High-Level Mupirocin Resistance within Methicillin-Resistant Staphylococcus aureus Pandemic Lineages

Abstract

The methicillin-resistant Staphylococcus aureus (MRSA) population in the Hospital Universitario Nuestra Señora de Candelaria over a 5-year period (1998 to 2002) was marked by shifts in the circulation of pandemic clones. Here, we investigated the emergence of high-level mupirocin resistance (Hi-Mup^r). In addition to clonal spread, transfer of ileS2-carrying plasmids played a significant role in the dissemination of Hi-Mup^r among pandemic MRSA lineages.

Most hospital-acquired methicillin-resistant Staphylococcus aureus (MRSA) isolates are members of five MRSA pandemic lineages or clonal complexes (CCs), namely, CC5, CC8, CC22, CC30, and CC45 (6, 14). Mupirocin constitutes the cornerstone of avoidance of MRSA carriage and ulterior infection, but resistance has emerged, and its spreading is worrisome, with transferable high-level mupirocin resistance (Hi-Mup^r) being of clinical significance (3, 4, 5, 11, 23, 25). Hi-Mup^r is associated with an additional isoleucyl-tRNA synthetase that is encoded by the ileS2 gene (8, 10). The ileS2 gene was commonly reported on plasmids that differed in size, restriction patterns, and ability to be transferred in conjugation experiments (12, 13, 16, 21, 24, 26).

We reported that 95.5% of the 375 MRSA isolates obtained from patients at Hospital Universitario Nuestra Señora de Candelaria (located in Tenerife, Canary Islands, Spain) between 1998 and 2002 belonged to six clones fitting in pandemic lineages (i.e., CC5, CC8, CC22, and CC30) (20). In the present work, we investigated Hi-Mup^r in such a staphylococcal population.

(Parts of this work were presented during the 1st International Workshop for Origin and Evolution of Bacterial Pathogens, Baeza, Spain, October 2004, and during the XX Congreso Nacional de Microbiología, Cáceres, Spain, September 2005.)

Isolates were screened for mupirocin resistance by the diskdiffusion and Etest methods (7, 15). The ileS2 gene was detected by a multiplex PCR (17, 18). Plasmid DNA was extracted with the QIAprep spin plasmid kit (QIAGEN, Hilden, Germany) with the addition of lysostaphin (Sigma Chemical Co., St. Louis, Mo.) and digested with EcoRI and HindIII. Curing of plasmids and conjugation experiments were performed as previously described (24). The primers used are listed in Table 1.

TABLE 1.

Amplification and sequencing primers used in this study

Target gene	Primer namea	Sequence (5′-3′)	Reference or source	GenBank accession no.	Predicted PCR product size (bp)
Amplification
ileS2	MupA	TATATTATGCGATGGAAGGTTGG	1		458
	MupB	AATAAAATCAGCTGGAAGTGTTG
traD-traE	TraD-E.F	GTAGCACAATTAGATCATGCAGTG	This study	NC_005024	212
	TraD-E.R	TGCCATAATCATAAACTCCCTTC
traK	TraK-F	TTGCCGAAGATAGCGAATTG	This study	NC_005024	1,888
	TraK-R	CTGCAATACCTTCGGTCAGTTC
Sequencing
traK	TraK-R1	CGCCACTAGGGTCAGTTACAAC	This study	NC_005024
	TraK-F2	GTCAGCTGGGTATGTTATTCCTAATG	This study	NC_005024
	TraK-R2	GGGTGGTCTTTAGATAATTCATTAAAGC	This study	NC_005024
	TraK-F3	AACCTAATCAAGATGAAGAAGGATCAG	This study	NC_005024
	TraK-R3	ATATTTGGCCATTCGTCTAG	This study	NC_005024
	TraK-F4	CTTCTCTCAAATGTTCCAACAGC	This study	NC_005024
	TraK-R4	GCTTTATCCTGTTGCATATTAC	This study	NC_005024
	TraK-F5	GCTACACTGGAAGGGCATTACTAAATG	This study	NC_005024
	TraK-R5	TTCGTAGAATGCTTTCTTAG	This study	NC_005024

^aTraK-F and TraK-R primers were used in amplification and sequencing.

The ileS2 locus was associated with conjugative plasmids in each Hi-Mup^r isolate.

