Abstract
Technologies allowing direct detection of specific RNA/DNA sequences occasionally serve as an alternative to amplification methods for gene expression studies. In these direct methods the hybridization of probes takes place in complex mixtures, thus specificity and sensitivity still limit the use of current technologies. To address these challenges, we developed a new technique called the nucleic acid capture assay, involving a direct multi-capture system. This approach combines a 3′-ethylene glycol scaffolding with the incorporation of 2′-methoxy deoxyribonucleotides in the capture sequences. In our design, all nucleotides other than those complementary to the target mRNA have been replaced by an inert linker, resulting in significant reductions in non-specific binding. We also provide a versatile method to detect the presence of captured targets by using specific labeled probes with alkaline phosphatase-conjugated anti-label antibodies. This direct, flexible and reliable technique for gene expression analysis is well suited for high-throughput screening and has potential for DNA microarray applications.
INTRODUCTION
Conventional amplification methods for the detection and quantification of specific nucleic acid sequences are known to be extremely sensitive. These methods, however, require multiple steps that can generate false positives and affect their reproducibility. In addition, time-consuming and labor- intensive steps make these approaches unsuitable for high-throughput applications. As an alternative, sandwich hybridization approaches were investigated (1). First described by Dunn and Hassell (2), these methods used nucleic acid probes complementary to the DNA or RNA target to be identified and quantified, of which one type was attached to a solid support and the other labeled. Although limited interference from proteins or other biological contaminants allowed direct quantitation, the sandwich hybridization was relatively slow and inefficient (3,4). Furthermore, the original methods employed radioisotopic detection systems that limit probe shelf-life.
Progress in synthetic oligonucleotide synthesis, in conjunction with the development of branched oligodeoxyribonucleotides (5), revolutionized hybridization assay technology. Rapid nucleic acid hybridization assays were developed (6) by combining solution and sandwich hybridization with the use of branched DNA (bDNA) and enzyme-labeled probes. These methods, known as bDNA assays, rely on the solution-phase hybridization of two sets of target probes called capture and label extenders. Capture extenders hybridize to both the nucleic acid target and a DNA oligomer bound to a solid support. Label extenders bind to different sequences on the target molecule and the synthetic bDNA amplifier. Alkaline phosphatase-conjugated probes that hybridize with the amplifier mediate a chemiluminescent reaction, leading to the amplification and detection of the capture event. The bDNA assay technology has been used for the quantification of various nucleic acid targets in different types of samples (7–11) and generally allows quantitation of between 104 and 107 molecules (7–9). In some cases, using increased amplification, investigators were able to quantitate as few as 50–500 target molecules (10,11). Although bDNA technology provides sensitive hybridization assays with a wide dynamic range, precise and accurate quantitation, there are still major limitations preventing its broad and routine use in research laboratories. For example, bDNA assays necessitate the tedious task of synthesizing branched oligodeoxyribonucleotides and alkaline phosphatase-conjugated probes. Further more, they require multiple layers of probes to capture and signal the target molecule, which often triggers high background. Finally, although the bDNA technology format could be easily adapted to high-throughput screening, the assay costs limit such an application.
To overcome these limitations, we developed a new technology called the nucleic acid capture assay (NACA), which allows high-throughput direct quantification of mRNAs. Our approach combines a 3′-ethylene glycol scaffolding with the incorporation of 2′-methoxy deoxyribonucleotides in the capture sequences covalently attached to a solid support. In our design, all nucleotides other than those complementary to the target mRNA have been replaced by an inert linker, which significantly reduces, if not eliminates, non-specific binding. We also provide an easy and versatile method to detect the capture of the nucleotidic target of interest using specific probes labeled either with digoxigenin (DIG), fluorescein isothiocyanate (FITC) or biotin, combined with alkaline phosphatase-conjugated anti-DIG, anti-FITC antibodies or streptavidin, respectively, and a chemiluminescent substrate. Although the target molecule is directly captured onto the solid support and no branched oligodeoxyribonucleotides are used for detection, we could successfully quantitate the level of fetal hemoglobin mRNA (gamma hemoglobin, γHb) with greater sensitivity than the bDNA technology. In order to validate our technology with ‘real world samples’ we measured the expression of the human γHb gene in primary bone marrow cells and compared the NACA with quantitative RT–PCR, a well established and broadly used gene expression analysis method. Finally, we demonstrate that our method holds potential for improvements in the capture process for DNA array applications.
