Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2000 Feb 1;97(3):1085–1090. doi: 10.1073/pnas.97.3.1085

Localization of a peripheral membrane protein: Gβγ targets GαZ

C Simone Fishburn 1, Sonia K Pollitt 1, Henry R Bourne 1,*
PMCID: PMC15529  PMID: 10655488

Abstract

To explore the relative roles of protein-binding partners vs. lipid modifications in controlling membrane targeting of a typical peripheral membrane protein, Gαz, we directed its binding partner, βγ, to mislocalize on mitochondria. Mislocalized βγ directed wild-type Gαz and a palmitate-lacking Gαz mutant to mitochondria but did not alter localization of a Gαz mutant lacking both myristate and palmitate. Thus, in this paradigm, a protein–protein interaction controls targeting of a peripheral membrane protein to the proper compartment, whereas lipid modifications stabilize interactions of proteins with membranes and with other proteins.


Targeting a peripheral membrane protein to the right subcellular compartment is thought to depend on a combination of signals, of which the best studied are posttranslational lipid modifications, polybasic domains, and protein-binding partners. Previous work from our (1, 2) and other (3–5) laboratories suggested that palmitate acts as a membrane targeting signal by trapping proteins at organelles containing a palmitoyl transferase. Specific membrane localization requires targeting signals in addition to palmitate, however, because mutants lacking palmitoylation sites undergo only partial or no mislocalization (2, 6–8) and some proteins are palmitoylated en route rather than at their final subcellular destination (9, 10). For this study, we used subunits of a heterotrimeric G protein, Gz, to test the hypothesis that protein partners direct the targeting of peripheral membrane proteins. We find that specific membrane localization of one subunit of this protein is determined by its interaction with the other, whereas posttranslational lipid modifications seem to stabilize the interaction of the subunits with each other and with membranes.

Heterotrimeric G proteins, which are signal transducers located on the cytoplasmic leaflet of the plasma membrane (PM), are composed of two functional subunits, a guanine nucleotide-binding α-subunit and a tightly bound βγ-heterodimer. The membrane attachment of βγ depends on the prenyl group attached to the C terminus of the γ-polypeptide (11). Although fatty acids attached at or near the N termini of Gα-subunits clearly tether them to membranes (12–15), other evidence suggests that βγ can play a controlling role in directing them specifically to the PM. For example, in cultured cells, overexpressed βγ can recruit to the PM an αz mutant lacking any lipid attachment (1), and pure βγ can recruit αo to phospholipid vesicles in vitro (16). Moreover, βγ cooperates with palmitate to bind α-subunits at the PM (1), and sequestration of βγ by the β-adrenergic receptor kinase impairs association of αz with the PM (2).

Materials and Methods

Expression Constructs.

cDNA constructs expressing αzEE, αz-C3A-EE and αz-G2AC3A-EE in pcDNA3 were generated as described (12). αzMUT (αzEE containing the mutations I19A, D20A, and E26A) was generated by using the Quickchange site-directed mutagenesis kit (Stratagene). γ2MITO was generated by three successive PCRs on myc-tagged γ2 (1) by using the primers shown below (5′ primers 1–3 and 3′ primers 4 or 5) in standard PCR procedures. The product of the reaction with primers 1 and 4 served as the template for the reaction with primers 2 and 4. Likewise, the product of this reaction served as the template for the reaction with primers 3 and 4. The final product was subcloned into the EcoRI and XbaI sites of pcDNA3.1 (Invitrogen). γ2C68S-MITO was produced the same way, with myc-tagged γ2C68S as the template, by using primer 5 instead of primer 4. (Primer 1, 5′-GGAATTCGCTATCGGAGCCTACTATTACTACGGAGCCGAACAAAAACTCATCTCAGAAGAGG-3′; primer 2, 5′-GGAATTCTATCCTCGCTACCGTGGCTGCAACAGGAACAGCTATCGGAGCCTACTATTACTACGG-3′; primer 3, 5′-GAATTCATGA AGTCCTTCATCACCAGAAACAAGACCGCTATCCTCGCTACCGTGGCTGCAACAGG-3′; primer 4, 5′-CCTCTAGATTACCAGGATAGCACAGAAAAAAC-3′; primer 5, 5′-GGTCTAGATTAAAGGATAGCACTGAAAAAC-3′.)

