A New d,l-Endopeptidase Gene Product, YojL (Renamed CwlS), Plays a Role in Cell Separation with LytE and LytF in Bacillus subtilis

Abstract

A new peptidoglycan hydrolase, Bacillus subtilis YojL (cell wall-lytic enzyme associated with cell separation, renamed CwlS), exhibits high amino acid sequence similarity to LytE (CwlF) and LytF (CwlE), which are associated with cell separation. The N-terminal region of CwlS has four tandem repeat regions (LysM repeats) predicted to be a peptidoglycan-binding module. The C-terminal region exhibits high similarity to the cell wall hydrolase domains of LytE and LytF at their C-terminal ends. The C-terminal region of CwlS produced in Escherichia coli could hydrolyze the linkage of d-γ-glutamyl-meso-diaminopimelic acid in the cell wall of B. subtilis, suggesting that CwlS is a d,l-endopeptidase. β-Galactosidase fusion experiments and Northern hybridization analysis suggested that the cwlS gene is transcribed during the late vegetative and early stationary phases. A cwlS mutant exhibited a cell shape similar to that of the wild type; however, a lytE lytF cwlS triple mutant exhibited aggregated microfiber formation. Moreover, immunofluorescence microscopy showed that FLAG-tagged CwlS was localized at cell separation sites and cell poles during the late vegetative phase. The localization sites are similar to those of LytF and LytE, indicating that CwlS is involved in cell separation with LytF and LytE. These specific localizations may be dependent on the LysM repeats in their N-terminal domains. The roles of CwlS, LytF, and LytE in cell separation are discussed.

A gram-positive bacterium, Bacillus subtilis, produces several peptidoglycan hydrolases during the vegetative phase (7, 28). So far, several hydrolases, such as LytC (CwlB), LytD (CwlG), LytG (YubE), LytE (CwlF), and LytF (CwlE), have been found to affect the cell morphology of B. subtilis (2, 7, 13, 14, 21, 23).

LytC, identified as an N-acetylmuramoyl-l-alanine amidase (16), and LytD, identified as an N-acetylglucosaminidase (20, 24), are well-known major cell wall-lytic enzymes. The lytC gene is cotranscribed as the lytABC operon by Eσ^A RNA polymerase (σ^A, housekeeping sigma factor) and Eσ^D RNA polymerase (σ^D, sigma factor mainly associated with flagellar motility and chemotaxis during the mid and late vegetative phases) (17, 18). lytD is transcribed by Eσ^D RNA polymerase (20, 24). Since the cell shape of a lytC lytD double mutant comprises a long chain under conditions of gentle shaking (35 or 45 rpm) (2), both enzymes are involved in cell separation. Recently a vegetative cell wall hydrolase, LytG (YubE), was also reported to be associated with cell separation, lysis, and motility in swarm plates (13).

Previously, our group reported that LytE and LytF affect cell separation in B. subtilis (14, 23). The lytE gene is transcribed by Eσ^A RNA polymerase and Eσ^H RNA polymerase (σ^H, sigma factor during the late vegetative and early stationary phases) (14). On the other hand, lytF is transcribed by Eσ^D RNA polymerase (23). The cell shapes of lytE-deficient and lytF-deficient mutants are slightly longer chain forms and slightly filamentous forms compared with that of the wild-type strain, respectively (14, 23). Interestingly, a lytE lytF double mutant forms extremely long chains (while being shaken at 120 strokes/min) (23). Moreover, our group recently showed that LytE and LytF are localized at cell separation sites and cell poles in the vegetative phase (33). These results indicate that LytE and LytF are localized at these sites in order to function in cell separation.

The cell separation enzymes LytE and LytF consist of two domains, i.e., N- and C-terminal domains (Fig. 1). The C-terminal domains of LytE and LytF have been predicted to be or have been identified as d,l-endopeptidases (NlpC/P60 family; Pfam database [http://www.sanger.ac.uk/]). The N-terminal domains of LytE and LytF have three and five repeats of the LysM motif, respectively, that is predicted to be a general peptidoglycan binding module (Pfam database). It is assumed that these N-terminal domains containing LysM repeats are important for localization of cell wall hydrolases at cell separation sites and cell poles in B. subtilis.

FIG. 1.

Domain structures of LytE, CwlS, and LytF in B. subtilis. The numbers just above each diagram indicate the positions of the amino acid residues of the proteins with respect to the N-terminal amino acid residue. Black boxes denote the putative signal sequences on the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/). Dark boxes and white boxes containing arrows denote the NlpC/P60 domain related to endopeptidase and the LysM repeats that may have a peptidoglycan binding function, in the Pfam database (http://www.sanger.ac.uk/Software/Pfam/), respectively. The light gray boxes denote serine-rich regions. The percentages, 68.3% and 75.2%, indicate the similarities between LytE and CwlS and between LytF and CwlS in the BLAST software program, respectively.

Since the LysM motif was assumed to be important for cell separation, we investigated with the Pfam database whether 35 definite and probable peptidoglycan hydrolase genes in B. subtilis mentioned by Smith et al. (28) have LysM repeats. As a result, six genes products (YojL [renamed CwlS], YpbE, XylA, XylB, YdhD, and YocH), in addition to LytE and LytF, have this motif. Among these gene products, we focused on CwlS as a candidate for the third cell separation enzyme because CwlS has domains similar to LytE and LytF peptidoglycan hydrolases. The N-terminal domain of CwlS has four repeats of the LysM motif, and the C-terminal domain has a predicted endopeptidase classified in the NlpC/P60 family (Pfam database).

In this study, we identified cwlS (yojL) as a new peptidoglycan hydrolase gene that is expressed during the late vegetative and early stationary phases. Moreover, we found that CwlS is a d,l-endopeptidase that cleaves the linkage of d-γ-glutamyl-meso-diaminopimelic acid of the B. subtilis cell wall and that is localized at cell separation sites and cell poles. Furthermore, we compared the roles of CwlS, LytE (CwlF), and LytF (CwlE) in cell separation.

MATERIALS AND METHODS

Bacterial strains and plasmids.

