Skip to main content
American Journal of Human Genetics logoLink to American Journal of Human Genetics
. 2006 Jul 3;79(3):549–555. doi: 10.1086/507047

UBE2A, Which Encodes a Ubiquitin-Conjugating Enzyme, Is Mutated in a Novel X-Linked Mental Retardation Syndrome

Rafaella M P Nascimento 1, Paulo A Otto 1, Arjan P M de Brouwer 1, Angela M Vianna-Morgante 1
PMCID: PMC1559544  PMID: 16909393

Abstract

We report a mutation of UBE2A/HR6A, which encodes a ubiquitin-conjugating enzyme (E2), a member of the ubiquitin proteasome pathway, as the cause of a novel X-linked mental retardation (XLMR) syndrome that affects three males in a two-generation family. A single-nucleotide substitution, c.382C→T in UBE2A, led to a premature UAG stop codon (Q128X). As a consequence, the predicted polypeptide lacks the 25 C-terminal amino acid residues. The importance of this terminal sequence for UBE2 function is inferred by its conservation in vertebrates and in Drosophila. UBE2A mutations do not appear to significantly contribute to XLMR, since no UBE2A mutations were identified in 15 families with nonsyndromic and 4 families with syndromic idiopathic XLMR previously mapped to intervals encompassing this gene. This is the first description of a mutation in a ubiquitin-conjugating enzyme gene as the cause of a human disease.


Monogenic X-linked mental retardation (XLMR) has been estimated to affect ∼10% of mentally retarded males.1,2 Mutations in 59 genes on the X chromosome have been implicated in familial mental retardation (Greenwood Genetic Center), and they represent about one-third of the X-linked genes demonstrated to be mutated in human monogenic diseases.3 With the identification of genes involved in XLMR, a picture emerges indicating that some genes are mutated in both syndromic and nonsyndromic mental retardation.4 However, mutations in such genes account for only a small proportion of XLMR-affected families and males with sporadic mental retardation.1 The FMR1 gene, mutated in the fragile X syndrome, is the most noticeable exception, with a prevalence of 2%–2.5% in cohorts of mentally retarded males5 and affecting roughly one-quarter of XLMR-affected families.6 Therefore, many genes involved in XLMR still await identification.

Here, we report a nonsense mutation in UBE2A, which encodes a ubiquitin-conjugating enzyme (E2) in the proteasome pathway of protein degradation, as the cause of a novel XLMR syndrome. Ubiquitination of proteins and their degradation constitute a major mechanism in the regulation of protein levels in mammalian cells. In addition, ubiquitination is recognized to have pleiotropic functions in the regulation of various cellular processes, such as control of transcription factor activity,7 receptor internalization,8 and histone modifications, which modulate chromatin structure.9

The described family includes three mentally retarded males in two generations, related through their clinically normal mothers (fig. 1 and table 1). Informed consent was obtained from every participating individual or from his or her guardian(s), and the study was approved by The Ethics Committee on Research on Human Subjects of the Institute of Biosciences, University of São Paulo, São Paulo. Physical examination was performed on the three affected males. The family provided information about the patients (i.e., pregnancy and condition at birth, developmental milestones, intellectual and adaptive functioning) and made medical records available. The patients’ mothers were clinically unaffected and did not show any overt intellectual or adaptive impairment; I-2 is a housewife, II-2 is the head of a school for mentally impaired children, and II-4 is a nutritionist. At age 46 years and 9 mo, II-3 developed acute myeloid leukemia. Chromosome studies of cultured blood lymphocytes—prometaphase G-banding of individuals II-3, III-2, and III-3 and in situ hybridization of subtelomeric probes (Chromoprobe Multiprobe-T System [Cytocell]) of individual II-3—did not reveal any alterations. The result of molecular testing of patient III-2 for fragile X syndrome was negative.

Figure 1. .

Figure  1. 

A, The three affected males, II-3 (aged 46 years and 7 mo), III-2 (aged 19 years and 11 mo), and III-3 (aged 5 years and 4 mo). B, Two-generation genealogy of the study family, showing affected males related through their clinically normal mothers. C, Chromatograms of the sense-strand sequence from I-2 (obligate carrier) and II-3 (affected male). A c.382C→T mutation in UBE2A exon 6 was identified as the cause of the syndrome.

Table 1. .