Hi-Mup^r was manifested by 48 MRSA isolates (12.8%) (Table 2) and increased significantly from 0% in 1998 to 15.6% in 2002 (P < 0.001). Each Hi-Mup^r isolate belonged to one of the six major MRSA clones and amplified the ileS2 gene fragment. Non-Hi-Mup^r isolates did not show the ileS2 amplicon. Pulsed-field gel electrophoresis (PFGE) subtypes shown by Hi-Mup^r isolates, excepting PFGE subtype B4, also included mupirocin-susceptible isolates, suggesting intrahospital acquisition of Hi-Mup^r by circulating clones.

TABLE 2.

Phenotypic and genotypic characteristics of high-level mupirocin-resistant MRSA isolates

MRSA clone (lineage)b and isolate no.	Isolation date (day/mo/yr)	Hospital wardc	Sample origind	PFGE subtypeb	HindIII-REAP patterne	ileS2 locus polymorph	ileS2-carrying plasmid type	Resistance transferred to standard recipientf
ST125-IVA (CC5)
HUNSC-356	06/11/2001	Internal medicine	Wound	C1	XI	E	pMUP2	+
HUNSC-364	29/11/2001	Internal medicine	Sputum	C1	XI	E	pMUP2	ND
HUNSC-414	22/03/2002	Internal medicine	Nasal exudate	C1	XI	E	pMUP2	ND
HUNSC-453	22/05/2002	Internal medicine	Wound	C1	XII	E	pMUP2	+
HUNSC-464	20/06/2002	Internal medicine	Sputum	C1	XI	E	pMUP2	ND
HUNSC-485	28/08/2002	Vascular surgery	Wound	C1	XII	E	pMUP2	ND
HUNSC-488	03/09/2002	ICU	BAS	C1	XIII	E	pMUP2	+
HUNSC-492	13/09/2002	Internal medicine	Nasal exudate	C1	XI	E	pMUP2	ND
HUNSC-505	07/10/2002	Vascular surgery	Wound	C1	XIII	E	pMUP2	ND
HUNSC-510	23/10/2002	Vascular surgery	Wound	C1	XIII	E	pMUP2	ND
HUNSC-523	13/11/2002	Vascular surgery	Wound	C1	XIV	E	pMUP2	+
HUNSC-525	19/11/2002	Vascular surgery	Wound	C1	XIV	E	pMUP2	ND
HUNSC-534	12/12/2002	Internal medicine	Nasal exudate	C1	XV	E	pMUP2	+
HUNSC-535	12/12/2002	Internal medicine	Nasal exudate	C1	XV	E	pMUP2	ND
HUNSC-537	17/12/2002	Internal medicine	Nasal exudate	C1	XV	E	pMUP2	ND
HUNSC-538	17/12/2002	Internal medicine	Nasal exudate	C1	XV	E	pMUP2	ND
HUNSC-540	18/12/2002	Internal medicine	Nasal exudate	C1	XV	E	pMUP2	ND
HUNSC-541	31/12/2002	Internal medicine	Nasal exudate	C1	XV	E	pMUP2	ND
ST146-IVA (CC5)         HUNSC-521	09/11/2002	Hematology	Wound	D1	V	A	pMUP4	ND
ST247-IA (CC8)
HUNSC-229	04/05/2000	Vascular surgery	Sputum	A1	I	D	pMUP1	+
HUNSC-246	08/04/2000	ICU	Blood	A1	I	D	pMUP1	ND
HUNSC-267	07/11/2000	Neurology	BAS	A1	I	D	pMUP1	ND
HUNSC-268	14/08/2000	Neurology	Wound	A1	I	D	pMUP1	ND
HUNSC-182	19/01/1999	ICU	BAS	A2	II	D	pMUP1	+
HUNSC-183	09/02/1999	ICU	BAS	A2	II	D	pMUP1	ND
HUNSC-242	29/06/2000	General surgery	Wound	A6	I	D	pMUP1	ND
HUNSC-243	04/07/2000	General surgery	Blood	A6	I	D	pMUP1	ND
HUNSC-244	07/07/2000	General surgery	Catheter	A6	I	D	pMUP1	ND
HUNSC-264	16/10/2000	Digestive surgery	Wound	A8	III	E	pMUP2	+
ST22-IV (CC22)
HUNSC-684	21/10/2002	Dermatology	Wound	E1	XVI	E	pMUP2	+
HUNSC-799	06/04/2002	Vascular surgery	Wound	E1	XVI	E	pMUP2	ND
ST36-II (CC30)
HUNSC-234	06/06/2000	Vascular surgery	Wound	B1	IV	B	pMUP3	+
HUNSC-238	14/06/2000	Vascular surgery	Wound	B1	IV	B	pMUP3	ND
HUNSC-256	11/08/2000	Internal medicine	Wound	B1	V	A	pMUP4	ND
HUNSC-277	14/02/2001	Internal medicine	Nasal exudate	B1	V	A	pMUP4	+
HUNSC-298	04/04/2001	Traumatology	Wound	B1	VI	E	pMUP5	+
HUNSC-319	14/05/2001	Internal medicine	Wound	B1	VI	E	pMUP5	ND
HUNSC-326	25/06/2001	Internal medicine	Nasal exudate	B1	V	A	pMUP4	ND
HUNSC-339	30/07/2001	Traumatology	Wound	B1	VII	E	pMUP6	ND
HUNSC-363	01/12/2001	Vascular surgery	Blood	B1	VIII	C	pMUP7	+
HUNSC-393	11/02/2002	Thoracic surgery	Sputum	B1	IX	A	pMUP8	+
HUNSC-396	19/02/2002	Internal medicine	Wound	B1	IX	A	pMUP8	ND
HUNSC-401	02/03/2002	Traumatology	Wound	B1	VI	E	pMUP5	ND
HUNSC-491	10/09/2002	General surgery	Wound	B1	X	D	pMUP9	+
HUNSC-499	30/09/2002	Traumatology	Catheter	B1	I	D	pMUP1	ND
HUNSC-503	07/10/2002	Traumatology	Wound	B1	I	D	pMUP1	ND
HUNSC-459	06/06/2002	U. medicine	Wound	B4	VII	E	pMUP6	+
HUNSC-489	03/09/2002	Cardiology	Wound	B4	VII	E	pMUP6	ND

^aEach Hi-Mup^r isolate showed a MIC of ≥1,024 μg/ml.

^bResults of PFGE, multilocus sequence, and staphylococcal chromosome cassette typing were already included in the analysis of MRSA clones (20).

^cICU, intensive care unit; U. medicine, urgency medicine.

^dBAS, bronchial aspirate.

^ePatterns obtained from total plasmid DNA.

^fND, not determined; +, isolate produced transconjugants.

HindIII restriction endonuclease analysis of plasmid DNA (REAP) revealed 16 patterns (i.e., I to XVI) (Table 2), each hybridizing with the ileS2-specific probe. Thus, the ileS2 gene was harbored by plasmids; this result was consistent with data from previous studies (12, 21). The different sizes of ileS2-hybridizing plasmid fragments permitted five polymorphs of the ileS2 locus (i.e., A to E) to be distinguished. Polymorphs A, B, D, and E were characterized by a single HindIII-hybridizing fragment, while polymorph C was defined by two hybridizing fragments (Tables 2 and 3).

TABLE 3.

Structural group, ileS2 locus polymorph, and clonal complex distribution of Hi-Mup^r plasmid types

Structural group	ileS2 locus polymorph	Size(s) (kb) of restriction fragments hybridizing with the ileS2 probea	ileS2-carrying plasmid type (kb)b	No. of isolates (%)	MRSA clone(s)	Clonal complex(es)
S1	A	4.3	pMUP4 (26)	4 (8.3)	ST146-IVA, ST36-II	CC5, CC30
			pMUP8 (41)	2 (4.2)	ST36-II	CC30
S2	B	5.0	pMUP3 (34)	2 (4.2)	ST36-II	CC30
	C	4.7, 5.0	pMUP7 (39)	1 (2.1)	ST36-II	CC30
S3	D	5.2	pMUP1 (33)	11 (22.9)	ST247-IA, ST36-II	CC8, CC30
			pMUP9 (35)	1 (2.1)	ST36-II	CC30
S4	E	5.5	pMUP2 (40)	21 (43.8)	ST125-IVA, ST247-IA, ST22-IV	CC5, CC8, CC22
			pMUP5 (47)	3 (6.2)	ST36-II	CC30
			pMUP6 (46)	3 (6.2)	ST36-II	CC30

^aAproximated sizes by comparison with a lambda HindIII marker.

^bPlasmid sizes were determined by summation of restriction fragments using agarose gel electrophoresis following separate digestions with EcoRI and HindIII.