The strains of B. subtilis and Escherichia coli used in this study are listed in Table 1. The primers used in this study are listed in Table 2. E. coli was grown on Luria-Bertani (LB) agar medium (25) at 37°C and then inoculated into LB medium. B. subtilis was grown on LB agar medium at 37°C and then inoculated into LB medium. For Northern and LacZ activity analyses, B. subtilis was grown on LB agar plates and then inoculated onto nutrient agar plates (nutrient medium [8 g/liter Bacto Nutrient Broth, 0.12 g/liter MgSO₄ · 7H₂O, 1 g/liter KCl, pH 7.0 to 7.2] containing 15 g/liter agar), followed by incubation at 30°C. The cells were then transferred to DSM (Schaeffer) medium [nutrient medium containing 1 mM Ca(NO₃)₂, 10 μM MnCl₂, and 1 μM FeSO₄ (26)] and then cultured while being shaken at 37°C. If necessary, ampicillin was added to E. coli cultures to a final concentration of 50 or 100 μg/ml and erythromycin, kanamycin, chloramphenicol, and spectinomycin were added to B. subtilis cultures to final concentrations of 0.3 μg/ml, 5 μg/ml, 3 or 5 μg/ml, and 50 μg/ml, respectively.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Genotype	Source or reference
B. subtilis strains
168	trpC2	D. Ehrlich
YOJLd	trpC2 cwlS (yojL)::pMT3-YOJL	pMT3-YOJL→168
YOJLp	trpC2 cwlS::pM4SDΔojL	pM4SDΔojL→168
FKD	trpC2 lytE (cwlF)::kan	Linearized pGMcFKm→168
ESD	trpC2 lytF (cwlE)::spc	Linearized pUCESPC→168
ESFKD	trpC2 lytF (cwlE)::spc lytE (cwlF)::kan	FKD ch.a→ESD
EFKYOJLp	trpC2 lytF (cwlE)::spc lytE (cwlF)::kan cwlS::pM4SDΔojL	YOJLp ch.→ESFKD
WE1	trpC2 wprA::kan epr::tet	33
OJL3FL	trpC2 cwlS::pCA3FLojL	pCA3FLojL→168
WE1OJL3FL	trpC2 wprA::kan epr::tet cwlS::pCA3FLojL	pCA3FLojL→WE1
EFOJL3FLp	trpC2 lytF (cwlE)::spc lytE (cwlF)::kan cwlS::Pspac-cwlS-3xFLAG	OJL3FL ch.→EFKYOJLp
BKD	trpC2 lytC (cwlB)::kan	32
E. coli strains
JM109	recA1 Δ(lac-proAB) endA1 gyrA96 thi-1 hsdR17 relA1 supE44 [F′ traD36 proAB+lacIqlacZ ΔM15]	Takara
C600	supE44 hsdR17 thi-1 thr-1 leuB6 lacY1 tonA21	Laboratory stock
Plasmids
pMUTINT3	bla erm lacZ lacI	22
pMUTIN4	bla erm lacZ lacI	D. Ehrlich
pBluescriptII(SK+)	bla ΔlacZ	Stratagene
pGEM3Zf(+)	bla ΔlacZ	Promega
pUC119	bla ΔlacZ	Takara
pDG780	bla kan	BGSCb
pDG1726	bla spc	BGSC
pQE-30	bla	QIAGEN
pCA3xFLAG	bla cat 3xFLAG	N. Ogasawara and K. Kobayashi
pMT3-YOJL	pMUTINT3::ΔcwlS (yojL)	K. Asai
pBLSDΔojL	pBluescriptII(SK+)::ΔcwlS (containing SD sequence of cwlS)	This study
pM4SDΔojL	pMUTIN4::ΔcwlS (containing SD sequence of cwlS)	This study
pGEMΔPCwlF	pGEM3Zf(+)::ΔlytE (cwlF)	This study
pGMcFKm	pGEMΔPCwlF::kan	This study
pUCE-BS	pUC119::ΔlytF (cwlE)	This study
pUCESPC	pUCE-BS::spc	This study
PQEOJL	pQE-30::ΔcwlS (C-terminal domain)	This study
pCA3FLojL	bla cat ΔcwlS-3xFLAG	This study

^ach., chromosomal DNA.

^bBGSC, Bacillus Genetic Stock Center, Ohio State University.

TABLE 2.

Primers used in this study

Primer	Sequence (5′→3′)a	Restriction site
YOJL-F	aagaagcTTG16TAGCCGGCTTGGCTG	HindIII
YOJL-R	ggaggatcCT199TTGTCCGACATAAAGC	BamHI
yojL-SD	gccgaagcttC−20AGTTTAGGAGGTTGAATG	HindIII
PCWLF-FB	gccgggatccC76AAAGCATTAAGGTGAAAAAAG	BamHI
CWLF-XR	gcgctctagaG1002AATCTTTTCGCACCGAG	XbaI
BF-CWLE	gcgcggatccG943ATTCCTTATGGGTGATTGC	BamHI
cESD-SpR	gcgcgcatgcC1529ATCAACGTCTTTAGGCT	SphI
BF-YOJL	gcgcggatccT871CAAACATTCAAATAGGTTCG	BamHI
KR-YOJL	gcgcggtaccG1306GTCAATCATTGTCTGGTA	KpnI
yojL-CHF	gcgcaagcttG967GTTTTGATTGCAGCGGC	HindIII
yojL-CBR	gcgcggatccA1242AAATAACTTCTTGCGCCC	BamHI
PM-FK	cggggtaccGTGTGGAATTGTGAGCG	KpnI
PM-T7	TAATACGACTCACTATATAGTGTATCAACAA GCTGG

^aUnderlining and lowercase letters indicate a restriction enzyme site and a tag sequence, respectively. Normal, underlined, and bold numbers represent the translational start codons of cwlS, lytE, and lytF, respectively. Bold letters show the promoter regions of T7 DNA polymerase.

Construction of plasmids to produce a cwlS (yojL)-deficient mutant.

To construct a cwlS-deficient mutant, a part of the cwlS gene was amplified with forward primer YOJL-F and reverse primer YOJL-R with B. subtilis 168 DNA as a template. The amplified fragment was digested with HindIII and BamHI and then ligated to the corresponding sites of pMUTINT3 (22), resulting in pMT3-YOJL. The plasmid from E. coli C600(pMT3-YOJL) was used for transformation of B. subtilis 168 (wild type) to obtain strain YOJLd (cwlS::pMT3-YOJL) through Campbell-type recombination. Proper integration of this plasmid was confirmed by PCR.

Construction of a strain containing isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible cwlS (yojL).