Immunofluorescence and Microscopy.

Cells were transfected by the adenovirus-DEAE dextran method (17), plated onto glass coverslips after 24 h, and fixed in 3.7% (vol/vol) formaldehyde/PBS 48 h after transfection. Immunofluorescence was performed as described (1). The primary antibodies used were as follows: anti-EE mouse monoclonal antibody (Onyx Pharmaceuticals, Richmond, CA; 20 μg/ml), mouse monoclonal anti-Hsp60 antibody (StressGen Biotechnologies, Victoria, Canada; 1:200), and rabbit polyclonal anti-γ2 (Santa Cruz Biotechnology; 1:100). Primary antibodies were followed by secondary antibodies: FITC-conjugated goat anti-mouse (1:100 dilution) and Texas Red-conjugated goat anti-rabbit secondary antibody (Jackson ImmunoResearch; 1:100 dilution). Cells were examined with a DeltaVision Nikon TE200 microscope equipped with a cooled charge-coupled device CH350L camera. Images were taken at nine z levels, deconvolved, and analyzed with delta vision software. The figures show the deconvolved pattern corresponding to z level five.

Quantitation of Immunofluorescence.

Locations of mitochondria were determined from deconvolved images of the mitochondrial stain (hsp60; see Fig. 2) or γ2MITO (see Figs. 3–5). For αz tagged with the EE epitope and expressed in the absence of γ2MITO, cells were costained with rabbit polyclonal anti-hsp60 (StressGen Biotechnologies; 1:200) and mouse monoclonal anti-EE antibodies (image not shown). In all cases, the locations of mitochondria were defined from the image showing the relevant stain by creating polygons at each of nine z levels in regions greater than 10 pixels that contained a fluorescence intensity above a threshold value. These polygons were then copied onto the image of the same cell representing the second stain, and the fluorescence intensities contained by the polygons, through all nine z levels, were calculated. The proportion of a G protein subunit located in mitochondria was calculated by comparing fluorescence intensity from that subunit contained within the polygons to the fluorescence intensity of the same stain associated with the whole cell.

Figure 2.

Figure 2

Mitochondrial targeting of proteins in cells expressing γ2MITO. (A) Diagrammatic representation of γ-subunit constructs, showing N-terminal mitochondrial targeting signal (mito), myc epitope tag (myc), and C-terminal prenyl modification. (B) Immunofluorescence microscopy of CHO cells transfected with wild-type γ2 (a–c) or γ2-MITO (d–f). Cells were costained with antibody to γ2 (a and d) and mitochondrial Hsp60 (b and e). c and f show the overlap (yellow) of the two antibody stains. (C) Quantitative analysis of the calculated percentage of overlap between immunofluorescent stain for the appropriate mitochondrial probe (anti-γ2 or anti-Hsp60, as indicated in the figure legends) and the stain for the indicated G protein subunit in cells cotransfected with no γ-subunit, β1 plus γ2MITO, or β1 plus γ2C68S-MITO. Bars represent means ± 2 SEM (n = 4).

Figure 3.

Figure 3

αz follows γ2MITO to mitochondria. Cells were transfected with γ2MITO, β1, and EE-tagged wild-type αz (a–c) or γ2MITO plus β1 tagged with the EE epitope (d–f). Cells were costained with anti-γ2 (a and d) and anti-EE antibodies (b and e). c and f show the overlap (yellow) of the two antibodies. (Bars = 20 μm.)

Figure 5.