One Hi-Mup^r isolate of each restriction endonuclease analysis pattern (n = 16) was randomly selected for conjugation assays. The Hi-Mup^r was transferred from each isolate (Table 2). Overall, nine different ileS2-carrying plasmids (i.e., pMUP1 to pMUP9) were identified in transconjugants (Fig. 1). Susceptibility tests and curing experiments support that idea that these plasmids mediate Hi-Mup^r. Plasmids differed from each other by at least one HindIII restriction fragment, but some bands in common permitted four structural groups (i.e., S1 to S4) to be distinguished (Table 3). EcoRI digestions corroborated these results (data not shown). Plasmids included in each group displayed the same ileS2 locus polymorph (Fig. 1A1). The exception was group S2, given that plasmids pMUP3 and pMUP7 showed different polymorphs due to an additional ileS2-hybridizing fragment in pMUP7, which appeared as a double-intensity ca. 4.7-kb HindIII band, suggesting the existence of two copies of the ileS2 gene in pMUP7 (Fig. 1A, lane 7). Plasmids belonging to distinct groups differed from each other by at least five bands and showed different polymorphs.

FIG. 1.

Analysis of ileS2-carrying plasmid types by restriction endonuclease analysis and Southern hybridization. (A) HindIII restriction patterns of plasmid types extracted from S. aureus transconjugants of Hi-Mup^r MRSA isolates. ▸, ileS2-hybridizing fragments. (A1) Southern hybridization with the ileS2-containing DNA as a probe, showing the different ileS2 polymorphs (A to E). (A2) Southern hybridization using the traK DNA fragment as probe. Lanes 1 through 9, plasmid types pMUP1 to pMUP9. λ, lambda phage DNA digested with HindIII and digoxigenin labeled as a molecular size standard. Numbers on the right correspond to the molecular sizes (in base pairs) of λ DNA HindIII restriction fragments.

ileS2-carrying plasmids are related to the pSK41 family of staphylococcal multiresistance plasmids.

It has been suggested that mupirocin resistance plasmids belong to the pSK41 family of staphylococcal conjugative plasmids (12) (the pSK41 sequence was obtained from GenBank, accession no. NC_005024). The putative relationship of pSK41 to ileS2-carrying plasmids was examined at the traK gene level. The traK gene of pSK41 is involved in the tra gene system for conjugation (2, 9). The traK gene was detected in each ileS2-carrying plasmid (Fig. 1A2). The nucleotide sequence of the open reading frame (1,641 bp) in the ca. 1.8-kb traK PCR products from plasmids included in groups S1 and S2 was identical to the pSK41 traK gene sequence. Group S3 plasmids showed 41 nucleotide differences, plus the insertion of 6 nucleotides, compared to the pSK41 traK sequence (>97% identity). The three plasmid types included in group S4 showed one nucleotide difference (>99% identity). These results indicated that the traK gene of pSK41 was conserved in ileS2-carrying plasmids. The plasmids included in groups S1, S2, and S4 had a single 4.7-kb traK-hybridizing fragment. The plasmids in group S3 presented a ca. 9-kb hybridization band. Additionally, the traD-traE region was detected in each Hi-Mup^r isolate and transconjugants. Our results are consistent with the concept of ileS2-carrying plasmids being members of the pSK41 family of conjugative plasmids.

Distribution of Hi-Mup^r plasmids among pandemic lineages (CCs).

Some of the ileS2-carrying plasmids were detected in the background of different MRSA clones belonging to different CCs (Tables 2 and 3), indicating plasmid transfer. Furthermore, we found plasmids of the four structural groups in the collection of Hi-Mup^r ST36-II epidemiologically related isolates. The emergence of Hi-Mup^r in ST36-II is of health concern because it is the predominant clone, completely replacing the Iberian clone (ST247-IA) (19, 20, 22). Unlike ST36-II isolates, Hi-Mup^r isolates belonging to clones ST125-IVA and ST22-IV shared a single, unique ileS2-carrying plasmid, which indicates clonal dissemination in the spread of Hi-Mup^r.

Conclusions.

All major MRSA pandemic clones already circulating in the hospital acquired ileS2-carrying plasmids, resulting in a multiclonal population structure. In addition to clonal spread and plasmid transfer, the finding of the ileS2 gene in plasmids differing in size and restriction patterns show that gene transposition constitutes an important mode of dissemination of Hi-Mup^r. Intervention strategies in the current scenario should identify dissemination of MRSA clones and/or ileS2-carrying mobile elements.

Nucleotide sequence accession numbers.

The nucleotide sequences of the entire traK homolog genes from mupirocin resistance plasmids pMUP1, pMUP2, pMUP3, pMUP4, pMUP5, pMUP6, pMUP7, pMUP8, and pMUP9 identified in this study have been deposited in GenBank under accession numbers DQ232628, DQ232629, DQ232630, DQ232631, DQ232632, DQ232633, DQ232634, DQ232635, and DQ232636, respectively.