To construct a strain containing an IPTG-inducible cwlS gene, a fragment containing a Shine-Dalgarno (SD) sequence and the 5′ end of cwlS was amplified by PCR with forward primer yojL-SD and reverse primer YOJL-R and with B. subtilis 168 DNA as a template. The PCR fragment was blunt ended and phosphorylated with a BKL kit (Takara), and then the fragment was ligated to EcoRV-digested pBluescriptII(SK+), followed by dephosphorylation, resulting in pBLSDΔojL. The pBLSDΔojL plasmid was further digested with HindIII and BamHI, and then the HindIII-BamHI fragment containing the SD sequence and 5′ end of cwlS was ligated into the corresponding site of pMUTIN4, resulting in pM4SDΔojL. The plasmid from E. coli C600(pM4SDΔojL) was used for transformation of B. subtilis 168 (wild type) to obtain strain YOJLp (cwlS::pM4ΔSDojL) through Campbell-type recombination. The resulting strain, YOJLp, contains all of cwlS, which is regulated by the spac promoter. Proper integration of the plasmid was confirmed by PCR with various primers.

Construction of various autolysin-deficient mutants.

To construct a lytE (cwlF)-deficient mutant, FKD, a truncated lytE fragment was prepared by PCR with forward primer PCWLF-FB and reverse primer CWLF-XR and with B. subtilis 168 DNA as a template. The PCR fragment was digested with BamHI and XbaI, and then the fragment was ligated to BamHI- and XbaI-digested pGEM3Zf(+), resulting in pGEMΔPCwlF. A plasmid, pDG780, containing a kanamycin resistance cassette was digested with HincII and SmaI, and then the HincII-SmaI fragment containing this cassette was ligated to HincII-digested pGEMΔPCwlF, followed by dephosphorylation, resulting in pGMcFKm. pGMcFKm was linearized with AatII, followed by transformation of B. subtilis 168. The resulting strain, FKD (lytE::kan), was a double-crossover recombinant with disruption of the lytE gene.

To construct a lytF (cwlE)-deficient mutant, ESD, a truncated lytF fragment was prepared by PCR with forward primer BF-CWLE and reverse primer cESD-SpR and with B. subtilis 168 DNA as a template. The PCR fragment was digested with BamHI and SphI, and then the fragment was ligated into the corresponding site of pUC119, resulting in pUCE-BS. pDG1726 containing an Spc (spectinomycin) resistance cassette was digested with PstI, and then the digested fragment containing the Spc resistance cassette was ligated into a PstI-digested pUCE-BS plasmid, followed by dephosphorylation, resulting in pUCESPC. pUCESPC was linearized with ScaI, followed by transformation of B. subtilis 168. The resulting strain, ESD (lytF::spc), was a double-crossover recombinant with disruption of the lytF gene.

A lytE lytF double mutant (ESFKD) and a lytE lytF cwlS (yojL) triple mutant (EFKYOJLp) were constructed by transformation of the ESD mutant with FKD DNA and of the ESFKD mutant with YOJLp DNA, respectively. Proper integration of these plasmids was confirmed by PCR.

Construction of pQEOJL for overexpression of the h-ΔCwlS protein (C terminus of CwlS with a histidine tag fused at its N terminus).

To construct pQEOJL for overexpression of h-ΔCwlS, a truncated cwlS fragment was prepared by PCR with forward primer BF-YOJL and reverse primer KR-YOJL and with B. subtilis 168 DNA as a template. The PCR fragment was digested with BamHI and KpnI, and then the fragment was ligated into the corresponding site of pQE-30, resulting in pQEOJL. pQEOJL was used for the production of h-ΔCwlS, which is the C-terminal domain of CwlS with a histidine tag at its N terminus.

Construction of 3 × FLAG fusion strains.

To construct cwlS-3xFLAG fusion strains (cwlS with a 3 × FLAG epitope tag fused at its C terminus), a truncated cwlS fragment was prepared by PCR with forward primer yojL-CHF and reverse primer yojL-CBR and with B. subtilis 168 DNA as a template. The PCR fragment was digested with HindIII and BamHI, and then the fragment was ligated into the corresponding site of pCA3xFLAG, resulting in pCA3FLojL. The plasmid from E. coli C600(pCA3FLojL) was used for transformation of B. subtilis 168 and WE1 (wprA epr) to obtain the OJL3FL (cwlS::pCA3FLojL) and WE1OJL3FL (cwlS::pCA3FLojL wprA::kan epr::tet) strains, respectively, through Campbell-type recombination. Proper integration of this plasmid was confirmed by PCR. Both strains have a 3 × FLAG epitope tag (DYKDHDGDYKDHDIDYKDDDDK) at the C terminus of cwlS.

Phenocopy test of CwlS-3xFLAG.

To confirm that a CwlS-3xFLAG fusion protein (CwlS with a 3 × FLAG tag fused at its C terminus) can retain the same function as the original CwlS protein, B. subtilis EFKYOJLp (lytE::kan lytF::spc P_spac-cwlS) was transformed with OJL3FL chromosomal DNA, resulting in EFOJL3FLp (lytE::kan lytF::spc P_spac-cwlS-3xFLAG). Proper integration was checked by means of PCR and antibiotic resistance.

All constructed plasmids were confirmed by sequencing with a DNA sequencer (Applied Biosystems 373A or 310).

Transformation of E. coli and B. subtilis.

E. coli transformation was performed as described by Sambrook et al. (25), and B. subtilis transformation was performed by the competent-cell method (1).

Northern blotting analysis.

B. subtilis cells were incubated in DSM medium. Harvesting of the cells and preparation of RNA were performed as described by Fukushima et al. (8, 10). Agarose-formaldehyde gel electrophoresis of RNA was performed as described by Sambrook et al. (25). Transfer of RNAs onto a nylon membrane (Magnagraph; Micron Separations) was performed with a vacuum blotter (BE-600; Biocraft). A DNA fragment containing cwlS was prepared by PCR with the PM-FK and PM-T7 primers and with pMT3-YOJL as a template. The amplified fragment was digested with HindIII, and then the resulting fragment was purified by phenol and chloroform treatment, followed by ethanol precipitation. The RNA probe was prepared with a digoxigenin RNA labeling kit (Roche) and the fragment. Northern hybridization was performed according to the manufacturer's instructions.

β-Galactosidase assay.