Figure 5

Removal of the prenylation site prevents association of αz with βγ at the mitochondria. Immunofluorescence microscopy of cells expressing γ2C68S-MITO, β1, and EE-tagged αz (a–c) or γ2C68S-MITO and EE-tagged β1 (d–f). Cells were costained with anti-γ2 (a and d) and anti-EE (b and e) antibody. c and f show the overlap of the two antibodies. (Bar = 20 μm.)

Mitogen-Activated Protein Kinase (MAPK) Assays.

To assay the activity of transfected αz without interference from endogenous αi-subunits, we treated cells with pertussis toxin, which does not act on αz but inactivates all other αi family members. MAPK assays were performed on Chinese hamster ovary (CHO) cells transfected 48 h earlier with the D2 dopamine receptor and hemagglutinin epitope-tagged MAPK (HA-MAPK) together with wild-type αz, αzMUT, or αzMUT plus β1 and wild-type γ2 as described (1). MAPK activity was determined after a 4-h treatment with pertussis toxin (100 ng/ml) and a 7-min exposure to the D2 agonist quinpirole (10 μM) or no agonist.

Results

Mislocalization of αz Caused by Impaired Binding to βγ.

To determine whether βγ is required for targeting Gα specifically to the PM, we constructed αzMUT, a recombinant αz carrying alanine substitution mutations designed to specifically impair its ability to bind βγ. To impair βγ binding without affecting the ability of αz to fold properly or to bind guanine nucleotides, we substituted alanines for three residues (I19, D20, and E26) in the N terminus that are likely to interact with βγ, as determined by inspection of the crystal structures of αt/i/βγ and αi/βγ heterotrimers (18, 19). Throughout this study, we used epitope-tagged αz (αzEE), a myristoylated and palmitoylated member of the Gi family, in which the Glu–Glu epitope had been shown not to disrupt signaling or PM targeting (12).

Unlike recombinant wild-type αz, αzMUT mislocalizes substantially to intracellular membranes, as indicated by immunofluorescence microscopy of CHO cells (Fig. 1A). Immunofluorescence of wild-type αz (Fig. 1Aa) fits the pattern characteristic of a protein located exclusively at the PM of CHO cells (1, 2)—that is, a uniform intensity of stain extending to the edge of the cell where it is sometimes more intense. Mislocalization of αzMUT to intracellular membranes, however, is partial (Fig. 1Ab)—that is, a portion of the fluorescence shows a pattern characteristic of PM localization. We imagine that mislocalization is incomplete, because the affinity of αzMUT for βγ is reduced but not abolished. In keeping with this interpretation, αzMUT does not mediate receptor activation of the MAPK pathway unless coexpressed with excess βγ (Fig. 1B). Because this MAPK response requires receptor-dependent release of βγ from αz/βγ heterotrimers (1, 20), we infer that αzMUT is properly folded in cells but forms functional heterotrimers only when supplied with sufficiently high levels of βγ to overcome its diminished ability to bind βγ.

Figure 1.

Figure 1

Alanine mutations at a βγ-binding interface of αz cause the mutant protein, αzMUT, to mislocalize to intracellular membranes. (A) Immunofluorescence microscopy of CHO cells transfected with wild-type αz (a) or αzMUT (b). Although the fluorescent signal for wild-type αz (a) is not confined to the outer perimeter of the cell, the staining pattern indicates localization at the PM. This pattern is due to the extremely flat and thin shape of CHO cells under our culture conditions; using confocal microscopy, we previously observed the same pattern of fluorescence for PM-localized proteins in CHO cells (1). (Bar = 20 μm.) (B) MAPK assays were performed on CHO cells transfected 48 h earlier with the D2 dopamine receptor and HA-MAPK, together with wild-type αz, αzMUT, or αzMUT plus β1 and wild-type γ2. MAPK activity was determined after a 4-h treatment with pertussis toxin (100 ng/ml) and a 7-min exposure to the D2 agonist (10 μM quinpirole, black bars) or no agonist (white bars). Data shown are the means ±2 SEM of four experiments.

αz Follows Mistargeted βγ to the Mitochondria.