Clinical Findings for the Mentally Retarded Patients

Patient
Characteristic II-3 III-2 III-3
Age at examination 46 years and 7 mo 19 years and 11 mo 5 years and 4 mo
Birth weight (percentile) 50th 90th–97th > 97th
Height (percentile) <3rd 10th–25th 10th
Weight (percentile) >97th 90th >97th
Head circumference (percentile) >98th >98th 50th
Hair whorls + + +
Wide face + +
Midface hypoplasia + +
Synophris + + +
Up-slanted palpebral fissures + + +
Ocular hypertelorism +
Low nasal bridge + +
Large mouth with down-turned corners and thin lips + + +
Short, broad neck + + +
Low posterior hairline + + +
Widely spaced nipples + + +
Small penis + + +
Small, flat feet, with dorsum swelling + + +
Onychodystrophya + +
Marked generalized hirsutism + + +
Myxedematous appearance + + +
Dry skin + + +
Seizures + + +
Severe speech impairment + +b +b
White matter hypodensityc Not examined + +
a

After puberty.

b

Absent speech.

c

Determined by magnetic resonance imaging.

On the basis of the family pedigree, we assumed an X-linked pattern of inheritance for this previously undescribed mental retardation syndrome (fig. 1). This assumption was further strengthened by our finding that the presumptive obligate carriers had completely skewed X inactivation in leukocytes, as demonstrated by the methylation status of the CAG repeat of the androgen receptor gene10 (data not shown). Indeed, skewed X-chromosome inactivation appears to be characteristic of carriers of many gene mutations involved in XLMR.11 These observations prompted us to search for the X-linked gene involved in the syndrome. Given the small size of the family, an exclusion-mapping strategy was performed. Using DNA extracted from peripheral blood leukocytes, we genotyped 46 microsatellite loci throughout the X chromosome (fig. 2), to locate regions of common descent in the three patients. In the initial mapping, 18 microsatellite loci ∼10 cM apart (ABI PRISM Linkage Mapping Set MD-10 [Applied Biosystems]) were amplified by PCR with fluorescent-labeled primers, and the amplified fragments were analyzed on a MegaBACE 1000 automated sequencer with the MegaBACE Genetic Profiler software (Amersham Bioscience–GE Healthcare). The other 28 markers were selected from the National Center for Biotechnology Information (NCBI) database, with regard to their location on the X chromosome and level of heterozygosity; PCR was performed according to standard conditions, and, after electrophoresis on 6% denaturing polyacrylamide gels, the amplified products were visualized by silver staining. Genotyping of 36 markers spaced at ∼5 cM disclosed three loci, at Xq23-25, harboring alleles shared by all three affected males, but their inheritance from a common ancestor could not be determined. A further 10 loci 1 Mb apart within the defined Xq23-q25 region were analyzed. An ∼15-Mb segment could be delimited by the excluded markers DXS8088 (Xq23) and DXS1047 (Xq26.1); all alleles within this defined region were shared by the affected males, and alleles at DXS8053, DXS8081, and DXS8057 were proven to be identical by descent (fig. 2). This candidate segment contained 86 known genes (NCBI); three of them had been previously associated with mental retardation: LAMP2 (lysosomal associated membrane protein 2), mutated in patients with multisystem glycogen storage disease—Danon disease (MIM 300257), an X-linked dominant disorder affecting predominantly cardiac and skeletal muscles—and also found to be mutated in primary cardiomyopathy12,13; GRIA3 (glutamate receptor, ionotrophic, AMP 3), interrupted in a female carrier of a balanced chromosomal translocation t(X;12)(q24;q15) who presented with bipolar disorder and mental retardation14; and AGTR2 (angiotensin II receptor, type 2), disrupted in a balanced translocation t(X;7)(q24;q22) in a female with moderate mental retardation15 and also mutated in males with variable mental retardation.16 On the basis of the clinical features associated with these mutations and those present in our patients, we considered AGTR2 the best candidate gene. Mutation screening was performed by direct sequencing on a MegaBACE 1000. The AGTR2-only coding exon was amplified with primers described elsewhere,16 and no mutations were found. We then performed a candidate-gene search (Genatlas) and found 30 genes within the candidate interval that were expressed in brain. However, only one of those genes, UBE2A/HR6A, was expressed in both brain and lymphocytes. Because of the skewed X-inactivation in the patients’ mothers, which likely represents the survival/proliferation advantage of lymphocytes with the active normal allele in a woman with mutation, we sequenced this gene directly. The six coding exons of UBE2A were amplified, with flanking intronic primer pairs (table 2) that we designed using Primer3 software,17 and were sequenced. A c.382C→T substitution leading to a premature UAG stop codon (Q128X) was detected in all three affected males and in their mothers (fig. 1). The sister of one of the affected males (III-1, with a rather random X-inactivation pattern, as documented by the methylation status of the AR gene [data not shown]) did not carry this mutation.