The β-galactosidase assay was performed as described by Shimotsu and Henner (27). One unit of β-galactosidase activity was defined as the amount of enzyme necessary to release 1 nmol of 2-nitrophenol from o-nitrophenyl-β-d-galactopyranoside in 1 min.

Preparation of B. subtilis ATCC 6633 cell wall.

Cell wall derived from B. subtilis ATCC 6633 (Sigma) was prepared as described previously (6, 23).

SDS-PAGE and zymography.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described by Sambrook et al. (25). Zymography was performed as described by Leclerc and Asselin (19), with an SDS-polyacrylamide gel containing 0.5 mg/ml purified B. subtilis ATCC 6633 cell wall as a substrate for cell wall hydrolases. Renaturation was performed at 37°C with renaturation buffer (25 mM Tris-HCl [pH 7.2], 1% [vol/vol] Triton X-100).

Purification of h-ΔCwlS, which contains the C-terminal domain of CwlS.

The h-ΔCwlS protein, the C-terminal domain of CwlS (from amino acid [aa] 291 to aa 414 of CwlS) with a six-histidine tag fused at its N terminus, was overexpressed in E. coli and then purified as follows. E. coli JM109(pQEOJL) was incubated in LB medium containing 100 μg/ml ampicillin at 37°C. At an optical density at 600 nm (OD₆₀₀) of 1.0, 1 mM IPTG was added to the culture. After 2 h of incubation, the cells were harvested by centrifugation and suspended in 10 mM imidazole NPB buffer (10 mM imidazole, 1 M NaCl, 20 mM sodium phosphate [pH 7.4]). Purification of h-ΔCwlS was performed basically as described previously (32), with a HiTrap chelating column (1 ml of resin; Amersham Biosciences), and the fractions were eluted with a stepwise gradient of 100 to 300 mM imidazole solutions (100 to 300 mM imidazole, 1 M NaCl, 20 mM sodium phosphate [pH 7.4]). A fraction eluted with 200 mM imidazole solution was used for determination of h-CwlS enzyme activity.

Determination of the optimum pH, temperature, and NaCl concentration of h-ΔCwlS.

Determination of the optimum pH of h-ΔCwlS was performed as described by Ohnishi et al. (23). The following buffers (50 mM) and 0.33 mg/ml B. subtilis ATCC 6633 cell wall were used at 37°C: citrate buffer for pHs 4.0, 4.5, and 5.0; Good's buffer for pHs 6.0, 6.5, 7.0, 7.5, 8.0, 9.0, and 10.0. To determine the optimum temperature, 50 mM MOPS (3-morpholinopropanesulfonic acid)-NaOH buffer (pH 7.0) without NaCl and 0.33 mg/ml cell wall were used. For determination of the optimum NaCl concentration, the reaction was performed at 40°C with 50 mM MOPS-NaOH buffer (pH 7.0) containing 0.33 mg/ml cell wall. For all experiments, purified h-ΔCwlS was added to the cell wall mixture to a final concentration of 5 μg/ml. The OD₅₄₀ of the cell wall was measured with a spectrophotometer (V-560; JASCO), and then the data were analyzed with the Spectra Manager (JASCO) and Excel software. One unit of hydrolase activity was defined as the amount of enzyme necessary to decrease the absorbance at 540 nm by 0.001 in 1 min (23).

Determination of the cleavage sites of cell wall peptidoglycan.

In order to determine the cleavage sites for h-ΔCwlS, purified B. subtilis cell wall (3.3 mg) and purified h-ΔCwlS (0.5 mg) were added to 10 ml of MOPS-NaOH buffer (pH 7.0) containing 25 mM NaCl, and then the enzyme reaction was performed at 37°C, followed by sampling at 0 and 60 min after the reaction. (For the sample at 0 min, h-ΔCwlS was added to the sample and then immediately the sample was kept on ice in order to stop the reaction as soon as possible.). After boiling of the samples for 10 min to completely stop the reaction, they were centrifuged and then the supernatants were collected. In order to label free amino groups with 1-fluoro-2,4-dinitrobenzene (FDNB), 30 μl of supernatant and 470 μl of 1.06% K₂B₄O₇ (pH 9.0) were mixed with 1 M FDNB and then labeling was performed for 30 min at 60°C in the dark. The samples were hydrolyzed with 3 M HCl for 12 h at 95 to 100°C in order to digest glycosidic and peptide bonds of the cell wall (23). The hydrolyzed samples were dried under vacuum and then resuspended in 100 μl of 10% acetonitrile containing 0.025% trifluoroacetic acid (TFA). A half volume (50 μl) of each sample was separated by reverse-phase (RP) high-performance liquid chromatography (HPLC) on a Wakosil-II 5C18 column (Wako; flow rate, 0.5 ml/min; monitoring wavelength, 365 nm; Shimadzu LC10AD HPLC system) (23). Elution buffers A and B comprised 0.025% TFA and a 0.025% TFA-60% CH₃CN solution, respectively. Elution was performed with a linear gradient of buffer B (from 0 to 100%) in 60 min at 40°C (column heater). In order to calculate the amount of non-cross-linked A₂pm (diaminopimelic acid) in the cell wall, purified B. subtilis cell wall (0.33 mg/ml) and lysozyme (0.1 mg/ml) were added to 10 ml of MOPS-NaOH buffer (pH 7.0) and then the enzyme reaction was allowed to proceed at 37°C for 12 h. The methods of labeling of FDNB and separation by RP-HPLC were the same as those used for the sample digested by CwlS as described above.

Separated peaks were dried, and then samples were used for identification by electrospray ionization-mass spectrometry (MS) as described by Fukushima et al. (9).

Preparation of cell surface proteins.

To prepare cell surface proteins, we used an extraction method involving LiCl as described previously (33). B. subtilis strains were incubated in LB medium at 37°C, and sampling was performed during the vegetative and stationary phases, followed by centrifugation of samples. Each pellet was washed with 25 mM Tris-HCl (pH 7.2) twice and then suspended in 3 M LiCl containing 25 mM Tris-HCl (pH 7.2), followed by incubation at 20 min on ice in order to remove cell surface proteins from the cell wall. After centrifugation of a sample, proteins in the supernatant were purified by trichloroacetic acid precipitation as described by Yamamoto et al. (33). Purified samples were analyzed by SDS-PAGE and zymography (see above).

Preparation of samples for immunofluorescence measurement and phase-contrast and fluorescence microscopy.