To ask whether βγ is sufficient for targeting αz, we applied a strategy that may be generally useful for studying targeting of peripheral membrane proteins: we assessed the ability of a misdirected protein to induce its partner to accompany it into the “wrong” cellular compartment—in this case, mitochondria. To do so, we used a well characterized mitochondrial targeting signal from the yeast protein Mas70p (21), which causes cytosolic proteins to translocate to the mitochondrial outer membrane without triggering import into the mitochondrial matrix (22) and thus anchors proteins on the cytosolic surface of the mitochondrial outer membrane. Attached to the N terminus of the γ2 polypeptide, Mas70p caused the fusion protein γ2MITO (Fig. 2A) to localize exclusively to mitochondria, as assessed by immunofluorescence (Fig. 2B). and quantitative analysis (Fig. 2C) γ2MITO immunofluorescence overlaps almost perfectly (81%; Fig. 2C) with that of the mitochondrial marker Hsp60, in marked contrast to that of wild-type γ2, which is seen at the PM and in perinuclear membranes (Fig. 2B). A limited overlap (24%; Fig. 2C) of wild-type γ-subunits with mitochondria was also detected, most probably reflecting nonspecific interaction with mitochondrial membranes mediated by the hydrophobic prenyl group. We (1) and others (11) have observed localization of wild-type γ-subunits on intracellular membranes after overexpression in transfected cells. This localization is clearly different, however, from the almost exclusive mitochondrial localization of γ2MITO.

Coexpression of wild-type αz with γ2-MITO causes the α-subunit to colocalize at the mitochondria, indicating that mistargeted βγ can direct αz to a new subcellular location (Fig. 3). In cells coexpressing epitope-tagged αz, β1, and γ2MITO, αz immunofluorescence substantially overlaps that of γ2MITO (Fig. 3 a–c). Even in the presence of mistargeted βγ, some αz immunofluorescence appears to target to the PM, presumably because it associates there with endogenous βγ. Nonetheless, coexpression with γ2MITO and β1 markedly increases localization of αz to mitochondria (compare Fig. 1Aa to Fig. 3b); the quantitative increase is highly significant: 39 ± 12% vs. 7 ± 0.4%, with and without misdirected βγ, respectively (Fig 2C). As compared with αz, an even higher proportion (77 ± 7%) of epitope-tagged β1 colocalizes with γ2-MITO at the mitochondria (Fig. 3 d–f); this difference probably reflects different trafficking pathways taken by α- and β-subunits (23).

Lipid Modifications Stabilize Interaction of αz with βγ.

The idea that βγ directs targeting of α-subunits contrasts with an earlier view (1, 24), that palmitate confers membrane specificity. Several mitochondrial proteins are palmitoylated (25), suggesting that the two views might be reconciled by postulating that palmitoylation and γ2MITO act in combination to recruit αz to mitochondria. Mitochondrial targeting by γ2MITO of an αz mutant lacking the palmitoylation site (αz-C3A,; ref. 12) indicates, however, that βγ can direct membrane localization of α-subunits in the absence of palmitate (Fig. 4 a–d). When coexpressed with β1 and γ2MITO, αzC3A and wild-type αz localize at mitochondria with similar efficiencies (28 ± 5% vs. 39 ± 12%; not significantly different) (Fig. 2C). As is the case with wild-type αz, targeting of αz-C3A to mitochondria by γ2MITO requires coexpression of α2 with β1γ2MITO (Fig. 4, compare b and d).

Figure 4.

Figure 4

Effect of removing lipid modification sites on PM and mitochondrial targeting of αz. Cells were transfected with αzC3A, which lacks the palmitoylation site (a–d), or with αzG2AC3A, which lacks both myristoylation and palmitoylation sites (e–h), either alone (d and h) or in combination with γ2MITO and β1 (a–c and e–g). Cells were stained with anti-EE antibody (b, d, f, and h; to detect epitope-carrying αz mutants) and anti-γ2 antibody (a and e). c and g show the overlap (yellow) of the antibody stains (c shows overlap between a and b; g shows overlap between c and f). (Bar = 20 μm.)