MATERIALS AND METHODS
All reagents were ordered from Sigma (St Louis, MO, USA) unless indicated otherwise.
Branched DNA assay
Using ProbeDesigner software (12) (Chiron Diagnostic, East Walpole, MA, USA) a set of probes specific for the human fetal hemoglobin (γHb) was designed as follows. Capture extenders: 1, ttgccgaaatggattgccaaatttttctcttggaaagaaagt; 2, gcacctcaggggtgaattcttttttctcttggaaagaaagt; 3, tcttctgccaggaagccttttttctcttggaaagaaagt; 4, gcctatccttgaaagctctgtttttctcttggaaagaaagt; 5, atttgtattgcttgcagaataaatttttctcttggaaagaaagt; 6, tgatctcttagcagaatagatttatttttttctcttggaaagaaagt. Label extenders: 1, gccttgactttggggttgcccatgatgtttttaggcataggacccgtgtct; 2, tcagcaccttcttgccatgttttttaggcataggacccgtgtct; 3, ttatggcatctcccaaggaagtttttaggcataggacccgtgtct; 4, gcccttgagatcatccaggtgcttttttaggcataggacccgtgtct; 5, tgcagttcactcagctgggcaaaggttttttaggcataggacccgtgtct; 6, acggtcaccagcacattt cccaggtttttaggcataggacccgtgtct; 7, ccagtcaccatcttctgccatttttaggcataggacccgtgtct; 8, ggacagggcactggccactttttaggcataggacccgtgtct. Blockers: cacatgcagcttgtcacag, agcttgaagttctcag gatc, catcatgggcagtgagctcagtggtatctgga (the bold sequences hybridize directly with γHb RNA). The bDNA assay for direct quantification of nucleic acid molecules was performed using the Quantigene bDNA signal amplification kit (Chiron Diagnostic) according to the procedure described by the manufacturer.
Nucleic acid capture assay
The different probes specific for the γHb RNA used in the bDNA assay were also used for the γHb NACA. To covalently bind the different capture polymers, quinone photochemistry was used (13). Basically, the photocoating technique introduces an ethylene glycol spacer and a stable electrophilic group that reacts with nucleophiles, such as free amines. The spacer design and the density of electrophilic groups on this surface are optimized for the detection of various types of DNA and RNA. As photoprobes the quinones have the advantages of high coupling yields, excitation at 300–400 nm, stability towards visible light and thermochemical stability. Different capture polymers were synthesized with an amino group at the 3′ end for covalent coupling to 96-well DNA Immobilizer™ plates (Exiqon, Vadbaek, Denmark) that employ quinone chemistry. Either γHb RNA standard was diluted in lysis buffer [1 M HEPES, pH 8.0; 10% lithium lauryl sulfate; 0.25 M EDTA; 5 M lithium chloride; 600 mg/l Proteinase K; Micro-protect (Boehringer Manheim, Indianapolis, IN, USA)], or human bone marrow primary cells were lysed in the above lysis buffer, in the presence of different analyte-binding oligonucleotides before mixing (1:1) with capture hybridization buffer [6× sodium chloride/sodium citrate (SSC) buffer; 0.1% SDS; 50 µg/ml salmon sperm DNA] and loading onto the DNA Immobilizer™ plates coated with modified capture polymers. Hybridization was performed overnight at 53°C in the dark. The next day, the plates were cooled to room temperature and washed with wash buffer (0.1× SSC buffer; 0.1% SDS). The diluted stem oligonucleotide (gatgtggttgtcgtacttgcgtagtgactgttttttttttgacacgggtcctatgcct) in label buffer [6× SSC; 10% BM block (Boehringer Mannheim)] was then added before incubating at 53°C for 30 min. After recooling to room temperature the plates were washed with wash buffer before addition of the DIG-, FITC- or biotin-labeled oligonucleotide (tacgcaagtacgacaaccacatctt label) diluted in label buffer. After 30 min incubation at 53°C, the plates were cooled back down to room temperature, washed with wash buffer and incubated at room temperature for 30 min in the presence of anti-label (DIG, FITC) antibody or streptavidin, all conjugated to alkaline phosphatase. Finally, the plates were treated with 50 µl/well of alkaline phosphatase substrate (CDP-Star, InnoGenex, San Ramon, CA, USA) and incubated at 37°C for 15 min. The chemiluminescence was read using an MLX microplate luminometer (Dynex, Chantilly, VA, USA).