Figure 2. .

Figure  2. 

Pedigree of the affected males and genotypes of the 46 analyzed markers, from Xpter to Xqter. The 15-Mb candidate segment that is delimited by the excluded markers DXS8088 and DXS1047 is boxed: alleles at loci DXS8053, DXS8081, and DXS8057 are identical by descent in the three affected males, and alleles at the other loci are identical by state. UBE2A is located between markers DXS8064 and DXS8067.

Table 2. .

Primer Pairs Designed to Amplify the Coding Sequence of the UBE2A Gene, with Use of Primer3 Software

Exon Primer Sequence
(5′→3′)
UBE2A-1F cgtggggctttaatgacata
UBE2A-1R aaccttcgggaagacagaca
UBE2A-2F catgcgggacttcaagaggt
UBE2A-2R ccaaacattttcccctaccc
UBE2A-3F ccgggacatccatttgtagt
UBE2A-3R cagaggcaggttcctaagca
UBE2A-4F cctctctaccctgtatctttgcat
UBE2A-4R ggcaccacaaaatacacagga
UBE2A-5F tgggaagcaacataggaatctt
UBE2A-5R aggtgtgagcgactgtaccc
UBE2A- 6F tgttttgcattaaggaactgaca
UBE2A-6R gggaggtgacaaacacatca

We then screened for UBE2A mutations in 19 affected males from XLMR-affected families that were collected by the Euro-MRX Consortium, previously mapped to intervals encompassing this gene. Four families had syndromic and 15 families had nonsyndromic idiopathic XLMR. The phenotypes, linkage intervals, and maximum LOD scores of the Euro-MRX families are summarized in table 3. No mutations were detected in these patients.

Table 3. .

Families from the Euro-MRX Consortium Screened for Mutations in UBE2A[Note]

Family Phenotypea (MRX Number) Maximum LOD Score Flanking Markers Reference
D004 MRX 1.20 DXS993 and DXS8043
L022 MRX (MRX35) 2.41 DXS178 and HPRT Gu et al.18
L025 MRX 1.50 DXS424 and Xqter Claes et al.19
L037 MRX (MRX70) 2.10 DXS8063 and DXS1047 Claes et al.20
L048 MRX 1.30 DXS991 and DXS1047
N005 MRX 1.03 DXS424 and DXS292
N043 MRX 1.14 DXS8076 and DXS1108
N108 MRX 1.51 DXS1169 and DXS8067
P004 MRX .68 DXS1217 and DXS1062
T011 MRX (MRX61) 3.51 DXS135 and DXS737
T013 MRX (MRX62) 2.23 DXS458 and DXS737 Raynaud et al.21
T014 MRX 1.20 MAOB and DXS425 Raynaud et al.21
T025 MRX 1.00 DXS1214 and DXS1212
T048 MRX .60 DXS993 and DXS737
T052 MRX 2.20 DXS990 and DXS8057
L056 MRXS (spastic paraplegia, macrocephaly, hypotonia, and developmental delay) 2.18 DXS8054 and DXS1001
N032 MRXS (hypotonia, ataxia, and areflexia) 6.97 DXS1231 and DXS1001
P014 MRXS (microcephaly, epilepsy, and developmental delay) .60 DXS986 and DXS1047
T019 MRXS (short stature, microcephaly, and facial dysmorphy) 2.96 DXS178 and DXS292 Raynaud et al.22

Note.— All families have males with mental retardation in at least two generations. Obligate carrier females are not affected.

a

MRX and MRXS = nonsyndromic and syndromic XLMR, respectively.