Although palmitate per se is not required, similar experiments showed that association of αz with βγ at the mitochondria does require two lipid attachments: a myristate at the N terminus of αz (Fig. 4 e–h) and a prenyl group at the C terminus of γ2MITO (Fig. 5). In contrast to αz-C3A, which contains myristate, a mutant αz carrying no lipid modification (αzG2AC3A; ref. 12) did not colocalize with γ2MITO and β1 at the mitochondria. Instead, αz-G2AC3A is distributed through the cytoplasm and in nuclei, showing little or no association with any cellular membrane (Fig. 4 e–g); only 11 ± 4% of this mutant overlapped with the γ2 fluorescence (Fig. 2c). The distribution of αz-G2AC3A was therefore not altered by overexpression of βγ at the mitochondria (Fig. 4, compare f and h), which suggests that βγ requires assistance from myristate (and/or palmitate) to hold αz stably on the mitochondrial membrane. It is likely that palmitate by itself could play a similar role to myristate; however, because mutation of the myristoylation site prevents both myristoylation and palmitoylation of αz (1, 12), we could not assess the ability of βγ to target αz containing palmitate alone.

The C-terminal prenylation site of γ2 is exposed to the cytoplasm in γ2MITO, which is attached to the mitochondrial outer membrane via a hydrophobic N-terminal targeting signal. Prenylation at the C terminus of γ2MITO is required for targeting αz, but not β1, to membranes (Fig. 5 and Fig 2C). Addition of a point mutation that prevents prenylation of γ2 (C68S; ref. 11) creates a mutant protein, γ2C68S-MITO, that does not differ from γ2MITO in its exclusive targeting to mitochondria (Fig. 5) or in its ability to induce overexpressed β1 to accompany it to mitochondria (Fig. 5). In contrast to γ2MITO, however, γ2C68S-MITO induced little or no mislocalization of αz to mitochondria (compare Fig. 5 b and c to Fig. 3 b and c). Quantitation showed that overlap of αz fluorescence with mitochondria was small and virtually the same in cells coexpressing αz with γ2C68S-MITO vs. αz with no γ-subunit. Prenylation of the γ-subunit plays an essential role, therefore, in the association of αz with βγ at the mitochondria.

Discussion

The present results provide strong evidence that the G protein βγ-subunit, rather than palmitate, directs specific targeting of G protein α-subunits to membranes. Mislocalization of αzMUT to intracellular membranes (Fig. 1) suggests that association with βγ is necessary for targeting an α-subunit to the PM, and the experiments with mistargeted γ2MITO (Figs. 3 and 4) indicate that βγ can suffice for targeting an α-subunit to a membrane-bound organelle.

These results require that we modify and extend a recently proposed general model proposed (2, 24, 26) to account for the specific targeting of dually lipidated peripheral membrane proteins. In this model, attachment of a single lipid (in this case myristate) endows the protein with sufficient hydrophobicity to associate randomly and reversibly with cellular membranes. At its correct target membrane, however, the protein encounters a second signal, which anchors the protein stably to the membrane and specifically retains it on the correct organelle. Previous studies (reviewed in ref. 24) focused on attachment of palmitate as the targeting signal, in part because palmitoylation takes place at the protein's final subcellular destination. In this study of G protein α-subunits, however, we demonstrate that subcellular location is primarily dictated by the protein's binding partner (βγ), rather than by palmitate. Considerable evidence indicates that palmitoylation of α-subunits and their binding to βγ are closely associated (1, 27, 28), suggesting a “dock-and-lock” modification of the previous model for targeting peripheral membranes at the PM: α-subunits first dock on βγ at the PM and then undergo rapid palmitoylation, which locks them in place. Indeed, localization of other peripheral membrane proteins to the correct membrane or organelle may likewise depend principally on association with specific protein partners. In keeping with this idea, stable membrane association of two palmitoylated proteins, SNAP25 and GAD65, seems to require additional proteins not yet identified (6, 7, 9).