Fetal hemoglobin RNA transcript
Total RNA was isolated from the granulocytic K562 cell line using a Qiagen RNAeasy kit (Qiagen, Valencia, CA, USA). Purified total RNA was reverse transcribed and amplified by PCR using the ThermoScript™ RT–PCR system (Life Technologies–GIBCO BRL, Rockville, NY, USA). The PCR product was subcloned into the XhoI–dHindII sites of the pBluescript II SK(–) vector and in vitro transcribed using a MEGAscript™ T7 kit (Ambion, Austin, TX, USA). Single-stranded DNA was also made using KO7-helper phage and purified using a Qiagen kit.
Oligonucleotide synthesis
The different unlabeled oligodeoxyribonucleotide molecules, as well as the FITC- or biotin-labeled molecules used in this work, were synthesized on an automated DNA synthesizer (Model 394, Applied Biosystems Division, Perkin Elmer, Foster City, CA, USA) using standard phosphoramidite chemistry (14,15) with reagents purchased from Glen Research (Sterling, VA, USA).
Probe labeling
The DIG-labeled sequence was generated using a DIG oligonucleotide tailing kit (Roche Molecular Biochemicals) by enzymatic labeling of oligonucleotides at their 3′ end with terminal transferase through incorporation of deoxynucleotide triphosphates (dNTP) and DIG-dUTPs in a template-independent reaction (16).
Quantitative RT–PCR
Total RNA was isolated from the NACA bone marrow cell lysate using the QiaShredder and Qiagen RNAeasy Mini Prep kits (Qiagen). Quantitative RT–PCR analysis for the human γHb gene was performed using an ABI PRISM 7700 sequence detection system and software (Perkin Elmer) as previously described (17) using the following primers: forward, GCCCTGTCCTCCAGATACCA; reverse, TTCCAGAATAAAGCCTATCCTTGA; and probe, TGAGCTCACTGCCCATGATGCAGAG. The ribosomal protein L19 (RPL19) was chosen as internal standard. The relative expression level of γHb was computed with respect to the expression level of RPL19.
RESULTS AND DISCUSSION
Implementation of the NACA detection system
A set of capture, label and blocker sequences was designed to establish a bDNA assay for human fetal hemoglobin (γHb) (Fig. 1A). In the bDNA assay, synthetic γHb RNA hybridizes in solution to a set of specifically designed capture and label extenders. To reduce non-specific binding and to stabilize the target, blockers hybridizing specifically to the γHb RNA were also added. Capture of γHb RNA on a solid support subsequently results from the binding of capture extenders to DNA oligomers covalently bound to the solid support provided in the Quantigene bDNA signal amplification kit (see Materials and Methods). The signaling of the captured γHb RNA is accomplished through a synthetic bDNA amplifier molecule containing 15 branches. This DNA structure hybridizes to a specific sequence present in all the label extenders. Finally, short oligomers conjugated to alkaline phosphatase are introduced into the assay. These sequences complement three binding sites on each branch of the amplifier, resulting in chemiluminescent signaling. Using a luminometer, the relative light units (RLUs) measured correlates with the amount of γHb RNA present.
Figure 1.
Comparison between the γHb bDNA assay and first generation NACA. The γHb bDNA assay (A) and the first generation NACA (B) differ in their detection strategies. The bDNA assay uses bDNA amplifier molecules that contain a maximum of 45 binding sites for alkaline phosphatase-conjugated probes. The label extenders contain a sequence specific for the γHb RNA target as well as an overhang sequence designed to bind the bDNA amplifier. Similarly, in the first generation NACA, the analyte-binding oligonucleotides contain a sequence specific for the γHb RNA target as well as an overhang sequence designed to bind the stem oligonucleotide. The labeled oligonucleotides, containing a maximum of 10 label molecules (DIG, FITC or biotin) bind to the stem oligonucleotide. Anti-label antibodies or streptavidin conjugated to alkaline phosphatase signal the capture event. Performances of the γHb bDNA assay (filled circles) and the NACA (open circles) with DIG-labeled oligonucleotides were compared using recombinant γHb RNA at concentrations ranging from 6.8 pg/ml to 5 ng/ml (C). While the bDNA assay generated a strong non-linear signal for the range of γHb RNA concentration tested, the first generation NACA generated a linear, albeit lower signal for the same range of concentrations (note the difference in RLU scales).
We took advantage of the different probes used in the γHb bDNA assay to develop the first generation of γHb NACA (Fig. 1B). The NACA differs from the bDNA assay in various aspects. One is its detection strategy. To detect the captured γHb mRNA, a stem oligonucleotide that specifically hybridizes with the label extender (analyte-binding oligonucleotide) is introduced in the assay. In turn, the stem oligonucleotide hybridizes with the labeled oligonucleotide containing approximately 10 label molecules. Several labels were investigated, including DIG, FITC and biotin. The captured γHb mRNA was successfully detected at similar efficiencies using DIG- or FITC-labeled oligonucleotide in conjunction with alkaline phosphatase conjugated to anti-DIG or anti-FITC, respectively (data not shown). Biotin-labeled oligonucleotide followed by alkaline phosphatase conjugated to streptavidin was similarly effective (data not shown). These detection approaches show promise in multiplexing the analysis. Although the specific signal intensity was a hundred times lower in the γHb NACA than in the bDNA assay (Fig. 1C), the background was also lower in the γHb NACA, resulting in similar signal-to-noise ratios. As presented in Figure 1C, the γHb NACA provides better sensitivity and a greater dynamic range than the bDNA assay. Later, we obtained similar results using a labeled oligonucleotide that directly hybridizes with the analyte-binding oligonucleotide (data not shown).
Direct binding of the capture sequences on the solid support
In the indirect capture system, the capture extenders hybridize freely to the target mRNA in solution before hybridizing to the DNA oligomer covalently attached to the solid support. Although this strategy increases the versatility of the technique, the introduction of an additional nucleic acid sequence could be a source of non-specific binding and decreased signal-to-noise ratio. To determine whether the indirect capture results in better performance than the direct capture approach, we covalently bound six different γHb mRNA capture extenders directly to the solid support (Fig. 2B) and compared this format with the first version of the NACA using the DNA oligomer in conjunction with the same six different capture extenders (Fig. 2A). Direct binding of the six different capture extenders to the solid support resulted in a 2-fold reduction in the signal-to-noise ratio compared with the indirect format involving the DNA oligomer (Fig. 2H). To investigate any negative impacts that the reduction of different capture extenders would hold, we progressively withdrew different sequences during the coating process (Fig. 2B–G). The stepwise reduction in diversity of the different capture extenders resulted in a linear decrease in the assay sensitivity (Fig. 2H).
Figure 2.
Advantage of the multiple indirect versus the single direct capture format. The indirect capture format, composed of six different capture extenders, all specific for the γHb RNA, as used in the γHb bDNA assay and the first generation NACA (A), was compared with the direct capture format using the same six different capture sequences (B). In the latter format, the capture extenders were synthesized with an amino group at the 3′ end that directly attaches onto DNA Immobilizer™ plates using quinone chemistry. Subsequently, the variety of different capture extenders involved in the capture of the γHb RNA was progressively reduced to five (C), four (D), three (E), two (F) and one (G) type of sequence. Performances of the different formats were compared using 5 ng/ml of γHb RNA and results plotted as signal-to-noise ratios (H). The direct capture format, as well as the reduction in diversity of the capture extenders involved in this assay, results in a major decrease of γHb NACA sensitivity compared with the indirect capture format. These results demonstrate the advantage of the indirect versus the direct capture format in terms of stability/flexibility and the advantage of a capture that involves different capture extenders (I).
These results revealed fundamental concepts about the capture process that allowed us to improve the NACA technology. As described in Figure 2I, cooperativity, flexibility and stability are major parameters that influence the performance of capturing a specific nucleic acid sequence. Involvement of different capture extenders that recognize different regions on the target sequence increases the probability of multi-capture events that promote more stable and specific hybridizations.
The involvement of the DNA oligomer in the first version NACA results in higher flexibility and stability of the capture event. When a DNA oligomer is involved, different capture extenders freely hybridize to the target molecule in solution with few spatial constraints and subsequently bind to the DNA oligomer attached to the solid support. Since involvement of all capture extenders takes place, this format results in an optimal capture process. In addition, the complex formed by the target, the capture extender and the DNA oligomer covalently attached to the solid support remains thermodynamically stable. In the case where the capture extender binds directly to the solid support, the hybridization process is less flexible and the captured target molecule is submitted to more physical constraints, likely decreasing the hybridization stability. In this respect, the indirect capture performs better than the direct capture approach (Fig. 2H). However, we wanted to take advantage of the direct capture format to reduce non-specific hybridization. Because of this result, we decided to modify the capture extenders in order to compensate for the reduction in flexibility, stability and cooperativity resulting from the absence of the DNA oligomer.
Improvement of the NACA direct capture system
In the direct capture format of NACA (Fig. 3B), the sequence in the capture extender that previously hybridized to the DNA oligomer (Fig. 3A) becomes useless. Therefore, we synthesized a new set of capture extenders called modified capture polymers (see Materials and Methods), in which the nucleic acid sequences that do not directly hybridize with the γHb RNA were replaced by a 3′-ethylene glycol scaffolding (Fig. 3C). To maintain optimal spacing between the sequence that directly hybridizes to the target molecule and the solid support, the scaffolding was composed of four 18-O-dimethoxytritylhexaethyleneglycol,1[(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite molecules. Being an inert carbon chain, this structure has the advantages of being uncharged and flexible. As presented in Figure 3D, the NACA sensitivity increased significantly when the modified capture polymers containing a 3′-ethylene glycol scaffolding (Fig. 3C) were directly attached to the solid support, compared with the direct format using regular capture extenders (Fig. 3B). This sensitivity increase is a result of a decreased background signal. The best sensitivity, however, was still obtained when an indirect capture strategy was used, as in the first generation NACA (Fig. 3A).
Figure 3.
Improvement of the direct capture format using a 3′-ethylene glycol scaffolding. The indirect capture format (A) was compared with a direct format using either the same capture extenders directly attached to the solid support (B) or the modified capture polymers (C), in which the sequences previously hybridizing with the DNA oligomer in the indirect format were replaced by a 3′-ethylene glycol scaffolding. The performances of the three different formats were tested in the γHb NACA with recombinant γHb RNA at concentrations ranging from 6.8 pg/ml to 5 ng/ml. While the sensitivity of the direct capture format was significantly improved by the use of capture polymers containing a 3′-ethylene glycol scaffolding (C) compared with a regular capture extender (B), the indirect capture format using the DNA oligomer still provided the best sensitivity in terms of signal-to-noise ratio (D).
In the direct capture format, one of the theoretical effects of a reduction in flexibility is a decreased probability that capture events will involve all the different capture sequences on the solid support. Therefore, only a fraction of the different capture polymers will contribute to the capture of one target molecule, resulting in weak hybridization and lower assay sensitivity. To determine whether increasing the hybridization strength between the capture polymers and target sequences would compensate for the reduction in flexibility, stability and cooperativity in the direct capture format, 2′-O-methoxy-RNA (18) was incorporated into the 3′-ethylene glycol scaffolding capture polymers, in both the 3′ and 5′ regions that hybridize to the target molecule (Fig. 4C). As shown in Figure 4D, incorporation of 2′-O-methoxy-RNA in the 3′-ethylene glycol scaffolding capture polymers results in a significant increase in signal-to-noise ratio compared with the direct capture that uses capture polymers containing only the 3′-ethylene glycol scaffolding (Fig. 4B). Furthermore, the 2′-O-methoxy- RNA format also significantly improved the assay sensitivity compared with the original indirect capture format (Fig. 4A).
Figure 4.
Improvement of the direct capture format using 2′-O-methoxy-RNA. The indirect capture format (A) was compared with a direct format using either the modified capture polymers containing a 3′-ethylene glycol scaffolding (B) or modified capture polymers containing 2′-O-methoxy-RNA in the sequence hybridizing with the γHb RNA target in addition to a 3′-ethylene glycol scaffolding (C). The performances of three different formats were tested in the γHb NACA using recombinant γHb RNA at concentrations ranging from 6.8 pg/ml to 5 ng/ml (D). The incorporation of 2′-O-methoxy-RNA in the modified capture polymers in addition to a 3′-ethylene glycol scaffolding significantly improved the performance of the direct capture format and resulted in better sensitivity than the indirect capture format. The final version of the NACA technology (E) integrates both a direct capture format using multiple modified capture polymers containing 2′-O-methoxy-RNA and a 3′-ethylene glycol scaffolding, and a signaling system using labeled oligonucleotide (DIG, FITC or biotin) in conjunction with anti-label antibodies or streptavidin conjugated to alkaline phosphatase. In the case of the γHb NACA, six modified capture polymers and eight labeled oligonucleotides were use.
The final format of the NACA technology (Fig. 4E) includes several modifications required for an efficient direct capture system. Multiple modified capture polymers designed using an ‘in-house’ algorithm include 2′-methoxy deoxyribonucleotides as well as a 3′-ethylene glycol scaffolding. Moreover, because DNA oligomers are not involved in the direct capture format, there is no need for blocker oligonucleotides. Therefore, all the nucleic acid sequences involved actively contribute to the capture or signaling of the target molecule. As a result, non-specific hybridization is dramatically decreased. Contrary to the bDNA assay in which the capture and signaling events contribute equally to the overall efficiency of the technique, emphasis is given to the capture step in the NACA. Indeed, the use of short partially modified capture sequences contributes to increase the specificity and the hybridization strength of the capture event.
Fetal hemoglobin gene expression analysis in human bone marrow cells
To demonstrate the ability of the NACA technology to measure the expression of a specific gene directly in crude cell lysate, the expression of the human fetal hemoglobin gene was analyzed in primary bone marrow cells treated with hemin (Fig. 5). To validate the approach, the NACA data were compared with quantitative RT–PCR data generated after RNA purification and subsequent specific amplification (see Materials and Methods). As shown in Figure 5A, the quantitative RT–PCR revealed a 10-fold increase in γHb gene expression in response to in vitro treatment of the bone marrow cells with hemin as compared with the untreated control cells. Similar results were obtained with the NACA using the indirect (Fig. 5B) or direct modified capture (Fig. 5C) as described in Figures 1B and 4E, respectively. In addition to validating the NACA technology with ‘real world samples’, the agreement between the NACA and quantitative RT–PCR results demonstrates the experimental advantage of the NACA over conventional PCR-based approaches for this type of application. Notably, the human fetal hemoglobin gene expression was analyzed using the NACA directly from cell lysates without requiring a time-consuming RNA purification step or an expensive real-time PCR instrument.
Figure 5.
Analysis of γHb gene expression in human bone marrow primary cells treated with hemin, using quantitative RT–PCR (A, n = 2) or NACA with indirect (B, n = 8) or direct capture (C, n = 10). Results are expressed as fold induction over the control condition after normalization to ribosomal protein L19 or the cell number in the case of the quantitative RT–PCR and the NACA, respectively. With the NACA, as well as the quantitative RT–PCR, a 10-fold increase in γHb expression is observed, thus validating the NACA as a direct approach for gene expression analysis. The error bars indicate the standard error for each data point.
Application of the modified capture polymers to a DNA array format
The cooperativity evidenced in the context of NACA also has applications for the field of DNA array technology. Indeed, the NACA format involving only one capture extender (Fig. 2G) is similar to most DNA array capture systems. Therefore, the use of different capture sequences would likely improve the sensitivity and specificity of existing DNA array systems. To investigate whether the direct multi-capture strategy using modified capture polymers containing a 3′-ethylene glycol scaffolding and 2′-O-methoxy-RNA could be applied to a simple DNA array format, we performed initial studies in a 96-well plate, using the γHb gene as the target. Three different γHb-specific modified capture polymers containing 2′-O-methoxy-RNA and a 3′-ethylene glycol scaffolding were designed. Modified capture polymers covalently attached to each well hybridized with various amounts of DIG-labeled γHb cDNA. Signaling of the captured cDNA was achieved through an anti-DIG antibody conjugated to alkaline phosphatase, followed by a chemiluminescent reaction (Fig. 6A). As presented in Figure 6B, this approach enabled us to measure a linear signal between 6.8 pg/ml and 5 ng/ml of DIG-labeled γHb cDNA. In addition, the signal intensity observed with 6.8 pg/ml of labeled cDNA appears almost 10 times higher than the background signal observed in the absence of probes. This result strongly suggests that the use of multiple capture polymers engineered with modified RNA and 3′-ethylene glycol scaffolding represents a simple, versatile and low cost approach for the detection and identification of specific genes in a 96 384 and 1536 well microplate format, as well as in a classical cDNA microarray format.
Figure 6.
Integration of the modified capture polymers into a DNA array format. The use of the modified capture polymers containing 2′-O-methoxy-RNA and a 3′-ethylene glycol scaffolding was tested in a simple DNA array format (A). Fetal hemoglobin cDNA was labeled with DIG and captured through multiple modified capture polymers covalently attached to DNA Immobilizer™ plates. Detection of the capture cDNA was performed using an anti-DIG antibody conjugated to alkaline phophatase. After addition of the alkaline phophatase substrate, a linear chemiluminescent signal was observed over concentrations of labeled γHb cDNA ranging from 6.8 pg/ml to 5 ng/ml (B).
Acknowledgments
ACKNOWLEDGEMENTS
We are grateful to Dr Dan Eaton and Bernd Wranik for providing us with the human bone marrow primary cells and the γHb primers and probe for quantitative RT–PCR analysis; and Dr Mickey Williams and Ayly Tucker for valuable discussions on bDNA assay technology. We also thank Drs Suzie Scales and Lino Gonzalez for their review of the manuscript.
REFERENCES
- 1.Meinkoth J. and Wahl,G. (1984) Hybridization of nucleic acids immobilized on solid support. Anal. Biochem., 138, 267–284. [DOI] [PubMed] [Google Scholar]
- 2.Dunn A.R. and Hassell,J.A. (1977) A novel method to map transcripts: evidence for homology between an adenovirus mRNA and discrete multiple regions of the viral genome. Cell, 12, 23–26. [DOI] [PubMed] [Google Scholar]
- 3.Ranki M., Palva,A., Virtanen,M., Laaksonen,M. and Soderlund,H. (1983) Sandwich hybridization as a convenient method for detection of nucleic acid in crude samples. Gene, 21, 77–85. [DOI] [PubMed] [Google Scholar]
- 4.Syvanen A.-C., Laaksonen,M. and Soderlund,H. (1986) Fast quantitation of nucleic acid hybrids by affinity hybrid collection. Nucleic Acids Res., 14, 5037–5048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Horn T. and Urdea,M.S. (1989) Forks and combs and DNA: the synthesis of branched oligodeoxyribonucleotides. Nucleic Acids Res., 17, 6959–6967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Urdea M.S., Running,J.A., Horn,T., Clyne,J., Ku,L. and Warner,B.D. (1987) A novel method for the rapid detection of specific nucleotide sequences in crude biological samples without blotting or radioactivity; application to the analysis of hepatitis B virus in human serum. Gene, 61, 253–264. [DOI] [PubMed] [Google Scholar]
- 7.Zaaijer H.L., Borg,F.T., Cuypers,H.T.M., Hermus,M.A.C.H. and Lelie,P.N. (1994) Comparison of methods for detection of hepatitis B virus DNA. J. Clin. Microbiol., 32, 2088–2091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hendricks D.A., Stowe,B.J., Hoo,B.S., Kolberg J., Irvine,B.D., Neuwald,P.D., Urdea,M.S. and Perrillo,R.P. (1995) Quantification of HBV DNA in human serum using a branched DNA (bDNA) signal amplification assay. Am. J. Clin. Pathol., 104, 537–546. [DOI] [PubMed] [Google Scholar]
- 9.Detmer J., Lagier,R., Flynn,J., Zayati,C., Kolberg,J., Collins,M., Urdea,M.S. and Sanchez-Pescador,R. (1996) Accurate quantification of hepatitis C virus (HCV) RNA from all HCV genotypes by using branched-DNA technology. J. Clin. Microbiol., 34, 901–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kern D., Collins,M.L., Fultz,T., Detmer,J., Hamren,S., Peterkin,J.J., Sheridan,P., Urdea,M., White,R., Yeghiazarian,T. and Todd,J. (1996) An enhance-sensitivity branched-DNA assay for quantification of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol., 34, 3196–3202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Collins M.L., Irvine,B., Tyner,D., Fine,E., Zayati,C., Chang,C., Horn,T., Ahle,D., Detmer,J., Shen,L.P. et al. (1997) A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic Acids Res., 25, 2979–2984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bushnell S., Budde,J., Catino,T., Cole,J., Derti,A., Kelso,R., Collins,M.L., Molino,G., Sheridan,P., Monahan,J. and Urdea,M. (1999) ProbeDesigner: for the design of probesets for branched DNA (bDNA) signal amplification assays. Bioinformatics, 15, 348–355. [DOI] [PubMed] [Google Scholar]
- 13.Koch T., Jacobsen,N., Fensholdt,J., Boas,U., Fensger,M. and Jakobsen,M.H. (2000) Photochemical immobilization of anthraquinone conjugated oligonucleotides and PCR amplicon on solid support. Bioconjug. Chem., 11, 474–483. [DOI] [PubMed] [Google Scholar]
- 14.Beaucage S. and Caruthers,M. (1981) Deoxynucleoside phosphoramidites: a new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett., 22, 1859–1862. [Google Scholar]
- 15.Warner B.D., Warner,M.E., Karns,G.A., Ku,L., Brown-Shimer,S. and Urdea,M.S. (1984) Construction and evaluation of an instrument for the automated synthesis of oligodeoxyribonucleotides. DNA, 3, 401–411. [DOI] [PubMed] [Google Scholar]
- 16.Schmitz G.G., Walter,T., Seibl,R. and Kessler,C. (1991) Nonradioactive labeling of oligonucleotides in vitro with the hapten digoxigenin by tailing with terminal transferase. Anal. Biochem., 192, 222–231. [DOI] [PubMed] [Google Scholar]
- 17.Gibson U.E.M., Heid,C.A. and Williams,P.M. (1996) A novel method for real time quantitative RT–PCR. Genome Res., 6, 995–1001. [DOI] [PubMed] [Google Scholar]
- 18.Shimizu M., Konishi,A., Shimada,Y., Inoue,H. and Ohtsuka,E. (1992) Oligo(2′-O-methyl)ribonucleotides. Effective probes for duplex DNA. FEBS Lett., 302, 155–158. [DOI] [PubMed] [Google Scholar]