UBE2A/HR6A is a ubiquitination pathway gene that encodes E2. The E2 conjugases, in conjunction with ligating enzymes (E3), mediate the attachment of ubiquitin molecules to proteins, thus targeting them for degradation by the proteasome complex. UBE2A is one of the two human orthologues of the Sacharomyces cerevisiae RAD6/UBC2 gene. In humans and other mammals, the gene is duplicated with one X-linked (UBE2A) copy and one autosomal (UBE2B) copy.23 The coding regions of human UBE2A and UBE2B paralogues share 80% identity and produce proteins with 96% amino acid identity and a seven-residue difference in their 152 amino acids. The UBE2A mutation in our patients introduces a premature stop codon and abolishes the 25 C-terminal amino acids of the protein. The great importance of this sequence for UBE2 function can be inferred from its high conservation in both vertebrates and Drosophila (fig. 3).

Figure 3. .

Figure  3. 

Alignment of UBE2 protein sequences, showing the high amino acid sequence identity between the human protein and those of mouse (100%), zebrafish (96%–100%), and Drosophila (85%–87%). The consensus ubiquitin-binding cysteine- and serine-phosphorylation sites are underlined. In the box, the highly conserved segment of the protein corresponds to the sequence abolished by the c.382C→T mutation (Q128X), which creates a premature stop codon. The identical amino acid sequence of UBE2A in the vertebrates is shown in bold. (Information is based on the NCBI database and GenBank.)

The high conservation of UBE2A and UBE2B amino acid sequences raises the question of function specificity or redundancy of these proteins, which are ubiquitously expressed, although the ratios between these proteins vary significantly in different cells and tissues.24 The fact that double Ube2a/Ube2b (hr6a/hr6b) knockout mice are not viable indicates that these genes are crucial for development, and viability was demonstrated to depend on the presence of at least one functional allele, by the construction of different knockout mice.25 However, the Ube2a- and Ube2b-knockout mice differ at least in reproductive performance. Male-limited sterility is exhibited by Ube2b-knockout26 but not Ube2a-knockout25 mice. In contrast, whereas Ube2b-knockout females are fertile,26 Ube2a-knockout females fail to produce offspring in spite of normal ovulation; the absence of the UBE2A/HR6A protein in oocytes prevents embryonic development beyond the two-cell stage.25 Since UBE2B protein levels, compared with those of UBE2A,24 are high in spermatids of wild animals and the opposite is observed in oocytes,25 the infertility phenotypes might result from a dose-dependent effect in the germ cells. However, other observations point to different functional properties of UBE2A and UBE2B. The polyubiquitination of the cyclophilin CYC4/hCyP-60 requires UBE2B (but not UBE2A),27 and UBE2A (not UBE2B) was found to interact with Rfp14 (ret finger protein-like 4) in a yeast two-hybrid screen.28

The affected males present a neurodevelopmental disorder. A number of studies have addressed the function of ubiquitination during neuronal development. Nerve growth factor (NGF)–induced neurite outgrowth from rat pheochromocytoma cells (PC12) is concurrent with increased levels of ubiquitin-protein conjugates and coincides with up-regulated activities of ubiquitin-conjugating enzymes but not with enhanced ubiquitin-dependent proteolysis; neurite outgrowth is accelerated by blocking ubiquitin-dependent proteolysis, and such outgrowth is inhibited by a dipeptide inhibitor of E3-dependent ubiquitination. These data imply that ubiquitination and ubiquitin-dependent proteolysis are positive and negative regulators of neurite outgrowth, respectively.29 Down-regulation of UBE2B mRNA in PC12 cells leads to a reduction of NGF-induced neurite length, and pharmacological inhibition of ubiquitin-dependent protein degradation was shown to significantly reduce axonal length and branching of adult sensory neurons in vitro.30 In Drosophila, synaptic development and function have been shown to be regulated by ubiquitin-dependent mechanisms.31 Taken together, these data point to an important role of the ubiquitin proteasome pathway in neuronal differentiation.

A few other human disorders have been recognized to result from mutations in genes involved in ubiquitination and proteasome function.32 Mutations in ligase genes from the ubiquitin enzymatic pathway were identified as causative for Angelman syndrome (MIM 105830) (UBE3A), recessive juvenile Parkinson disease (MIM 600116) (PARK2), autoimmune polyendocrinopathy syndrome type 1 (MIM 240300) (AIRE), and von Hippel-Lindau disease (MIM 193300) (VHL). To our knowledge, the UBE2A mutation described here is the first in a ubiquitin-conjugating enzyme gene to be associated with a human disease. As in the case of UBE3A mutations causing Angelman syndrome,33,34 mutation of UBE2A leads to neurodevelopmental anomalies.