The requirement for lipids attached to both αz and γ2MITO for targeting αz to mitochondria (Figs. 4 and 5) suggests that hydrophobic interactions between the two lipid groups enhance the affinity of αz for βγ. In vitro experiments comparing functional activities of acylated vs. nonacylated α-subunits (28, 29) and of prenylated vs. nonprenylated γ-subunits (30–32) do not agree with respect to the relative importance of these lipid groups for the interaction of α and βγ. Our in vivo experiments indicate that lipid modifications on both α and βγ are involved in assembling αβγ heterotrimers at membranes. The idea that these lipid attachments enhance association of α and βγ by a direct lipid–lipid interaction idea accords with the likely proximity of lipid groups at the N termini of α-subunits and the C termini of γ-subunits, based on three-dimensional crystal structures of G protein trimers (18, 19). Alternatively, or in addition, the prenyl group of βγ may associate with the hydrophobic mitochondrial outer membrane and orient αz such that its myristoyl group interacts more effectively with the membrane, thereby stabilizing the association of the heterotrimer with the membrane.

Taken together, our data indicate a prominent role for βγ as a targeting signal for α-subunits. A related riddle—how βγ itself is targeted to PM—remains unsolved. Finally, by extension, our results suggest that investigators should look for accessory proteins that direct other peripheral membrane proteins to their correct locations in cells.

Acknowledgments

We thank Paul Herzmark for technical assistance and Mark von Zastrow and Keith Mostov for useful advice and for reading the manuscript. This work was supported by a fellowship from the Western States Affiliate of the American Heart Association (to C.S.F.) and National Institutes of Health Grant CA54427.