The samples for immunofluorescence measurement were referred as described by Yamamoto et al. (33). B. subtilis strains were incubated at 37°C, and then equivalent amounts of cells (OD₆₀₀, 0.3) were harvested and fixed with 4.4% (wt/vol, final concentration) paraformaldehyde containing 30 mM Na₂HPO₄ and 30 mM NaH₂PO₄ (pH 7.0) for 20 min on ice. After washing of the cells with phosphate-buffered saline (PBS; 80 mM Na₂HPO₄, 20 mM NaH₂PO₄, 100 mM NaCl, pH 7.5), they were suspended in 500 μl of PBS containing 2% (wt/vol) bovine serum albumin (BSA-PBS) and then the mixture was incubated at 4°C for 20 min (blocking). The cells were suspended in 400 μl of BSA-PBS containing 4 μg/ml mouse anti-FLAG M2 monoclonal antibody (Sigma) and then incubated at 4°C for 1 h (primary antigen-antibody reaction). After washing of the cells, they were suspended in 400 μl of BSA-PBS containing a 1:400 dilution of fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin G antibodies (Sigma) and then incubated at 4°C for 1 h (secondary antigen-antibody reaction). The following treatments (preparation of immunofluorescence samples and mounting on slides) were described previously (33). Phase-contrast and fluorescence microscopy of cells was performed as described previously (11, 33).

Western blotting.

For Western blotting, cell surface proteins were separated by SDS-12% PAGE. After separation, the proteins were transferred to a polyvinylidene difluoride membrane (Amersham Bioscience) in transfer buffer (25 mM Tris-HCl [pH 8.3], 192 mM glycine, 20% [vol/vol] methanol, 0.1% [wt/vol] SDS) with a semidry blotting system (Bio-Rad). For immunoblotting and immunodetection, the instruction manual for the ECL plus Western blotting detection system (Amersham Biosciences) was referred to. The membrane was incubated for 1 h in a blocking buffer (25 mM Tris-HCl [pH 7.6], 14 mM NaCl; TBS buffer) containing 5% skim milk. The membrane was incubated for 1 h in mouse anti-FLAG M2 monoclonal antibody (Sigma) diluted 1:10,000 with TBS containing 0.3% (vol/vol) Tween 20 as the primary antibody. Horseradish peroxidase-linked whole sheep antibodies (Amersham Biosciences) diluted 1:10,000 with TBS-0.3% (vol/vol) Tween 20 were then used as the secondary antibodies (1 h of incubation). For immunodetection, the ECL plus Western blotting detection system was used.

RESULTS

Amino acid sequence of CwlS.

It is thought that the N-terminal 26-amino-acid sequence of CwlS comprises a signal peptide because there is a positively charged amino acid, lysine, at positions 2 to 4, a hydrophobic region from positions 5 to 23, and a typical signal peptide cleavage site, A₂₄EA₂₆ ↓ (the arrow indicates the cleavage point). Thus, it is predicted that CwlS is a secreted protein. CwlS has four LysM repeats related to peptidoglycan binding at its N terminus and an NlpC/P60 family region that corresponds to an endopeptidase domain at its C terminus (Fig. 1).

Transcriptional analysis of cwlS.

To determine the period of expression of cwlS, we constructed a cwlS-lacZ gene fusion strain, YOJLd. Figure 2B shows the β-galactosidase activity of this strain. The activity increased from the mid-vegetative phase, became maximal at t₀ (onset of sporulation), and then decreased in the stationary phase. Moreover, Northern blotting was performed with an RNA probe containing a part of the cwlS gene. As a result, hybridizing bands were detected around 1.3 kb from t₋₁ (Fig. 2C). Because the calculated size of cwlS is 1.24 kb and there are two rho-independent terminators upstream and downstream of cwlS, this transcript size (1.3 kb) is reasonable. These results indicate that cwlS is solely transcribed from the mid-vegetative phase to the early stationary phase.

FIG. 2.

(A) Map of cwlS and the neighboring genes of B. subtilis. yojK (similar to glycosyltransferase) and yojM (putative superoxide dismutase) are upstream and downstream of cwlS, respectively. Stem-loop structures T1 and T2 are putative rho-independent terminators (ΔG = −27.2 kcal/mol and −18.1 kcal/mol, respectively). The arrow indicates the position of cwlS mRNA. (B) Cell growth and β-galactosidase activity of the cwlS-lacZ transcriptional fusion strain. Open and closed symbols indicate cell growth at 600 nm and β-galactosidase activity, respectively. The time (x axis) indicates x hours after the onset of sporulation. Triangles, B. subtilis 168 (wild type); squares, YOJLd (cwlS::pMT3-YOJL). (C) Northern blotting analysis with a cwlS RNA probe. t_−x indicates x hours before the onset of sporulation. Ten micrograms of each RNA was separated on a 1% formaldehyde-agarose gel. The arrow indicates the calculated size of the detected cwlS mRNA.

Characterization of the C-terminal region of CwlS.

It is predicted that CwlS is a cell wall hydrolase because it has an endopeptidase domain at its C terminus (Fig. 1). In order to confirm that CwlS is a cell wall hydrolase, the C-terminal region of CwlS (from aa 291 to aa 414), which had a six-His tag fused at its N terminus (h-ΔCwlS), was overexpressed in E. coli. This protein was purified on a HiTrap chelating column. Figure 3 shows the results of SDS-PAGE and zymography with h-ΔCwlS. Purified h-ΔCwlS gave a band on SDS-PAGE corresponding to around 14 kDa (Fig. 3, lane 3), which corresponds to the cell wall-hydrolyzing band observed on zymography (Fig. 3, lane 4). Since the molecular mass of h-ΔCwlS is 15.1 kDa, this result also supports the idea that the band containing cell wall-hydrolyzing activity represents h-ΔCwlS.

FIG. 3.

SDS-16% PAGE and zymography of h-ΔCwlS. h-ΔCwlS was overexpressed in E. coli JM109(pQEOJL) cells with 1 mM IPTG. Lanes 1 and 2, proteins extracted from whole cells (OD₆₀₀, 0.05) without and with 1 mM IPTG addition for 2 h, respectively; lane 3, purified h-ΔCwlS (2 μg); lane 4, zymography of purified h-ΔCwlS (2 μg) with 3 h of incubation at 37°C; lane M, protein molecular size standards (Bio-Rad). The arrow indicates the position of purified h-ΔCwlS.

Moreover, the enzymatic properties of the purified h-ΔCwlS protein were identified. As a result, The optimum pH ranged from 6 to 7 without NaCl at 37°C (specific activity, about 500 U/mg protein), the optimum temperature was 48°C in 50 mM MOPS-NaOH buffer (pH 7.0) without NaCl (720 U/mg protein), and the optimum NaCl concentration was 0.025 mM in 50 mM MOPS-NaOH buffer (pH 7.0) at 40°C (1,500 U/mg protein).

Determination of the cleavage site in peptidoglycan for h-ΔCwlS.

To determine the peptidoglycan cleavage site for h-ΔCwlS, purified cell wall of B. subtilis was digested with the purified h-ΔCwlS protein and then free amino groups of the digested sample were labeled with FDNB, followed by hydrolysis of glycoside and peptide linkages of the cell wall with HCl. Dinitrophenyl (DNP)-labeled amino acids were then separated by RP-HPLC. Figure 4 shows charts of DNP-labeled amino acids separated by RP-HPLC. As shown in Fig. 4, peak 1 (retention time, 28 min) and peak 5 (retention time, 53 min) increased greatly after digestion of the cell wall with h-ΔCwlS. MS analysis of the peak 1 and 5 materials in the negative mode revealed fragment ions at m/z 355.4 and 521.1, respectively. These values correspond to the [M-H]⁻ of mono-DNP-A₂pm (M_r, 356.1) and the [M-H]⁻ of bis-DNP-A₂pm (M_r, 522.1), respectively. On MS analysis of the other peak materials, the peak 2, 3, and 4 materials in the negative mode gave the same fragment ion at m/z 183.3. The value of these peaks corresponds to the [M-H]⁻ of DNP (M_r, 184.0).

FIG. 4.

Determination of the cleavage site of CwlS by RP-HPLC. The cell wall of B. subtilis ATCC 6633 was treated without (A) or with (B) h-ΔCwlS for 60 min. After free amino residues in the sample had been labeled with FDNB, it was hydrolyzed with HCl and then separated by RP-HPLC. Peak 1, mono-DNP-A2pm; peaks 2, 3, and 4, DNP; peak 5, bis-DNP-A2pm. Values are elution times in minutes. mAU, milliabsorbance unit.

It is possible that the detected mono-DNP-A₂pm is derived from free (non-cross-linked) A2pms because they have free amino acid groups in the cell wall (28) which can react with FDNB. The amount of mono-DNP-A₂pm in the cell wall then was measured after the cell wall (0.3 mg/ml) was completely digested with lysozyme (0.1 mg/ml) at 37°C for 12 h. As a result, 1 mg of cell wall had 189 nmol of mono-DNP-A₂pm (bis-DNP-A₂pm was never detected). Moreover, the amounts of mono-DNP-A₂pm (peak1) and bis-DNP-A₂pm (peak 5) were measured after digestion of the cell wall with h-ΔCwlS for 1 h (Fig. 4B). As a result, 250 nmol/mg cell wall and 71 nmol/mg cell wall of mono-DNP-A₂pm and bis-DNP-A₂pm were found, respectively. Thus, at least 61 nmol of mono-DNP-A₂pm and 71 nmol of bis-DNP-A₂pm were newly produced from 1 mg of cell wall by the cell wall hydrolysis activity of h-ΔCwlS, and these results indicate that h-ΔCwlS is a d-γ-glutamyl-meso-diaminopimelic acid endopeptidase.

Detection of the cwlS gene product in a cell surface extract of B. subtilis.

Because CwlS has putative cell wall binding domains, called LysM (Fig. 1), it is assumed that CwlS is localized on the cell surface. To confirm this possibility, cell surface proteins were extracted from cell walls of the B. subtilis 168, YOJLd (cwlS), and YOJLp (P_spac-cwlS) strains. As a result, the 40-kDa protein in the cell surface extract of the 168 strain was found to exhibit cell wall hydrolase activity (Fig. 5, lane 1), although this activity at the 40-kDa position was not detected in the cwlS-deficient strain, YOJLd (cwlS) (Fig. 5, lane 2, position d). Moreover, in the case of CwlS overexpressed by the YOJLp (P_spac-cwlS) strain, the band derived from CwlS could be clearly detected (Fig. 5, lane 3, position d). These results suggest that the 40-kDa protein is CwlS (388-amino-acid polypeptide without a putative signal peptide [M_r, 41.7 kDa]) and that it is localized on the cell surface.

FIG. 5.

Zymography of cell surface proteins extracted from the B. subtilis strains 168 (wild type), YOJLd (cwlS), and YOJLp (P_spac-cwlS). Electrophoresis was performed in an SDS-14% polyacrylamide gel containing 0.5 mg/ml B. subtilis cell wall as a substrate. Cells of all strains were harvested at an OD₆₀₀ of 2.7, and cell surface proteins were prepared as described in Materials and Methods. Proteins extracted from an equivalent amount of cells (OD₆₀₀, 8) were applied to each lane. Lanes 1 and 2, cell surface proteins of strains 168 and YOJLd (cwlS), respectively; lanes 3 and 4, cell surface proteins of strain YOJLp (P_spac-cwlS) with or without 1 mM IPTG, respectively; lane M, protein molecular size standards (Bio-Rad). The letters a to g indicate the positions of hydrolyzed bands. Bands a, d, and g represent LytF and LytC, CwlS, and LytE, respectively.

Cell morphology of a lytE lytF cwlS-deficient mutant.

As shown in Fig. 1 (domain structures of CwlS, LytE, and LytF) and Fig. 5 (localization of CwlS on the cell surface), it is possible that CwlS has a function similar to that of LytE and LytF. LytE and LytF are associated with cell separation and localized on the cell surface (cell separation sites and cell poles) (23, 33). Therefore, we determined the cell morphology of a cwlS-deficient mutant. However, the cell shape was not significantly different from that of the wild type (data not shown).

Previously, we reported that a lytE lytF-deficient mutant exhibited cell aggregation and an extremely filamentous cell shape when it was shake cultured in a test tube at medium speed (120 strokes/min) (23). Therefore, it is predicted that the cell morphology of a lytE lytF cwlS-deficient mutant exhibits more aggregated and extreme microfiber formation than the lytE lytF mutant. We determined the cell morphology of the lytE lytF cwlS-deficient mutant (EFKYOJLp; lytE::km lytF::spc P_spac-cwlS). As shown in Fig. 6, this mutant without cwlS expression exhibited highly aggregated and extreme microfiber formation when it was shake cultured in a test tube at high speed (168 strokes/min). This result indicates that CwlS is associated with cell separation. Moreover, CwlS was overexpressed in EFKYOJLp with the addition of IPTG. As a result, the cell shape was the same as that of the wild type (Fig. 6). The expressed CwlS protein could play a role in a cellular function (cell separation) similar to those of LytE and LytF. Thus, these results strongly suggest that CwlS is a new cell separation enzyme in B. subtilis.

FIG. 6.

Cell morphology of B. subtilis 168 (wild-type), ESFKD (lytE lytF), and EFKYOJLp (lytE lytF P_spac-cwlS) under a phase-contrast microscope. Cells were incubated in 5 ml of LB medium with or without 1 mM IPTG at 37°C for 3 h (OD₆₀₀, 0.6). B. subtilis EFKYOJLp (without IPTG) cells exhibited extraordinary microfiber formation when shake cultured in a test tube (5 ml culture) at high speed (168 strokes/min). Bars, 5 μm.

Localization of CwlS by means of immunofluorescence.

In order to clearly determine the localization of CwlS, a CwlS-3xFLAG fusion protein was expressed and then the localization of this fusion protein was determined by immunofluorescence (Fig. 7). The CwlS-3xFLAG protein was localized at cell separation sites and cell poles in the OJL3FL strain (cwlS::cwlS-3xFLAG) (Fig. 7A). Moreover, we determined the localization with a protease-deficient mutant, WE1OJL3FL (cwlS::cwlS-3xFLAG wprA epr), because in a previous study, WprA and Epr were found to affect the stability and processing of cell surface proteins including LytF and LytE (33). As a result, the localization of CwlS-3xFLAG in the WE1OJL3FL strain was strongly detected at cell separation sites and cell poles compared with that in the OJL3FL strain (Fig. 7A).

FIG. 7.

(A) Immunofluorescence of CwlS-3xFLAG of B. subtilis OJL3FL (cwlS::cwlS-3xFLAG) and WE1OJL3FL (cwlS::cwlS-3xFLAG wprA epr). Both strains were incubated in LB medium at 37°C, and these pictures were taken at an OD₆₀₀ of 1.7. The exposure times were 0.1, 0.001, and 0.1 for phase-contrast, DAPI, and fluorescein isothiocyanate, respectively. Bars, 2 μm. (B) Western blotting of CwlS-3xFLAG of B. subtilis OJL3FL (lane 1) and WE1OJL3FL (lane 2). Both strains were grown in LB medium at 37°C. At an OD₆₀₀ of 2.0, cells were harvested and then cell surface proteins were extracted. The extracts of both strains (cell OD₆₀₀, 0.1) were separated on an SDS-12% polyacrylamide gel, followed by Western blotting as described in Materials and Methods. The molecular mass of a standard protein (Bio-Rad) is shown on the left.

To confirm that CwlS is more stable and/or less processed in the case of wprA epr deficiency, the total amount of CwlS-3xFLAG on the cell surface was determined by Western blotting. As shown in Fig. 7B, a band derived from the CwlS-3xFLAG fusion protein was detected at slightly less than 45 kDa (the molecular mass of CwlS-3xFLAG without the putative signal peptide is 44.8 kDa), and the total amount of the fusion protein in the wprA epr-deficient mutant was higher than that in the wprA⁺ epr⁺ strain (OJL3FL). Thus, it is suggested that CwlS is localized at cell separation sites and cell poles (Fig. 7A) and that this localization is affected by the WprA and/or Epr proteases (Fig. 7A and B). Moreover, these tendencies were completely the same as those in the cases of LytE and LytF (33).

Phenocopy test of CwlS-3xFLAG.

CwlS-3xFLAG was overexpressed in B. subtilis EFOJL3FLp (lytE lytF P_spac-cwlS-3xFLAG). If the overexpressed fusion protein can act as the original CwlS protein, the phenotype of the EFOJL3FLp strain with the overexpressed CwlS-3xFLAG protein should become rod shaped like the phenotype of the EFKYOJLp strain with overexpressed CwlS (Fig. 6, EFKYOJLp with 1 mM IPTG). As a result, the cells became rods—similar to those of the wild-type strain (Fig. 8). These results indicated that the function of CwlS-3xFLAG is the same as that of the original CwlS protein.

FIG. 8.

Phenocopy test of CwlS-3xFLAG with strain EFOJL3FLp (lytE lytF P_spac-cwlS-3xFLAG). Cells were incubated in 5 ml of LB medium with or without 1 mM IPTG at 37°C for 4 h (OD₆₀₀, 1.5). B. subtilis EFOJL3FLp cells (with IPTG) were rod shaped when shake cultured in a test tube at high speed (168 strokes/min). Bars, 2 μm.

Functional relationship among LytE, LytF, and CwlS.

It is clear that CwlS is associated with cell separation, in addition to LytE and LytF. Moreover, these three proteins have two domains, a LysM domain and a d,l-endopeptidase (NlpC/P60) domain. Since we are curious to know why B. subtilis has three similar functional lytic enzymes, we determined the cell wall hydrolase activities of cell surface proteins by zymography during the vegetative and stationary phases. As shown in Fig. 9, CwlS was active from the late vegetative phase (t_−0.5) to the stationary phase (t_3.5). On the other hand, LytE appears to be roughly constant from the vegetative phase (t_−1.5) to the stationary phase (t_3.5) and LytF also appears from the vegetative phase (t_−1.5) to the stationary phase (t_3.5). In particular, the activities of LytE and LytF were strongest in the late vegetative phase (t_−0.5) (Fig. 9). In this period, CwlS began to appear on the cell surface. Therefore, CwlS may facilitate cell separation caused by LytE and LytF. The timing of CwlS formation is very reasonable because the late vegetative phase is the time when the cell shape drastically changes from a chain to a rod. Thus, it is suggested that CwlS, LytE, and LytF share a role in cell separation with different timings of expression.

FIG. 9.

Zymography of cell surface proteins of B. subtilis BKD (lytC [cwlB]) during the vegetative and stationary phases. The strain was incubated in LB medium at 37°C. At several points, cells were harvested and cell surface proteins were extracted as described in Materials and Methods. The extracted proteins (OD₆₀₀, 10) were separated on an SDS-12% polyacrylamide gel (containing cell wall), followed by zymography. t₀ indicates the sampling time at the onset of the stationary phase. t_−x and t_x indicate x hours before and after t₀, respectively. Lane M, protein molecular size standards (Bio-Rad). The letters a to g indicate the positions of hydrolyzed bands. Bands a, d, and g represent LytF, CwlS, and LytE, respectively. The band positions were determined with reference to Fig. 5 and our previous article (23).

DISCUSSION

It is now clear that B. subtilis has three similar hydrolases associated with cell separation. As shown in Fig. 1, LytE, LytF, and CwlS have very similar domains; however, the difference among them is the number of LysM repeats. The number of repeats may be associated with tight binding to the cell wall. Therefore, the functions of the enzymes may differ slightly from each other. Another difference is the expression period. As shown in Fig. 2B and C, cwlS is transcribed from the mid-vegetative phase to the stationary phase. Recently, Britton et al. reported that cwlS (yojL) is transcribed by Eσ^H RNA polymerase (3). We determined the activities of LytE, LytF, and CwlS localized on the cell surface by zymography (Fig. 9). As a result, LytE appears to be roughly constant on the cell surface, LytF also appears at same period, and CwlS appears from the late vegetative phase to the stationary phase. This result indicates that these hydrolases share in the work of cell separation during the late vegetative and early stationary phases. In particular, because B. subtilis cells drastically change from a chain to a rod shape during the late vegetative phase, it is very likely that the cells need three cell separation hydrolases (LytE, LytF, and CwlS) to act together in the period.

The lytC (cwlB) lytD (cwlG)-deficient mutant forms long chains under the condition of gentle shaking (speed, 35 or 45 rpm) (2). Thus, LytC and LytD are candidates for cell separation enzymes. However, our previous study indicated that this mutant formed rods under the condition of medium speed (speed, 120 strokes/min) (23; data not shown). Moreover, not only the septa but also the cell walls of the mutant are thicker than those of the wild-type strain (2). Thus, LytC and LytD play a role not only in cell separation but also in the hydrolysis of whole cell walls. In other words, both enzymes act as cell wall hydrolases toward whole cell walls and should be called autolysins (self-digestive enzymes of the cell wall). As another candidate for a cell separation enzyme, a vegetative 32-kDa glucosaminidase (LytG) of B. subtilis is involved in cell lysis and motility on swarm plates (13). Moreover, lytC lytD lytG-deficient mutant cells make clumps when shaken at 40 rpm at 25°C (13). But LytG does not have LysM repeats (Pfam database). Since a lytG-deficient mutant shows various phenotypes and the shaking speed for clump formation is very slow (13), cell separation may not be a main function of LytG. On the other hand, LytE, LytF, and CwlS specifically function as cell wall hydrolases associated with cell separation because these proteins are localized at cell separation sites and cell poles (Fig. 7) (33), and the lytE lytF cwlS-deficient mutant exhibits extremely dense fiber formation at a high shaking speed (168 strokes/min) (Fig. 6). Interestingly, YOJLp, used for overexpression of CwlS, was not lysed and the growth curve was the same as that of the wild type (data not shown), even though CwlS was strongly overexpressed (see zymography in Fig. 5, lane 3). Usually, overexpression of a cell wall hydrolase leads to cell lysis because the hydrolase targets and digests the whole cell wall. From the result that overexpression of CwlS does not lyse cells, it is predicted that CwlS cannot target and/or digest the whole cell wall. Actually, since CwlS is localized at cell division sites and cell poles (Fig. 7A), it is strongly suggested that CwlS specifically functions as a cell separation enzyme.

What is the difference between major autolysins (LytC and LytD) and cell separation hydrolases (LytE, LytF, and CwlS)? The difference may be whether there are LysM repeats (a predicted general peptidoglycan binding module) or not. Recently, some papers showed that the LysM motif has cell wall (peptidoglycan) binding ability (29, 30). MurA of Listeria monocytogenes, which has a muramidase homologue at its N terminus and four LysM repeats at its C terminus (4), and AcmA of Lactococcus lactis, which has an N-acetylglucosaminidase domain in its N-terminal region and three LysM repeats in its C-terminal region, are associated with cell separation (29). Recently, Steen et al. also reported that AcmA is localized at cell separation sites and cell poles (29). Thus, it may be generally predicted that the LysM repeats are very important for proteins to be localized at cell separation sites and cell poles. In Staphylococcus aureus, two cell-separating enzymes, Atl and Sle1, have been reported (15, 31). Sle1 is a 32-kDa N-acetylmuramoyl-l-alanine amidase and contains a signal peptide and three LysM repeats at its N terminus (15). But Atl being a bifunctional protein (containing amidase and glucosaminidase domains) does not have LysM repeats (31; Pfam database). Electron microscopic observation using protein A-gold particles reacting with the antigen-antibody complex indicated that the atl gene products form a ring structure on the cell surface at the septal region and also that for the next cell division site (31). Since the atl gene products also show similar localization on protoplasts, the binding mechanism is completely different from LysM (31). Recently, it has become clear that LytB in Streptococcus pneumoniae is essential for cell separation (12) and is localized at cell poles (5). LytB does not have a LysM motif (Pfam database); however, it has a repeat motif in its N-terminal domain and a cell wall hydrolase in its C-terminal domain. Thus, the localization mechanism is also different from that of LysM.

We do not know why cell wall hydrolases containing LysM repeats target cell separation sites and cell poles. These repeats themselves bound to cell walls (peptidoglycan) (data not shown). How do cell separation hydrolases recognize cell separation sites and cell poles? Steen et al. proposed that binding of the LysM repeats to cell walls is hindered by other cell wall constituents (lipoteichoic acid is a candidate) (30). It may be the case that, in B. subtilis, some cell wall components such as teichoic acid and teichuronic acid prevent the LysM repeats from binding to cell walls (peptidoglycan) (data not shown). Through further study, we will investigate a factor(s) that is needed for the LysM proteins to be localized at cell separation sites and cell poles. Moreover, we know that identified cell separation enzymes with a LysM motif are only d,l-endopeptidases in B. subtilis. At least cell separation enzymes in L. monocytogenes and L. lactis are not d,l-endopeptidases (they are a muramidase and a glucosaminidase, respectively) (4, 29). We want to construct hybrid proteins containing LysM repeats and other cell wall-lytic domains and to investigate the functions of the fused proteins.