AGT	1485	—				*	*	*	*						*

^aPosition numbering is from the first nucleotide of the structural gene.

^b*, base change is present.

^cBoldface indicates a base change with respect to the R6 sequence.

^d—, no change.

In the case of hexB (Table 3), proportionally fewer changes were found in its sequence. Ten polymorphic sites among 1,949 nucleotides generated eight polymorphic patterns. For this gene, strikingly, not a single amino acid change was found, and all nucleotide changes represented synonymous transitions. Once again, neither deletions nor insertions were found. Significantly, certain polymorphic patterns found in hexB are shared by many of the studied strains. An explanation could be supported by the possibility that if subsequent recombination events have occurred, a putative long-term shuffling process could be responsible for such remarkable conserved sequences. The presence of different hexA and hexB alleles among clinical pneumococcal strains by sequencing internal fragments of the genes has been previously reported (9).

Differences in transformation frequencies permit the characterization of Hex proficiency status in recipient strains. Evaluation of the Hex phenotype in 8 of the 13 selected strains (four strains each with mean mutation frequencies on the order of 10⁻⁸ and 10⁻⁷) was performed. Hex phenotype was established through the ratio of novobiocin-resistant (Nov^r) to streptomycin-resistant (Str^r) transformants obtained in independent cultures, roughly following previously reported procedures (2). Chromosomal DNA used as the donor was obtained from the S. pneumoniae RF46SKNE strain (5) carrying novobiocin (low-efficiency) and streptomycin (high-efficiency) resistance markers. The procedure for transformation experiments was essentially as described previously (13). Selection of transformants was carried out on plates containing either 2.5 μg of novobiocin/ml or 100 μg of streptomycin/ml. All experiments were done in duplicate, and S. pneumoniae control strains R800 and R310 were also tested.

Efficiency of transformation, expressed as the ratio of Nov^r to Str^r transformants, was similar for the eight clinical strains studied, with a range of values from 0.015 to 0.022, as expected for Hex-proficient cells (2). This means that hex genes' functionality did not seem to be affected, irrespective of the different mutation frequencies to rifampin resistance exhibited by these isolates. Nov^r/Str^r ratios for control strains were 0.012 for R800 (Hex-proficient) and 1.3 for R310 (hexA-deficient).

Although in the bimodal distribution of mutation frequency to rifampin resistance, the peak mutation frequency of 2.5 × 10⁻⁷ was similar to that found for the R310 Hex-deficient strain (1.06 × 10⁻⁷) (10), the role of a presumptive deficiency in hexA and/or hexB mismatch repair genes was not apparent in the hypermutator isolates. Moreover, these isolates exhibited neither substantial alterations in the integrity of the genetic background of the hex genes nor changes in Hex-modulated transforming efficiencies.

However, certain polymorphic clusters or even unique polymorphic sites, particularly along the hexB sequences, were shared by most of the strains analyzed irrespective of their mutation frequency grouping. Nevertheless, due to the few and clustered variable sites found and the limited sample size of the studied strains, evidence of recombination processes leading to such polymorphic variants cannot be inferred. The presence of other runs of similarity in other genes or even the presence of more variability in other parts of hexB could strengthen the hypothesis of either intergenic or intragenic recombination. In the case of hexA, a similar approach can be made, although polymorphic changes among the 13 sequences were rather more dispersed, and many of them resulted in amino acid replacements.

Hex-independent repair genes mutX (6) and mutY (14) were not characterized in the present study, and therefore their involvement in the hypermutable phenotype cannot be ruled out. In any case, a substantial proportion of the clinical isolates examined in this work displayed a mutation frequency similar to that found for the Hex-defective laboratory strain. It has been previously reported (10) that this increased mutation frequency may be sufficient to assure that most of the mutations leading to antibiotic resistance will occur among hypermutable S. pneumoniae populations that are expected to be coselected by hitchhiking with antibiotic resistance. We cannot discard the possibility that once the mutational adaptation occurs, the wild-type hexA or hexB allelic sequences could be reacquired by previously defective S. pneumoniae strains, thus minimizing the biological cost associated with a hypermutable state as soon as the antibiotic-selective bottleneck has been successfully crossed.