UBE2A mutations may be exclusive to the novel mental retardation syndrome described here or may also cause different clinical pictures, including nonsyndromic mental retardation, as reported for other genes involved in XLMR.4 However, the failure to detect UBE2A mutations in 19 idiopathic XLMR-affected families mapped to intervals encompassing UBE2A suggests that mutations in this gene are not a common cause of XLMR, in keeping with most XLMR genes identified to date.

Acknowledgments

We are indebted to the Euro-MRX Consortium for providing families for mutation screening. This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo.

Web Resources

The accession numbers and URLs for data presented herein are as follows:

  1. Euro-MRX Consortium, http://www.euromrx.com/
  2. Genatlas, http://www.genatlas.org/
  3. GenBank, http://www.ncbi.nlm.nih.gov/Genbank/ (for UBE2A [accession number NP_003327], UBE2B [accession number NP_003328], Ube2a [accession numbers NP_062642 and NP_033484], ube2a [accession number NP_958430], ube2b [accession number NP_956013], and UbcD6 [accession number NP_524130])
  4. Greenwood Genetic Center, http://www.ggc.org/xlmr.htm (for the X-linked Mental Retardation Database [August 2005])
  5. NCBI, http://www.ncbi.nlm.nih.gov/
  6. Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim (for Danon disease, Angelman syndrome, recessive juvenile Parkinson disease, autoimmune polyendocrinopathy syndrome type 1, and von Hippel-Lindau disease)
  7. Primer3, http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi

References

  • 1.Mandel J-L, Chelly J (2004) Monogenic X-linked mental retardation: is it as frequent as currently estimated? The paradox of the ARX (Aristaless X) mutations. Eur J Hum Genet 12:689–693 10.1038/sj.ejhg.5201247 [DOI] [PubMed] [Google Scholar]
  • 2.Ropers H-H, Hamel BCJ (2005) X-linked mental retardation. Nat Rev Genet 6:46–57 10.1038/nrg1501 [DOI] [PubMed] [Google Scholar]
  • 3.Ross MT, Grafham DV, Coffey AJ, Scherer S, McLey K, Platzer M, Scherer S, et al (2005) The DNA sequence of the human X chromosome. Nature 434:325–337 10.1038/nature03440 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kleefstra T, Hamel BC (2005) X-linked mental retardation: further lumping, splitting and emerging phenotypes. Clin Genet 67:451–467 10.1111/j.1399-0004.2005.00434.x [DOI] [PubMed] [Google Scholar]
  • 5.Biancalana V, Beldjord C, Taillandier A, Szpiro-Tapia S, Cusin V, Gerson F, Philippe C, Mandel JL (2004) Five years of molecular diagnosis of fragile X syndrome (1997–2001): a collaborative study reporting 95% of the activity in France. Am J Med Genet A 129:218–224 10.1002/ajmg.a.30237 [DOI] [PubMed] [Google Scholar]
  • 6.Fishburn J, Turner G, Daniel A, Brookwell R (1983) The diagnosis and frequency of X-linked conditions in a cohort of moderately retarded males with affected brothers. Am J Med Genet 14:713–724 10.1002/ajmg.1320140413 [DOI] [PubMed] [Google Scholar]
  • 7.Conaway RC, Brower CS, Conaway JW (2002) Emerging roles of ubiquitin in transcription regulation. Science 296:1254–1258 10.1126/science.1067466 [DOI] [PubMed] [Google Scholar]
  • 8.Weissman AM (2001) Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol 2:169–178 10.1038/35056563 [DOI] [PubMed] [Google Scholar]
  • 9.Dover J, Schneider J, Tawiah-Boateng MA, Wood A, Dean K, Johnston M, Shilatifard A (2002) Methylation of histone H3 by COMPASS requires ubiquitination of histone H2B by RAD6. J Biol Chem 277:28368–28371 10.1074/jbc.C200348200 [DOI] [PubMed] [Google Scholar]
  • 10.Allen RC, Zoghbi HY, Mosele AB, Rosenblatt HM, Belmont JW (1992) Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 51:1229–1239 [PMC free article] [PubMed] [Google Scholar]
  • 11.Plenge RM, Stevenson RA, Lubs HA, Schwartz CE, Willard HF (2002) Skewed X-chromosome inactivation is a common feature of X-linked mental retardation disorders. Am J Hum Genet 71:168–173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Nishino I, Fu J, Tanji K, Yamada T, Shimojo S, Koori T, Mora M, Riggs JE, Oh SJ, Koga Y, Sue CM, Yamamoto A, Murakami N, Shanske S, Byrne E, Bonilla E, Nonaka I, DiMauro S, Hirano M (2000) Primary LAMP-2 deficiency causes X-linked vacuolar cardiomyopathy and myopathy (Danon disease). Nature 406:906–910 10.1038/35022604 [DOI] [PubMed] [Google Scholar]
  • 13.Arad M, Maron BJ, Gorham JM, Johnson WH Jr, Saul JP, Perez-Atayde AR, Spirito P, Wright GB, Kanter RJ, Seidman CE, Seidman JG (2005) Glycogen storage diseases presenting as hypertrophic cardiomyopathy. N Engl J Med 352:362–372 10.1056/NEJMoa033349 [DOI] [PubMed] [Google Scholar]
  • 14.Gecz J, Barnett S, Liu J, Hollway G, Donnelly A, Eyre H, Eshkevari HS, Baltazar R, Grunn A, Nagaraja R, Gilliam C, Peltonen L, Sutherland GR, Baron M, Mulley JC (1999) Characterization of the human glutamate receptor subunit 3 gene (GRIA3), a candidate for bipolar disorder and nonspecific X-linked mental retardation. Genomics 62:356–368 10.1006/geno.1999.6032 [DOI] [PubMed] [Google Scholar]
  • 15.Vervoort VS, Beachem MA, Edwards PS, Ladd S, Miller KE, de Mollerat X, Clarkson K, DuPont B, Schwartz CE, Stevenson RE, Boyd E, Srivastava AK (2002) AGTR2 mutations in X-linked mental retardation. Science 296:2401–2403 [DOI] [PubMed] [Google Scholar]
  • 16.Bienvenu T, Poirier K, Van Esch H, Hamel B, Moraine C, Fryns JP, Ropers HH, Beldjord C, Yntema HG, Chelly J (2003) Rare polymorphic variants of the AGTR2 gene in boys with non-specific mental retardation. J Med Genet 40:357–359 10.1136/jmg.40.5.357 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rozen S and Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, NJ, pp 365–386 [DOI] [PubMed] [Google Scholar]
  • 18.Gu XX, Decorte R, Marynen P, Fryns JP, Cassiman JJ, Raeymaekers P (1996) Localisation of a new gene for non-specific mental retardation to Xq22-q26 (MRX35). J Med Genet 33:52–55 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Claes S, Gu XX, Legius E, Lorenzetti E, Marynen P, Fryns JP, Cassiman JJ, Raeymaekers P (1996) Linkage analysis in three families with nonspecific X-linked mental retardation. Am J Med Genet 64:137–146 10.1002/(SICI)1096-8628(19960712)64:1<137::AID-AJMG24>3.0.CO;2-N [DOI] [PubMed] [Google Scholar]
  • 20.Claes S, Volcke P, Devriendt K, Holvoet M, Raeymaekers P, Cassiman JJ, Fryns JP (1999) Regional localization of a gene for nonspecific XLMR to Xp11.3-p11.23 (MRX51) and tentative localization of an MRX gene to Xq23-q26.1. Am J Med Genet 85:283–287 10.1002/(SICI)1096-8628(19990730)85:3<283::AID-AJMG19>3.0.CO;2-N [DOI] [PubMed] [Google Scholar]
  • 21.Raynaud M, Moizard MP, Dessay B, Briault S, Toutain A, Gendrot C, Ronce N, Moraine C (2000) Systematic analysis of X-inactivation in 19 XLMR families: extremely skewed profiles in carriers in three families. Eur J Hum Genet 8:253–258 10.1038/sj.ejhg.5200437 [DOI] [PubMed] [Google Scholar]
  • 22.Raynaud M, Ronce N, Ayrault AD, Francannet C, Malpuech G, Moraine C (1998) X-linked mental retardation with isolated growth hormone deficiency is mapped to Xq22-Xq27.2 in one family. Am J Med Genet 76:255–226 10.1002/(SICI)1096-8628(19980319)76:3<255::AID-AJMG10>3.0.CO;2-G [DOI] [PubMed] [Google Scholar]
  • 23.Koken MH, Reynolds P, Jaspers-Dekker I, Prakash L, Prakash S, Bootsma D, Hoeijmakers JH (1991) Structural and functional conservation of two human homologs of the yeast DNA repair gene RAD6. Proc Natl Acad Sci USA 88:8865–8869 10.1073/pnas.88.20.8865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Koken MH, Hoogerbrugge JW, Jasper-Dekker I, de Wit J, Willemsen R, Roest HP, Grootegoed JA, Hoeijmakers JH (1996) Expression of the ubiquitin-conjugating DNA repair enzymes HHR6A and B suggests a role in spermatogenesis and chromatin modification. Dev Biol 173:119–132 10.1006/dbio.1996.0011 [DOI] [PubMed] [Google Scholar]
  • 25.Roest HP, Baarends WM, de Wit J, van Klaveren JW, Wassenaar E, Hoogerbrugge JW, van Cappellen WA, Hoeijmakers JH, Grootegoed JA (2004) The ubiquitin-conjugating DNA repair enzyme HR6A is a maternal factor essential for early embryonic development in mice. Mol Cell Biol 24:5485–5489 10.1128/MCB.24.12.5485-5495.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Roest HP, van Klaveren J, de Wit J, van Gurp CG, Koken MH, Vermey M, van Roijen JH, Hoogerbrugge JW, Vreeburg JT, Baarends WM, Bootsma D, Grootegoed JA, Hoeijmakers JH (1996) Inactivation of the HR6B ubiquitin-conjugating DNA repair enzyme in mice causes male sterility associated with chromatin modification. Cell 86:799–810 10.1016/S0092-8674(00)80154-3 [DOI] [PubMed] [Google Scholar]
  • 27.Hatakeyama S, Yada M, Matsumoto M, Ishida N, Nakayama KI (2001) U box proteins as a new family of ubiquitin-protein ligases. J Biol Chem 276:33111–33120 10.1074/jbc.M102755200 [DOI] [PubMed] [Google Scholar]
  • 28.Suzumori N, Burns KH, Yan W, Matzuk MM (2003) RFPL4 interacts with oocyte proteins of the ubiquitin-proteasome degradation pathway. Proc Natl Acad Sci USA 100:550–555 10.1073/pnas.0234474100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Obin M, Mesco E, Gong X, Haas AL, Joseph J, Taylor A (1999) Neurite outgrowth in PC12 cells. Distinguishing the roles of ubiquitylation and ubiquitin-dependent proteolysis. J Biol Chem 274:11789–11795 10.1074/jbc.274.17.11789 [DOI] [PubMed] [Google Scholar]
  • 30.Kavakebi P, Hausott B, Tomasino A, Ingorokva S, Klimaschewski L (2005) The N-end rule ubiquitin-conjugating enzyme, HR6B, is up-regulated by nerve growth factor and required for neurite outgrowth. Mol Cell Neurosci 29:559–568 10.1016/j.mcn.2005.04.008 [DOI] [PubMed] [Google Scholar]
  • 31.DiAntonio A, Haghighi AP, Portman SL, Lee JD, Amaranto AM, Goodman CS (2001) Ubiquitination-dependent mechanisms regulate synaptic growth and function. Nature 412:449–452 10.1038/35086595 [DOI] [PubMed] [Google Scholar]
  • 32.Jiang, YH, Beaudet AL (2004) Human disorders of ubiquitination and proteasomal degradation. Curr Opin Pediatr 16:419–426 10.1097/01.mop.0000133634.79661.cd [DOI] [PubMed] [Google Scholar]
  • 33.Kishino T, Lalande M, Wagstaff J (1997) UBE3A/E6-AP mutations cause Angelman syndrome. Nat Genet 15:70–73 (erratum 15:411) 10.1038/ng0197-70 [DOI] [PubMed] [Google Scholar]
  • 34.Matsuura T, Sutcliffe JS, Fang P, Galjaard RJ, Jiang YH, Benton CS, Rommens JM, Beaudet AL (1997) De novo truncating mutations in E6-AP ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nat Genet 15:74–77 10.1038/ng0197-74 [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Human Genetics are provided here courtesy of American Society of Human Genetics

RESOURCES