Abbreviations

PM

plasma membrane

MAPK

mitogen-activated protein kinase

CHO

Chinese hamster ovary

References

  • 1.Morales J, Fishburn C S, Wilson P T, Bourne H R. Mol Biol Cell. 1998;9:1–14. doi: 10.1091/mbc.9.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Fishburn C S, Herzmark P, Morales J, Bourne H R. J Biol Chem. 1999;274:18793–18800. doi: 10.1074/jbc.274.26.18793. [DOI] [PubMed] [Google Scholar]
  • 3.van't Hof W, Resh M D. J Cell Biol. 1997;136:1023–1035. doi: 10.1083/jcb.136.5.1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wolven A, Okamura H, Rosenblatt Y, Resh M D. Mol Biol Cell. 1997;8:1159–1173. doi: 10.1091/mbc.8.6.1159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zlatkine P, Mehul B, Magee A I. J Cell Sci. 1997;110:673–679. doi: 10.1242/jcs.110.5.673. [DOI] [PubMed] [Google Scholar]
  • 6.Solimena M, Dirkx R, Jr, Radzynski M, Mundigl O, De Camilli P. J Cell Biol. 1994;126:331–341. doi: 10.1083/jcb.126.2.331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shi Y, Veit B, Baekkeskov S. J Cell Biol. 1994;124:927–934. doi: 10.1083/jcb.124.6.927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Laakkonen P, Ahola T, Kääriäinen L. J Biol Chem. 1996;271:28567–28571. doi: 10.1074/jbc.271.45.28567. [DOI] [PubMed] [Google Scholar]
  • 9.Gonzalo S, Linder M E. Mol Biol Cell. 1998;9:585–597. doi: 10.1091/mbc.9.3.585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bijlmakers M J, Marsh M. J Cell Biol. 1999;145:457–468. doi: 10.1083/jcb.145.3.457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Muntz K H, Sternweis P C, Gilman A G, Mumby S M. Mol Biol Cell. 1992;3:49–61. doi: 10.1091/mbc.3.1.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wilson P T, Bourne H R. J Biol Chem. 1995;270:9667–9675. doi: 10.1074/jbc.270.16.9667. [DOI] [PubMed] [Google Scholar]
  • 13.Jones T L, Simonds W F, Merendino J J, Jr, Brann M R, Spiegel A M. Proc Natl Acad Sci USA. 1990;87:568–572. doi: 10.1073/pnas.87.2.568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Linder M E, Middleton P, Hepler J R, Taussig R, Gilman A G, Mumby S M. Proc Natl Acad Sci USA. 1993;90:3675–3679. doi: 10.1073/pnas.90.8.3675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wedegaertner P B, Chu D H, Wilson P T, Levis M J, Bourne H R. J Biol Chem. 1993;268:25001–25008. [PubMed] [Google Scholar]
  • 16.Sternweis P C. J Biol Chem. 1986;261:631–637. [PubMed] [Google Scholar]
  • 17.Forsayeth J R, Garcia P D. BioTechniques. 1994;17:354–356. , 357–358. [PubMed] [Google Scholar]
  • 18.Lambright D G, Sondek J, Bohm A, Skiba N P, Hamm H E, Sigler P B. Nature (London) 1996;379:311–319. doi: 10.1038/379311a0. [DOI] [PubMed] [Google Scholar]
  • 19.Wall M A, Coleman D E, Lee E, Iniguez-Lluhi J A, Posner B A, Gilman A G, Sprang S R. Cell. 1995;83:1047–1058. doi: 10.1016/0092-8674(95)90220-1. [DOI] [PubMed] [Google Scholar]
  • 20.Pace A M, Faure M, Bourne H R. Mol Biol Cell. 1995;6:1685–1695. doi: 10.1091/mbc.6.12.1685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shore G C, McBride H M, Millar D G, Steenaart N A, Nguyen M. Eur J Biochem. 1995;227:9–18. doi: 10.1111/j.1432-1033.1995.tb20354.x. [DOI] [PubMed] [Google Scholar]
  • 22.McBride H M, Millar D G, Li J M, Shore G C. J Cell Biol. 1992;119:1451–1457. doi: 10.1083/jcb.119.6.1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rehm A, Ploegh H L. J Cell Biol. 1997;137:305–317. doi: 10.1083/jcb.137.2.305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dunphy J T, Linder M E. Biochim Biophys Acta. 1998;1436:245–261. doi: 10.1016/s0005-2760(98)00130-1. [DOI] [PubMed] [Google Scholar]
  • 25.Berthiaume L, Peseckis S M, Resh M. In: Lipid Modifications of Proteins. Casey P J, Buss J E, editors. Vol. 250. San Diego: Academic; 1995. pp. 454–467. [Google Scholar]
  • 26.Schroeder H, Leventis R, Shahinian S, Walton P A, Silvius J R. J Cell Biol. 1996;134:647–660. doi: 10.1083/jcb.134.3.647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dunphy J T, Greentree W K, Manahan C L, Linder M E. J Biol Chem. 1996;271:7154–7159. doi: 10.1074/jbc.271.12.7154. [DOI] [PubMed] [Google Scholar]
  • 28.Iiri T, Backlund P S, Jr, Jones T L, Wedegaertner P B, Bourne H R. Proc Natl Acad Sci USA. 1996;93:14592–14597. doi: 10.1073/pnas.93.25.14592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hepler J R, Biddlecome G H, Kleuss C, Camp L A, Hofmann S L, Ross E M, Gilman A G. J Biol Chem. 1996;271:496–504. doi: 10.1074/jbc.271.1.496. [DOI] [PubMed] [Google Scholar]
  • 30.Ohguro H, Fukada Y, Takao T, Shimonishi Y, Yoshizawa T, Akino T. EMBO J. 1991;10:3669–3674. doi: 10.1002/j.1460-2075.1991.tb04934.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Fukada Y, Takao T, Ohguro H, Yoshizawa T, Akino T, Shimonishi Y. Nature (London) 1990;346:658–660. doi: 10.1038/346658a0. [DOI] [PubMed] [Google Scholar]
  • 32.Wildman D E, Tamir H, Leberer E, Northup J K, Dennis M. Proc Natl Acad Sci USA. 1993;90:794–798. doi: 10.1073/pnas.90.3.794. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES