Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2003 Apr 15;31(8):e43. doi: 10.1093/nar/gng043

Multiplexed SNP genotyping using the Qbead™ system: a quantum dot-encoded microsphere-based assay

Hongxia Xu, Michael Y Sha a, Edith Y Wong, Janet Uphoff, Yanzhang Xu, Joseph A Treadway, Anh Truong, Eamonn O’Brien 1, Steven Asquith 1, Michael Stubbins 1, Nigel K Spurr 2, Eric H Lai 2, Walt Mahoney
PMCID: PMC153755  PMID: 12682378

Abstract

We have developed a new method using the Qbead™ system for high-throughput genotyping of single nucleotide polymorphisms (SNPs). The Qbead system employs fluorescent Qdot™ semiconductor nanocrystals, also known as quantum dots, to encode microspheres that subsequently can be used as a platform for multiplexed assays. By combining mixtures of quantum dots with distinct emission wavelengths and intensities, unique spectral ‘barcodes’ are created that enable the high levels of multiplexing required for complex genetic analyses. Here, we applied the Qbead system to SNP genotyping by encoding microspheres conjugated to allele-specific oligonucleotides. After hybridization of oligonucleotides to amplicons produced by multiplexed PCR of genomic DNA, individual microspheres are analyzed by flow cytometry and each SNP is distinguished by its unique spectral barcode. Using 10 model SNPs, we validated the Qbead system as an accurate and reliable technique for multiplexed SNP genotyping. By modifying the types of probes conjugated to microspheres, the Qbead system can easily be adapted to other assay chemistries for SNP genotyping as well as to other applications such as analysis of gene expression and protein–protein interactions. With its capability for high-throughput automation, the Qbead system has the potential to be a robust and cost-effective platform for a number of applications.

INTRODUCTION

The ability to discern human genetic variation is fundamental to human genetic research and pharmacogenomics. The most common type of genetic variation among individuals is the single nucleotide polymorphism (SNP), in which two alternative bases appear at a given site in the human genome. SNPs occur in humans at an estimated frequency of 1 in 1000 bp, and estimates of the number of SNPs that may be present in the entire human genome range from three million to 10 million (1,2). Several databases of SNPs have been established and are steadily growing in content, including the Human Genome Variation database (HGVbase) (3), the SNP Consortium and the central database for SNPs (dbSNP) (4). Recently, the first high-density map of SNPs integrated with the features of the human genome, created through the combined efforts of the SNP Consortium and the Human Genome Project, has been published (5). Given their abundance and stability, SNPs offer tremendous potential to identify disease-causing genes, as well as to establish markers for diagnostics and differential drug response.

Several methods have been used to characterize SNPs, including restriction fragment length polymorphism analysis, DNA sequencing, single-stranded conformational polymorphism analysis (6), allele-specific hybridization (7), molecular beacon probes (8,9), flap endonuclease digestion (10,11), 5′ nuclease TaqMan® (12,13), oligonucleotide ligation assay (14,15), primer extension assay (16–18) and electrocatalysis (19). These methods have been adapted to a variety of detection platforms, including gel electrophoresis, fluorescence polarization (20), high-density fluorescent arrays (18,21,22) and mass spectrometry (23,24). Each of these SNP genotyping methods has different advantages and disadvantages and is suitable for a different range of applications (25). Yet, in order to capitalize fully on the tremendous work in this area, further development efforts are needed to create more broadly applicable SNP genotyping methods that permit accurate allelic determination, allow genotyping of multiple SNPs in parallel and are cost-effective.

In this report, we describe a new SNP genotyping method using the Qbead™ system. The Qbead system employs fluorescent Qdot™ semiconductor nanocrystals (26), also known as quantum dots, to encode latex beads that subsequently can be used as a platform for multiplexed assays. Quantum dots are nanoscopic inorganic crystallites that exhibit properties based not only on the composition but also on the size of the particles. For example, cadmium selenide (CdSe) nanocrystals can be prepared so as to emit light fluorescently at nearly any wavelength within the visible spectrum by tuning the particle size from 1 to 7 nm in diameter. CdSe nanocrystals with a 3 nm core emit green light, whereas CdSe nanocrystals with a 6 nm core emit red light. These materials possess several unique properties important to the present analysis. Many colors of quantum dots can be induced to emit light with the same excitation source, allowing the use of simple, inexpensive instrumentation. Quantum dot emission also can be extremely narrow [full peak width at half-maximum (FWHM) emission intensity of <20–30 nm] and symmetric (no red tail), allowing many non-overlapping colors to be utilized simultaneously. Finally, these inorganic crystallites can be prepared as extremely stable and robust materials that can withstand chemically and photochemically demanding environments without bleaching.

In the Qbead system, unique spectral signatures are created for each microsphere population by mixing nanocrystals with different emission colors as well as by varying the intensity (i.e. concentration) of nanocrystals used to encode the microspheres. In theory, the encoding capacity of the Qbead system can be derived from the following equation: C = Nm – 1, where C is the number of unique codes, N is the number of intensity levels, and m is the number of emission colors. For this study, we used nanocrystals of two emission colors (530 and 565 nm) at varying concentrations to yield different emission intensity levels. In applying the Qbead system to multiplexed SNP genotyping, multiplexed PCR was performed to amplify regions in the genomic DNA containing the SNPs of interest. The PCR products were then hybridized with encoded microspheres conjugated to allele-specific oligonucleotides (beads). The beads were decoded by flow cytometry, and SNP genotypes were determined based on the relative proportions of the paired allele present in the genomic DNA. Our results show that the Qbead system is an accurate and reliable method for multiplexed SNP genotyping. With the potential for simultaneous detection of thousands of SNPs in a single well, the Qbead system offers a cost-effective approach for high-throughput multiplexed SNP genotyping.

MATERIALS AND METHODS

Human genomic DNA samples

Human genomic DNA samples were obtained from GlaxoSmithKline (GSK) (Brentford, UK). Samples from GSK were supplied as fully anonymized human genomic DNA originally collected from volunteers participating in phase I clinical trials. Human genomic DNA samples also were purchased from Coriell Cell Repositories (Camden, NJ). Coriell genomic DNA samples were from 20 individuals (18 males and two females) of different ethnic origins, including 12 Caucasian, 4 African American, 2 Asian Chinese and 2 Asian Japanese.

Multiplex PCR amplification

PCR primers were designed for SNPs of the cytochrome P450 (CYP1A1, CYP2C8, CYP2C18, CYP2D6 and CYP3A5) and N-acetyltransferase (NAT2) genes. Primers were designed using Oligo 6 primer analysis software (Molecular Biology Insights, Inc., Cascade, CO) with high-stringency parameters and sequence blast analysis to reduce non-specific amplification in multiplexed PCR. To obtain higher specificity, allele-specific probes with similar melting temperatures were designed for each SNP allele with polymorphic sequences located near the center of each hybridization sequence. For each SNP, a pair of forward and reverse PCR primers flanking the SNP of interest was created, and the reverse primer was labeled with biotin at the 5′ end. Qualified primer pairs generated amplicons no greater than 200 bp in length, with melting temperatures in the range of 58–64°C based on the nearest-neighbor method, and yielded a specific amplicon that was confirmed by sequencing.

Ten-plex PCRs were performed in a 25 µl volume with 1.0 ng of genomic DNA. The reaction mixture contained 9 mM Tris–HCl pH 8.3, 65 mM KCl, 5 mM MgCl2, 0.2 mM dNTPs, 1.5 µl of primer mix and 1 U of AmpliTaq Gold DNA polymerase (PE Applied Biosystems, Foster City, CA). PCRs were performed in a GeneAmp PCR System 9700 (PE Applied Biosystems) and included a 10 min incubation at 94°C followed by 40 cycles at 94°C for 30 s, 58°C for 30 s and 72°C for 30 s. Primer mix contained 20 primers, consisting of a pair of forward and reverse primers for each of 10 SNPs, at concentrations of 60–120 nM. PCR conditions were optimized for maximum allele specificity by varying the concentrations of KCl, MgCl2 and primers. AmpliTaq Gold, which is a ‘Gold’ version of Taq polymerase with a simplified hot start, was used to minimize further the formation of the template-independent, artifactual product primer dimer.

Allele-specific oligonucleotides

For a given SNP, two allele-specific oligonucleotide probes were designed, one for each of the two SNP alleles (Table 1). Oligonucleotide lengths and sequences were optimized using Oligo 6 software so that all probes had minimal secondary structures and similar melting temperatures (62.1–66.9°C) predicted using the nearest-neighbor method. The allele-specific oligonucleotide probes contained four components: (i) a 5′ amine modification for amide coupling to the carboxylated microspheres; (ii) a 12 carbon spacer to extend the oligonucleotide from the microsphere in order to minimize any potential interaction between the oligonucleotide sequence and the microsphere surface; (iii) an 18mer poly(dT) linker used to determine the coupling efficiency, which can be detected by poly(A) oligonucleotide probe; and (iv) a 17–25 base hybridization sequence complementary to the SNP allele. With the exception of Q18-A, the polymorphic sequences were situated near the center of each hybridization sequence to obtain higher allele specificity. For Q18-A, the polymorphic sequence was placed toward the 5′ end of the hybridization sequence because of potential interference by predicted secondary structures. Allele-specific oligonucleotide probes were synthesized by Biosource/Keystone (Camarillo, CA).

Table 1. Allele-specific oligonucleotides used for SNP genotypinga.

Allele-specific oligos Gene and SNP position Sequence
Q1-A CYP1A1 (6819) X02612 5′GTGAGACCGTTGCCCGC3′
Q1-B CYP1A1 (6819) X02612 5′GTGAGACCATTGCCCGC3′
Q4-A CYP2C18 (792) L16869 5′ATCCCAGCACTTAGGGAGAC3′
Q4-B CYP2C18 (792) L16869 5′ATCCCAGCACCTAGGGAGAC3′
Q6-A CYP2C8 (1238) Y00498 5′CTACATGATGACAAAGAATTTCCTA3′
Q6-B CYP2C8 (1238) Y00498 5′CTACATGATGACAGAGAATTTCCTA3′
Q7-A CYP2C8 (1539) Y00498 5′TCTGGCTGCTGATCTGCTAT3′
Q7-B CYP2C8 (1539) Y00498 5′TCTGGCTGCCGATCTGCTAT3′
Q8-A CYP2C8 (458) Y00498 5′GGGGAAGAGGAGCATTGAG3′
Q8-B CYP2C8 (458) Y00498 5′GGGGAAGAAGAGCATTGAG3′
Q10-A CYP2D6 (4469) M33388 5′ATGAGAACCTGCGCATAGTG3′
Q10-B CYP2D6 (4469) M33388 5′ATGAGAACCTGTGCATAGTG3′
Q13-A CYP2D6 (5799) M33388 5′CCTGGTGAGCCCATCCC3′
Q13-B CYP2D6 (5799) M33388 5′CCTGGTGACCCCATCCC3′
Q15-A CYP3A5 (145601) AF280107 5′TGGCTGGGCTTGCAAGG3′
Q15-B CYP3A5 (145601) AF280107 5′TGGCTGGGCGTGCAAGG3′
Q18-A NAT2 (481) U53473 5′TACCTGGACCAAATCAGGAGA3′
Q18-B NAT2 (481) U53473 5′ATCTGGTACTTGGACCAAATCA3′
Q20-A NAT2 (341) U53473 5′GTGACCATTGACGGCAGG3′
Q20-B NAT2 (341) U53473 5 GTGACCACTGACGGCAGGA3′

aEach allele-specific oligonucleotide has a 12 carbon spacer and 18mer poly(dT) linker at its 5′ end. The polymorphic sites in each allele-specific oligonucleotide are in bold and underlined.

Coupling of oligonucleotides to microspheres

For each conjugation reaction, 80 µl of 10 µm diameter carboxylated microspheres (Polysciences, Warrington, PA) containing approximately 4 × 106 microspheres was centrifuged at 5220 g for 3 min. After removing the supernatant, microspheres were washed twice in 100 µl of 0.1 M imidazole buffer pH 7.0. After resuspension of microspheres in 20 µl of imidazole buffer pH 7.0 (∼10% solids), 1 µl of 100 mM oligos and 100 µl of 200 mM EDAC (Acros, Pittsburgh, PA) in freshly made imidazole buffer pH 7.0 was added and the reaction mixture was incubated for 2 h at room temperature with continuous rotation. An additional 100 µl of 200 mM EDAC in freshly made imidazole buffer pH 7.0 was added and the room temperature incubation with rotation was continued for another 2 h. Microspheres were then centrifuged at 5220 g for 3 min, washed twice with 100 µl of water, and resuspended in 40 µl of phosphate-buffered saline (PBS), pH 7.4.

Encoding of oligonucleotide-conjugated microspheres

Dyeing solution was freshly prepared by mixing 3 µl of hydrophobic TOP/TOPO nanocrystals (26–28) in chloroform with 42 µl of chloroform and 405 µl of butanol. For each dyeing reaction, 200 µl of oligonucleotide-conjugated microspheres (approximately 2.5 × 107 microspheres) were centri fuged at 5220 g for 3 min. After sequential washes in methanol and butanol, microspheres were resuspended in 75 µl of dyeing solution, vortexed, and incubated at room temperature for 1 h with end-to-end shaking. Microspheres were then washed with PBS pH 7.4, resuspended to 400 µl in PBS pH 7.4 with 1% bovine serum albumin (BSA) and incubated for 30 min with end-to-end shaking. Finally, PBS pH 7.4 with 1% BSA was added to a final volume of 200 µl to bring the final suspension to approximately 1 × 105 microspheres/µl. The encoded oligonucleotide-specific microspheres were stored in the dark at 4°C.

Due to instrument limitations at the time, we made use of nanocrystals of only two emission colors (530 and 565 nm) at concentrations to yield three intensity levels (high, medium and low), which provided for nine unique codes. In addition, a tenth code was used in which no nanocrystals were present. A representative dot plot showing the green versus yellow profiles of each of the 10 microsphere types used for SNP genotyping is depicted in Figure 1. In experiments in which 10 SNPs were identified, multiplexed PCR products were incubated in two separate reactions. Each reaction included all 10 microsphere types and five paired sets of allele-specific probes, with each pair corresponding to one SNP. While the spectral signatures created by the combinations of colors and intensity levels used here were more than adequate for the level of multiplexing required for this study, substantially higher levels of encoding, i.e. 2–3 orders of magnitude greater, are possible by making use of additional colors ranging from blue to far red, as well as additional intensity levels.

Figure 1.

Figure 1

Dot plot showing the green (FL1) versus yellow (FL2) profiles of each of the 10 microsphere types used for SNP genotyping.

Hybridization

Hybridization reactions were carried out by combining 1.5 µl of each preparation of encoded microspheres (10 different encoded microsphere preparations in total) with 3 µl of denatured multiplex PCR products, 7 µl of water and 25 µl of 2× hybridization buffer (2 M tetramethyl-ammonium chloride, 75 mM Tris, 6 mM EDTA) at 55°C for 30 min. Prior to hybridization, PCR products were denatured at 96°C for 2 min and then placed on ice. Following one wash at room temperature and one wash at 55°C for 7 min in 1.2× SSPE, 0.05% SDS, encoded microspheres were resuspended in PBS pH 7.4 with 1% BSA. After addition of 3 µl of 0.2 mg/ml Streptavidin–phycoerythrin (PE)–Cy5 conjugate (BD Biosciences, Pharmingen, San Diego, CA), encoded microspheres were incubated for 30 min in the dark at room temperature and 300 µl of PBS was added for flow cytometry analysis.

Data analysis by flow cytometry and verification by sequencing

The encoded microspheres were analyzed using a Becton Dickinson Immunocytometry Systems (BDIS) FACScan and associated CellQuest Software 3.3 (Becton Dickinson, San Jose, CA). Each encoded microsphere population was identified by its unique fluorescence profile of green (530 nm) and yellow (565 nm) light emitted at low, medium or high intensity. The red (670 nm) fluorescence of the Streptavidin–PE–Cy5 conjugate, resulting from hybridization of biotin-labeled amplicons to allele-specific oligonucleotides on the surface of the microspheres, was calculated by subtracting the small amount of red fluorescence contributed by microspheres alone from the total red fluorescence. For each hybridization, approximately 400–800 encoded microspheres were analyzed. The ratio of the mean intensity from microspheres with probes specific for allele A versus microspheres with probes specific for allele B was used to identify the three AA, AB and BB genotypes for genomic DNA. Alternatively, the mean intensity from microspheres with probes specific for allele A versus microspheres with probes specific for allele B was plotted to identify AA, AB and BB genotypes using a cluster analysis program.

Sequence analyses for verification of SNP genotypes were performed at Sequetech (Mountain View, CA). PCR products were purified using the QIAquick® PCR purification kit (QIAGEN, Valencia, CA) prior to DNA sequencing, Both strands of the PCR template were used for DNA sequencing.

RESULTS

Principles of the Qbead system

A schematic diagram of the Qbead system applied to multiplexed SNP genotyping is shown in Figure 2. To begin, regions in the genomic DNA containing the SNPs of interest are amplified by multiplexed PCR using biotin-labeled primers. The resulting biotinylated amplicons are then incubated under hybridization conditions with different microsphere populations, each conjugated to different allele-specific oligonucleotides and encoded with mixtures of nanocrystals with distinct emission wavelengths and intensities that create spectral signatures to identify individual microspheres uniquely. Hybridization occurs only when there is a perfect match between the amplicon and the allele-specific probe of the encoded microsphere, whereas no hybridization occurs in cases where there is a mismatch. After addition of Streptavidin–PE–Cy5 conjugate, flow cytometric analysis is used simultaneously to decode the microspheres and determine the extent of hybridization. Each encoded microsphere population is identified by its unique ratiometric fluorescence profile of green (530 nm) and yellow (565 nm) emitted light. A hybridization signal emitted as red fluorescence (670 nm) by the Streptavidin–PE–Cy5 conjugate is present only on those encoded microspheres to which biotinylated amplicons have hybridized to allele-specific oligonucleotides on the surface of the microspheres. Homozygous and heterozygous SNP genotypes are then determined based on the relative proportions of the paired alleles present in the genomic DNA.

Figure 2.

Figure 2

Schematic diagram of SNP genotyping using the Qbead system. Biotin-labeled primers are used for PCR amplification of each SNP from genomic DNA. The resulting biotin-labeled amplicons are hybridized only when there is a perfect match between the amplicon and the allele-specific probe of the encoded microsphere. Flow cytometric analysis identifies each encoded microsphere population by its unique fluorescence profile of green (530 nm) and yellow (565 nm) light emitted at different intensity levels. Encoded microspheres to which biotinylated amplicons have hybridized are identified by the red fluorescence (670 nm) emitted by the Streptavidin–PE–Cy5 conjugate. The relative proportions of the paired alleles present in the genomic DNA are used to distinguish homozygous and heterozygous SNP genotypes.

Validation of allele-specific probes for the Qbead system

Allele-specific hybridization is used as the basis for SNP discrimination in the Qbead system. Each allele-specific probe was validated in the Qbead system by testing singleplex PCR products of genomic DNA samples. For each SNP, genotypes were determined for up to nine GSK genomic DNA samples in singleplex reactions using encoded microspheres (86 SNP genotypes total), and all experiments with encoded microspheres were conducted in a blinded manner. After analysis of encoded microspheres, the SNP genotypes of the genomic DNA samples were also determined by sequence analysis to verify results obtained using the Qbead system. Results showed that the allele-specific probes accurately discriminated between homozygous and heterozygous SNP genotypes in the Qbead system in all samples tested. No discrepancies were observed between results of the Qbead system and sequencing results.

Multiplexed SNP genotyping using the Qbead system

Multiplexed SNP genotyping using the Qbead system was explored by first testing multiplex PCR products of Coriell genomic DNA samples. In these experiments, the genotypes of 10 different SNPs for each of 20 Coriell genomic DNA samples were determined by incubating multiplexed PCR products in two separate reactions with all 10 microsphere types and five paired sets of allele-specific probes (each pair corresponding to one SNP). The SNP genotype results obtained with the Qbead system for the 20 Coriell genomic DNA samples are summarized in Table 2. These results show that each of the encoded microsphere sets discriminated between homozygous and heterozygous SNP genotypes for all 20 samples tested (200 SNP genotypes in total). Results obtained with the Qbead system were verified by sequence analysis for 194 SNP genotype determinations. In the remaining six cases, the Qbead system was able to discern the SNP genotype, whereas sequence analysis failed to give an SNP genotype result. Hence, the call rate for sequence analysis was 96.5%, while the call rate of the Qbead system was 100% and the accuracy of the Qbead system was 100% for 194 SNP genotypes.

Table 2. Comparison of SNP genotyping of Coriell genomic DNA samples by sequencing versus multiplex reactions using the Qbead systema.

Sample no. SNP genotype detected
  Q1 Q4 Q6 Q7 Q8 Q10 Q13 Q15 Q18 Q20
1 GA TT AA TT GG CT GC GG CC TC
2 AA TT AA CC GG CC GC TT TC TC
3 GA TC AA TC GG CC CC TG TC TC
4 GA TC AA TT GG CC GC TT CC TT
5 GA TT AA CC GG CC GC TT CC TT
6 AA CC AA TT GG CC GC TT CC TT
7 AA TT AA TC GG CT GC TT TC TC
8 AA TC AA TC GG CT GC TG TC TC
9 AA TT AA TT GG TT CC GG CC TT
10 AA TT AA CC GG CC GG TT TC TC
11 AA TT AA CC GG TT CC TG TC TC
12 AA TT AG CC GA CT CC TT TC TC
13 AA TT AG CC GA CC GG TT CC TT
14 AA TT AA TC GG CC GG TT TC CC
15 AA TC AA TC GG CC GG TT TC TT
16 AA TC AG TC GA CC GC TT TC TC
17 AA TC AG TC GA TT CC TT TT TT
18 GA TT AA CC GG CC CC TT TT TT
19 AA TT AA CC GG CC GG TG TT CC
20 AA TT AA TC GG CC GG TT TC TC

aTen SNP genotypes for each of 20 Coriell genomic DNA samples were determined in multiplexed reactions using encoded microspheres (200 SNP genotypes in total). Sequencing results agreed with the results of the Qbead system for 194 SNP genotype determinations. No sequencing result was obtained for six SNP genotypes, which are indicated in bold and underlined.

Multiplexed SNP genotyping using the Qbead system was explored further by determining 10 different SNP genotypes for 94 genomic DNA samples from GSK on a 96-well plate with two blanks for negative controls (940 SNP genotypes in total). All experiments with encoded microspheres were conducted in a blinded manner, and the SNP genotypes were determined independently at GSK using 5′ nuclease TaqMan® in-house assays to verify the results of the Qbead system. A typical example of the data generated by one pair of encoded microspheres for the 94 GSK genomic DNA samples is shown in Figure 3. This graph shows the mean fluorescence intensity (MFI) generated by the hybridization of PCR products to the Q20-A/Q20-B-encoded microsphere pair. SNP genotypes are clearly distinguished by comparing the fluorescence intensity of the C allele and T allele for each genomic DNA sample. The ratio (C:T) of MFI values for the CC homozygous samples ranged from 0.012 to 0.044, while the ratios of MFI values for the CT heterozygous samples ranged from 0.390 to 1.483 and for the TT homozygous samples ranged from 51.766 to 5781.000.

Figure 3.

Figure 3

Mean fluorescence intensity generated by the C allele and T allele of the SNP position 341 of NAT2 as measured in a multiplexed assay with the Q20-A/Q20-B-encoded microsphere pair. Low-level background MFI indicative in greater intensities of the presence of the T allele, can be observed in the CC homozygous samples. Similarly, low-level MFI indicative in greater intensities of the presence of the C allele, can be observed in the TT homozygous samples.

A composite dot plot figure showing the MFI generated by all 10 encoded microsphere pairs for each SNP allele of the 94 GSK genomic DNA samples is shown in Figure 4. In this figure, the MFIs generated by the hybridization of PCR products of one allele (designated allele A) are plotted on the x-axis, and the MFIs from the second allele (designated allele B) are plotted on the y-axis. For each of the 10 encoded microsphere pairs, homozygous and heterozygous SNP genotypes are discriminated as clusters on the graph. As expected, no signal was obtained for the two negative controls (i.e. 0 on the x-axis and 0 on the y-axis). In order to assess the reliability and robustness of the Qbead system, the PCR amplification and hybridization steps for these experiments were performed twice by two different operators. Results from the first operator determined 937 and results from the second operator determined 939 of the 940 SNP genotypes, indicating call rates of 99.7 and 99.9%, respectively. The four cases in which an SNP genotype was not determined by one operator were non-overlapping. Upon repeat testing, SNP genotypes were determined by both operators for these four cases. In all cases in which an SNP genotype was determined by both operators, the results of the two operators were 100% concordant. The encoded microsphere results were verified further at GSK using 5′ nuclease TaqMan® in-house assays for all 940 SNP genotype determinations, indicating that the concordance between these two methods was 100%.

Figure 4.

Figure 4

Multiplexed genotyping of SNPs using the Qbead system. A composite dot plot figure showing the MFI generated by all 10 paired encoded microsphere sets for each SNP allele of the 94 GSK genomic DNA samples is shown. MFIs generated by the hybridization of PCR products of one allele (designated allele A) are plotted on the x-axis, and the MFIs from the second allele (designated allele B) are plotted on the y-axis. For each of the encoded microsphere sets, homozygous and heterozygous SNP genotypes are discriminated as clusters on the graph.

DISCUSSION

In this report, we describe a new method for multiplexed SNP genotyping using the Qbead system. The Qbead system uses spectral signatures or ‘barcodes’ to identify individual microspheres. Just as traditional barcodes use black and white stripes of various positions and widths to track and identify items, the Qbead system uses combinations of different Qdot nanocrystals with various emission wavelengths and intensities to create unique codes for microsphere identification. To our knowledge, this is the first study to demonstrate a practical biological application for nanocrystal-encoded bead technology. Earlier studies used water-dispersible nanocrystals covalently linked to biomolecules to investigate the suitability of Qdot nanocrystals for ultrasensitive labeling of molecules in a biological context (26,29). Recently, nanocrystals covalently linked to streptavidin have been used to visualize molecular targets at the subcellular level (30). In addition, a proof-of-concept study used nanocrystals conjugated to microspheres as a model to detect DNA hybridization of oligonucleotide probes (31). Our work both confirms and extends the findings of these earlier studies in that we have validated the Qbead system as an accurate, sensitive and robust method for multiplexed genetic analyses. Our study represents a significant advance in that this is the first demonstration of multiplexed genotype analysis of actual patient samples using nanocrystal-encoded bead technology.

We wished to demonstrate a practical working system for real-world genotyping applications rather than modeling individual components of such a system. For this reason, we chose genes from the cytochrome P450 family. This family is particularly relevant to modern drug discovery due to the critical metabolic role played by many of these genes (32). Furthermore, the cytochrome P450 family is a notoriously difficult gene family due to the high degree of homology among its members that impacts not only multiplexed detection (e.g. because of cross-reactivities) but also the ability to multiplex PCR amplification of targets. In addition, we made use of only authentic genomic samples rather than relying upon clean model oligonucleotides.

The Qbead system offers a number of advantages for highly multiplexed biological and genetic applications. The broad excitation spectra and narrow emission spectra of the nanocrystals make it possible to excite many different nanocrystals as well as the fluorophore of the hybridized target with a single wavelength of light, resulting in emission colors that can be detected simultaneously. Moreover, it is possible to produce nanocrystals that emit light at any desired wavelength with a narrow 20–30 nm FWHM (full-width at half maximum) band width by controlling the mean size and size distribution of nanocrystals during synthesis. Nanocrystals also have superior stability and a reduced photo-bleaching rate as compared with organic fluorophores (29). One of the key features of nanocrystal-encoded bead technology is the potential encoding capacity that enables the high level of multiplexing necessary for genetic analysis. In theory, N intensity levels with m colors will produce Nm – 1 unique codes. For example, a combination of five colors and six intensity levels theoretically would produce 7776 unique codes. In practice, however, fewer unique codes may be produced due to spectral overlapping, fluorescence intensity variations and signal-to-noise requirements. Nonetheless, a realistic scheme using 5–6 colors with six intensity levels would be expected to yield at least 10 000–40 000 recognizable codes (31). When compared with other bead-based technologies such as the Luminex platform (33,34), the Qbead system provides much more potential upside in terms of multiplexing since thousands more spectral codes are possible using nanocrystals instead of traditional dyes.

Our study demonstrates several key features of the Qbead system that are important for SNP genotyping. First, the Qbead system is highly accurate. In analyzing 86 SNP genotypes from GSK genomic DNA samples and 200 SNP genotypes from Coriell genomic DNA samples, results of the Qbead system were 100% concordant with those of direct DNA sequencing. In fact, the call rate of the Qbead system was higher than that of DNA sequencing. Whereas sequencing discerned 280 of the 286 genotypes tested (97.9% call rate), the Qbead system identified 286 of the 286 SNP genotypes (100% call rate). One possible explanation for the relatively low call rate by DNA sequencing is that the PCR products may not have been sufficiently clean for DNA sequencing, despite purification of products with the QIAquick™ PCR purification kit. Nonetheless, using the same samples without QIAquick™ PCR purification, the Qbead system was able to discern SNP genotypes for all samples tested. In determining the 940 SNP genotypes of the GSK genomic DNA samples, results of the Qbead system were 100% concordant between operators and 100% concordant with results of the GSK 5′ nuclease TaqMan® in-house assays.

Secondly, the Qbead system is able to function accurately with very low quantities of DNA. In the experiments shown here, we used 1 ng of genomic DNA for 10-plex PCR, and the resulting PCR products were used for multiplex SNP genotype determinations (0.1 ng per SNP genotype). We have since found that we obtain comparable results using 0.2 ng of genomic DNA for 10 SNP genotype determinations (0.02 ng per SNP genotype). The amount of genomic DNA used for each SNP determination by the Qbead system is substantially less than that required by non-multiplexed assays or multiplexed assays without direct multiplexed amplification of genomic DNA.

A third feature of the Qbead system is its flexibility. It is relatively straightforward to customize the Qbead system by selecting allele-specific oligonucleotides according to the SNPs of interest, and different multiplexed assays can be created simply by mixing various combinations of encoded microspheres. In addition, the Qbead system can, in principle, be adapted to other assay chemistries for SNP genotyping such as allele-specific primer extension (ASPE), oligonucleotide ligation assay (OLA), PCR combined with ligase detection reaction (PCR/LDR), single base extension assay and molecular beacon probes. Also, by modifying the types of probes conjugated to microspheres, the Qbead system can easily be adapted to other applications such as analysis of gene expression and protein–protein interactions. The ease with which oligonucleotides and spectral codes can be added or changed renders the Qbead system far more flexible while simultaneously less expensive than methods such as DNA microarrays in which all probes are located on a single platform. Moreover, because each custom-encoded microsphere population can be tested individually and checked for quality control, the Qbead system does not suffer from the chip-to-chip variation problems common with microarrays.

Efficiency is a fourth feature of the Qbead system. Because the PCR amplification of genomic DNA is performed in multiplex, only one amplification step is performed. As compared with systems in which genomic DNA is first amplified in singleplex PCRs and the products then applied to other amplification steps, the multiplex PCR of the Qbead system reduces the amount of not only the genomic DNA required but also the enzymes and reagents needed for PCR amplification. In addition, because the reaction products from the muliplexed PCR amplification are used directly, the Qbead system saves the time and expense associated with enzymatic or column purification of PCR products. The rapid reaction kinetics and reduced hybridization times of the Qbead system also enhance efficiency. As compared with microarrays, suspended bead-based systems such as the Qbead system have the advantage of fast solution-like reaction kinetics instead of the comparatively sluggish kinetics characteristic of two-dimensional chip technologies. This is advantageous from the standpoint of high throughput and, more importantly, potentially critical to the ultimate accuracy of the genotyping systems.

Finally, the Qbead system has high-throughput capability. In the experiments shown here, 10 SNP alleles were determined in multiplexed reactions using combinations of nanocrystals with two emission colors and different intensity levels. To date, more than 110 unique codes have been created and decoded successfully using Qbead technology (manuscript in preparation). The multiplexed PCR amplification and hybridization reactions can be performed in a 96-well plate, and high throughput can be facilitated by adapting the Qbead system to automated sample handling and transfer devices. Also, although data for this study were generated using a BDIS FACScan, assays can now be analyzed with a fluorescence-based imaging and data analysis instrument that has been developed for the Qbead system (35). Information about the microscope-based detection platform as well as other information about quantum dot technology can be viewed at http://www.qdots.com.

In summary, we have developed an accurate and sensitive method for multiplexed SNP genotyping using the Qbead system. Furthermore, we have demonstrated the actual use of the Qbead system for SNP genotyping of the cytochrome P450 family and produced extremely accurate parallel results in spite of the known difficulties often encountered with this gene family. We have done so while simultaneously reducing the amount of genomic DNA typically required for SNP genotype analysis. Bead-based genetic analysis in general, and Qbead microsphere-based analysis in particular, promise flexibility, efficiency and easy automation in a robust and cost-effective platform for a number of biological and genetic applications.

Acknowledgments

ACKNOWLEDGEMENTS

We would like to thank Ping Wu and Kenneth Barovsky (Quantum Dot Corporation, Hayward, CA) for careful review of the manuscript. We also thank Michael Hagan (Oakland, CA) for graphics, and Julie Sommer and Linda Wuestehube (SciScript, Lafayette, CA) for writing and editorial assistance.

REFERENCES

  • 1.Wang D.G., Fan,J.B., Siao,C.J., Berno,A., Young,P., Sapolsky,R., Ghandour,G., Perkins,N., Winchester,E., Spencer,J. et al. (1998) Large-scale identification, mapping and genotyping of single-nucleotide polymorphisms in the human genome. Science, 280, 1077–1082. [DOI] [PubMed] [Google Scholar]
  • 2.Lai E. (2001) Application of SNP technologies in medicine: lessons learned and future challenges. Genome Res., 11, 927–929. [DOI] [PubMed] [Google Scholar]
  • 3.Brookes A.J., Lehvaslaiho,H., Siegfried,M., Boehm,J.G., Yuan,Y.P., Sarkar,C.M., Bork,P. and Ortigao,F. (2000) HGBASE: a database of SNPs and other variations in and around human genes. Nucleic Acids Res., 28, 356–360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Smigielski E.M., Sirotkin,K., Ward,M. and Sherry,S.T. (2000) dbSNP: a database of single nucleotide polymorphisms. Nucleic Acids Res., 28, 352–355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sachidanandam R., Weissman,D., Schmidt,S.C., Kakol,J.M., Stein,L.D., Marth,G., Sherry,S., Mullikin,J.C., Mortimore,B.J., Willey,D.L. et al. (2001) A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature, 409, 928–933. [DOI] [PubMed] [Google Scholar]
  • 6.Kozlowski P. and Krzyzosiak,W.J. (2001) Combined SSCP/duplex analysis by capillary electrophoresis for more efficient mutation detection. Nucleic Acids Res., 29, e71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Howell W.M., Jobs,M., Gyllensten,U. and Brookes,A.J. (1999) Dynamic allele-specific hybridization. A new method for scoring single nucleotide polymorphisms. Nat. Biotechnol., 17, 87–88. [DOI] [PubMed] [Google Scholar]
  • 8.Marras S.A., Kramer,F.R. and Tyagi,S. (1999) Multiplex detection of single-nucleotide variations using molecular beacons. Genet. Anal., 14, 151–156. [DOI] [PubMed] [Google Scholar]
  • 9.Tyagi S., Bratu,D.P. and Kramer,F.R. (1998) Multicolor molecular beacons for allele discrimination. Nat. Biotechnol., 16, 49–53. [DOI] [PubMed] [Google Scholar]
  • 10.Lyamichev V., Mast,A.L., Hall,J.G., Prudent,J.R., Kaiser,M.W., Takova,T., Kwiatkowski,R.W., Sander,T.J., de Arruda,M., Arco,D.A. et al. (1999) Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes. Nat. Biotechnol., 17, 292–296. [DOI] [PubMed] [Google Scholar]
  • 11.Mein C.A., Barratt,B.J., Dunn,M.G., Siegmund,T., Smith,A.N., Esposito,L., Nutland,S., Stevens,H.E., Wilson,A.J., Phillips,M.S. et al. (2000) Evaluation of single nucleotide polymorphism typing with invader on PCR amplicons and its automation. Genome Res., 10, 330–343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Livak K.J. (1999) Allelic discrimination using fluorogenic probes and the 5′ nuclease assay. Genet. Anal., 14, 143–149. [DOI] [PubMed] [Google Scholar]
  • 13.Whitcombe D., Brownie,J., Gillard,H.L., McKechnie,D., Theaker,J., Newton,C.R. and Little,S. (1998) A homogeneous fluorescence assay for PCR amplicons: its application to real-time, single-tube genotyping. Clin. Chem., 44, 918–923. [PubMed] [Google Scholar]
  • 14.Baron H., Fung,S., Aydin,A., Bahring,S., Luft,F.C. and Schuster,H. (1996) Oligonucleotide ligation assay (OLA) for the diagnosis of familial hypercholesterolemia. Nat. Biotechnol., 14, 1279–1282. [DOI] [PubMed] [Google Scholar]
  • 15.Iannone M.A., Taylor,J.D., Chen,J., Li,M.S., Rivers,P., Slentz-Kesler,K.A. and Weiner,M.P. (2000) Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry. Cytometry, 39, 131–140. [PubMed] [Google Scholar]
  • 16.Cai H., White,P.S., Torney,D., Deshpande,A., Wang,Z., Keller,R.A., Marrone,B. and Nolan,J.P. (2000) Flow cytometry-based minisequencing: a new platform for high-throughput single-nucleotide polymorphism scoring. Genomics, 66, 135–143. [DOI] [PubMed] [Google Scholar]
  • 17.Hoogendoorn B., Owen,M.J., Oefner,P.J., Williams,N., Austin,J. and O’Donovan,M.C. (1999) Genotyping single nucleotide polymorphisms by primer extension and high performance liquid chromatography. Hum. Genet., 104, 89–93. [DOI] [PubMed] [Google Scholar]
  • 18.Pastinen T., Raitio,M., Lindroos,K., Tainola,P., Peltonen,L. and Syvanen,A.C. (2000) A system for specific, high-throughput genotyping by allele-specific primer extension on microarrays. Genome Res., 10, 1031–1042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Boon E.M., Ceres,D.M., Drummond,T.G., Hill,M.G. and Barton,J.K. (2000) Mutation detection by electrocatalysis at DNA-modified electrodes. Nat. Biotechnol., 18, 1096–1100. [DOI] [PubMed] [Google Scholar]
  • 20.Chen X., Levine,L. and Kwok,P.Y. (1999) Fluorescence polarization in homogeneous nucleic acid analysis. Genome Res., 9, 492–498. [PMC free article] [PubMed] [Google Scholar]
  • 21.Fan J.B., Chen,X., Halushka,M.K., Berno,A., Huang,X., Ryder,T., Lipshutz,R.J., Lockhart,D.J. and Chakravarti,A. (2000) Parallel genotyping of human SNPs using generic high-density oligonucleotide tag arrays. Genome Res., 10, 853–860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gilles P.N., Wu,D.J., Foster,C.B., Dillon,P.J. and Chanock,S.J. (1999) Single nucleotide polymorphic discrimination by an electronic dot blot assay on semiconductor microchips. Nat. Biotechnol., 17, 365–370. [DOI] [PubMed] [Google Scholar]
  • 23.Fei Z. and Smith,L.M. (2000) Analysis of single nucleotide polymorphisms by primer extension and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Rapid Commun. Mass. Spectrom., 14, 950–959. [DOI] [PubMed] [Google Scholar]
  • 24.Sauer S., Lechner,D., Berlin,K., Lehrach,H., Escary,J.L., Fox,N. and Gut,I.G. (2000) A novel procedure for efficient genotyping of single nucleotide polymorphisms. Nucleic Acids Res., 28, e13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kwok P.Y. (2001) Methods for genotyping single nucleotide polymorphisms. Annu. Rev. Genomics Hum. Genet., 2, 235–258. [DOI] [PubMed] [Google Scholar]
  • 26.Bruchez M. Jr, Moronne,M., Gin,P., Weiss,S. and Alivisatos,A.P. (1998) Semiconductor nanocrystals as fluorescent biological labels. Science, 281, 2013–2016. [DOI] [PubMed] [Google Scholar]
  • 27.Dabbousi B.O., Rodriguez-Viejo,J., Mikulec,F.V., Heine,J.R., Mattoussi,H., Ober,R., Jensen,K.F. and Bawendi,M.G. (1997) (CdSe)ZnS core-shell quantum dots: synthesis and characterization of a size series of highly luminscent nanocrystallites. J. Phys. Chem., 101, 9463–9475. [Google Scholar]
  • 28.Hines M.A. and Guyot-Sionnest,P. (1996) Synthesis and characterization of strongly luminescing ZnS-capped CdSe nanocrystals J. Phys. Chem., 100, 468–471. [Google Scholar]
  • 29.Chan W.C. and Nie,S. (1998) Quantum dot bioconjugates for ultrasensitive nonisotopic detection. Science, 281, 2016–2018. [DOI] [PubMed] [Google Scholar]
  • 30.Wu X., Liu,H., Liu,J., Haley,K.N., Treadway,J.A., Larson,J.P., Ge,N., Peale,F. and Bruchez,M.P. (2003) Immunofluorescent labeling of cancer marker Her2 and other cellular targets with semiconductor quantum dots. Nat. Biotechnol., 21, 41–46. [DOI] [PubMed] [Google Scholar]
  • 31.Han M., Gao,X., Su,J.Z. and Nie,S. (2001) Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules. Nat. Biotechnol., 19, 631–635. [DOI] [PubMed] [Google Scholar]
  • 32.Omura T. (1999) Forty years of cytochrome P450. Biochem. Biophys. Res. Commun., 266, 690–698. [DOI] [PubMed] [Google Scholar]
  • 33.Armstrong B., Stewart,M. and Mazumder,A. (2000) Suspension arrays for high throughput, multiplexed single nucleotide polymorphism genotyping. Cytometry, 40, 102–108. [PubMed] [Google Scholar]
  • 34.Taylor J.D., Briley,D., Nguyen,Q., Long,K., Iannone,M.A., Li,M.S., Ye,F., Afshari,A., Lai,E., Wagner,M. et al. (2001) Flow cytometric platform for high-throughput single nucleotide polymorphism analysis. Biotechniques, 30, 661–669. [DOI] [PubMed] [Google Scholar]
  • 35.Wu P., Xu,H., Sha,M., Wong,E., Treadway,J., Yong,H., Xu,Y., Wang,E., Chin,R., Jin,J. et al. (2002) A multiplex assay platform using microparticles encoded with quantum dots. 8th Annual Conference and Exhibition, September 22–26, 2002, The Society for Biomolecular Screening, Poster Presentation, The Hague, The Netherlands.

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES