Abstract
A multiplex real-time PCR assay was developed using molecular beacons for the detection of Vibrio cholerae by targeting four important virulence and regulatory genes. The specificity and sensitivity of this assay, when tested with pure culture and spiked environmental water samples, were high, surpassing those of currently published PCR assays for the detection of this organism.
The continual wave of outbreaks and pandemics all over the world caused by the bacterium Vibrio cholerae is a steady reminder of the immense importance of cholera as a global threat and a major public health problem (28). The disease may become life-threatening if appropriate therapy is not undertaken quickly; hence, fast, accurate, and sensitive detection of this organism is of foremost importance.
The use of PCR as a reliable molecular-biology-based technology has been reported for the detection of a variety of organisms. Although a significant number of PCR detection assays have been reported for V. cholerae, these reports mostly describe conventional, time-consuming, and laborious methods of PCR product characterization (1, 2, 4-6, 8, 11-15, 17, 19, 21-26). Real-time PCR analysis enables the detection of reaction products through fluorescence, which is faster and more sensitive. However, published real-time PCR assays for V. cholerae are few (9, 10, 16) and have limitations in sensitivity or detect no more than two genes simultaneously. Molecular beacons (MB), due to their stable stem-and-loop structure, have been demonstrated to be significantly more specific than dyes such as SYBR green I and other types of probes. The assay described here utilizes MB for the highly sensitive detection of four important V. cholerae genes by multiplex real-time PCR.
This assay was developed through significant modification of our previously developed fourplex real-time PCR assay, which used SYBR green I for detection (10). Three of the four targets were taken from the previously described assay: rtxA, epsM, and tcpA (10). The fourth gene target, ompW, was incorporated to replace the mshA target. It has been proposed that all V. cholerae strains, both toxigenic strains and nontoxigenic environmental isolates, contain this conserved gene sequence (19). As previously reported, the exploitation of a 68-bp deletion in tcpA within classical biotypes could give an indication of the presence of the El Tor/O139 biotype (10). Collectively, the four unique gene targets cover a range of gene sequences essential for the virulence and survival of V. cholerae.
The 51 bacterial strains used in this study (Table 1) were grown, and the DNA template was prepared, as described previously (10). Tenfold serial dilutions with the equivalent of 1 to 1 × 105 CFU of V. cholerae and 1 × 105 CFU of all the other bacterial species were then added directly to the PCR mixtures in order to determine the sensitivity and specificity of the assay.
TABLE 1.
Bacterial strains assayed by molecular-beacon real-time PCR
| Serogroup and strain | Sourcea (origin) | Detectionb of the indicated gene by:
|
|||||||
|---|---|---|---|---|---|---|---|---|---|
| Single PCR (1 × 103 CFU)
|
Multiplex PCR (1 × 105 to 5 CFU)c
|
||||||||
| rtxA | epsM | ompW | tcpA | rtxA | epsM | ompW | tcpA | ||
| V. cholerae O1 classical | |||||||||
| 11966 | A (Bangladesh, 1987) | + | + | + | − | + | + | + | − |
| AA14041 | A (Bangladesh, 1985) | + | + | + | − | + | + | + | − |
| Z17561 | A (Bangladesh, 1985) | + | + | + | − | + | + | + | − |
| Z17561 tcpA::kan (tcpA mutant) | A (University of Adelaide) | + | + | + | − | + | + | + | − |
| 0162 | C (India) | + | + | + | − | ||||
| 162 | C (India) | + | + | + | − | ||||
| 569B | C (Unknown) | + | + | + | − | ||||
| 569B-685RNM | C (Unknown) | + | + | + | − | ||||
| 35A3 | C (Unknown) | + | + | + | − | ||||
| 111-V585R | C (Unknown) | + | + | + | − | ||||
| 95 | C (India) | + | + | + | − | ||||
| V. cholerae El Tor | |||||||||
| N16961 | A (Unknown) | + | + | + | + | + | + | + | + |
| AA13993 | A (Bangladesh, 1985) | + | + | + | + | + | + | + | + |
| H1 | A (India, 1985) | + | + | + | + | + | + | + | + |
| H1 tcpA::kan (tcpA mutant) | A (University of Adelaide) | + | + | + | − | + | + | + | − |
| HP-51-1 | C (Thailand, 1972) | + | + | + | + | ||||
| BRL 7738 | C (1966) | + | + | + | + | ||||
| N107 | C (Unknown) | + | + | + | + | ||||
| VB1961 | C (Unknown) | + | + | + | + | ||||
| I-816 | C (Unknown) | + | + | + | + | ||||
| V. cholerae O139 | |||||||||
| AI-1838 | A (Bangladesh, 1993) | + | + | + | + | + | + | + | + |
| AI-1854 | A (Bangladesh, 1993) | + | + | + | + | + | + | + | + |
| AI-1855 | A (Bangladesh, 1993) | + | + | + | + | + | + | + | + |
| V. cholerae non-O1 | |||||||||
| V. cholerae non-O1 | B (Fairfield Hospital, Australia) | + | + | + | − | ||||
| H II (nonagglutinating)d | C (Hong Kong, 1963) | + | + | + | − | ||||
| Other Vibrio spp. | |||||||||
| V. anguillarum ATCC 19246e | ATCC | − | − | − | − | ||||
| V. alginolyticus | B (MDU, Australia) | − | − | − | − | ||||
| V. alginolyticus ATCC 17749 | ATCC | − | − | − | − | ||||
| V. campbellii ATCC 25920e | ATCC | − | − | − | − | ||||
| V. fischerie | B (Microtox kit strain 2000) | − | − | − | − | ||||
| V. fluvialis | A (Unknown) | − | − | − | − | ||||
| V. harveyi 179e (tentative name) | C (Unknown) | − | − | − | − | ||||
| V. mimicus | A (Unknown) | +/− | − | − | +/− | − | |||
| V. mimicus | B (Fairfield Hospital, Australia) | +/− | − | − | +/− | − | |||
| V. natriegens NCMB 857f | NCMB | − | − | − | − | ||||
| V. pagrus MIC-2e | C (Pagrus auratus) | − | − | − | − | ||||
| V. parahaemolyticus ATCC 17802 | ATCC | − | − | − | − | ||||
| V. parahaemolyticus NCTC10884 | NCTC | − | − | − | − | ||||
| V. parahaemolyticus NCTC10885 | NCTC | − | − | − | − | ||||
| V. vulnificus | B (RCPA, QAP 1995:8:4) | − | − | − | − | ||||
| V. vulnificus C7184 | CDC | − | − | − | − | ||||
| V. vulnificus C7184T | CDC | − | − | − | − | ||||
| Other bacteria | |||||||||
| Bacillus subtilis ATCC 6051f | ATCC | − | − | − | − | ||||
| Enterococcus faecalis 159905660 | Pathcentre, Perth, Australia | − | − | − | − | ||||
| Escherichia coli PA03M55679 | Pathcentre, Perth, Australia | − | − | − | − | ||||
| Klebsiella pneumoniae 106156559 | Pathcentre, Perth, Australia | − | − | − | − | ||||
| Pseudomonas aeruginosa PA03M2615 | Pathcentre, Perth, Australia | − | − | − | − | ||||
| Serratia marcescens 13023f | Pathcentre, Perth, Australia | − | − | − | − | ||||
| Shigella sonnei ATCC 9290 | ATCC | − | − | − | − | ||||
| Staphylococcus aureus ATCC 9144 | ATCC | − | − | − | − | ||||
| Yersinia enterocolitica W22703 | Melbourne University | − | − | − | − | ||||
A, Stephen Attridge, University of Adelaide; B, Celia McKenzie, Royal Melbourne Institute of Technology; C, University of New South Wales; MDU, Microbiological Diagnostics Unit; RCPA, Royal College of Pathologists of Australasia Quality Assurance Program.
Blank, not tested; +, specific amplified product detected; −, no amplified product detected; +/−, limited product detected.
All Vibrio spp. other than V. cholerae and all other bacterial species were assessed using 106 CFU.
Serotype unknown.
Grown at 25°C.
Grown at 30°C.
The primers for the newly incorporated ompW target (forward, AACATCCGTGGATTTGGCATCTG; reverse, GCTGGTTCCTCAACGCTTCTG) produced an amplicon of 89 bp and were used at a final concentration of 0.40 μM. The design and optimization of the other three primer pairs have been described previously (10). To enable simultaneous detection, each of the beacons was labeled with a different fluorophore (Table 2). Initially, each of the four primer pairs and molecular beacons was individually assessed. Following this, each individual assay was incorporated stepwise to form a single, optimized multiplex assay capable of the simultaneous real-time PCR detection of all four target sequences in a single reaction.
TABLE 2.
Molecular beacon probes used in this study
| Target gene | Beacon | Sequence (5′-3′)a | Size (bp) | Fluorophore | Quencher | Concnb (μM) multiplex |
|---|---|---|---|---|---|---|
| rtxA | MBrtxA | CGCGATCACCAGAGCGCCAAGAAGTGACTCGTAGATCGCG | 40 | FAMc | Dabcyl | 0.25 |
| epsM | MBepsM | CGCGATGCCACCGACATCGTAACGCTCCGATCGCG | 35 | Texas Red | BHQ2 | 0.25 |
| ompW | MBompW | CCGAAGAAACAACGGCAACCTACAAAGCTTCGG | 33 | Cy5 | BHQ3 | 0.25 |
| tcpA | MBtcpA | CGCGACGCTGAAACCTTACCAAGGCTGACCAAGTCGCG | 38 | Cy3 | BHQ2 | 0.50 |
Molecular beacons were designed using Beacon Designer (version 2.12) software from Premier Biosoft (Palo Alto, CA). Underlined nucleotides indicate the stem sequence of each molecular beacon. MBrtxA, MBepsM, and MBompW were synthesized by TIB MOLBIOL (Berlin, Germany). MBtcpA was synthesized by Proligo (Helios, Singapore).
Remaining PCR constituents were 2 U of FastStart Taq DNA polymerase, 1× PCR buffer, 4 mM MgCl2, 200 μM each deoxynucleoside triphosphate (all from Roche Diagnostics, Laval, Quebec, Canada), and 2 μl of template DNA in a 25-μl final volume.
FAM, 6-carboxyfluorescein.
The results obtained for the analysis of all 51 strains using the developed multiplex PCR assay indicated 100% specificity for all of the V. cholerae strains examined (Table 1). The only exception was the presence of a weak fluorescent signal, indicating the presence of small amounts of amplified product, for the ompW sequence with the two V. mimicus strains. This signal, however, appeared late in the amplification protocol, and upon the addition of fewer cells (1 × 103 CFU), the signal was no longer detected, indicating that the amplified product was not specific. Since limited genetic sequence data are publicly available for V. mimicus, it is not possible to preclude the presence of a similar gene in this organism. The rtxA, epsM, and ompW gene targets were detected in all of the V. cholerae strains, and the El Tor-type tcpA gene target, as previously reported, was correctly detected only for the O1 El Tor and O139 strains (10). PCR analysis of the non-O1 isolate failed to generate a product for the El Tor-type tcpA target. However, this lack of detection could be due to the fact that this strain contained a different allele of the gene (3, 7, 18, 20).
The limit of detection of this fourplex assay, when tested by the addition of 10-fold serial dilutions of heat-lysed V. cholerae cells, was very low: the assay routinely detected as few as 5 CFU per reaction (Fig. 1). This sensitivity was good and in most cases significantly better than other described PCR detection limits for V. cholerae (1, 8, 11, 12, 16, 17, 24-26).
FIG. 1.
Representative PCR amplification profile obtained from the fourplex real-time PCR analysis of products amplified from serially diluted heat-lysed V. cholerae AI-1838. All four targets—rtxA (A), epsM (B), ompW (C), and tcpA (D)—were detected simultaneously by the four different molecular beacons. To determine the limit of detection of the assay, the dilutions contained the following CFU of V. cholerae: 1 × 105 (▪), 1 × 104 (•), 1 × 103 (▴), 1 × 102 (▸), 10 (⧫), 5 (□), and 1 (○). ▵, negative control. The optimized multiplex PCR amplification profile consisted of 150 s at 95°C, followed by 45 cycles of three steps consisting of 30 s at 95°C, 60 s at 60°C, and 30 s at 72°C using the Smart Cycler (Cepheid, Sunnyvale, Calif.). Fluorescence signals emitted from the molecular beacon were measured at the end of each annealing step. Each analysis was repeated multiple times to ensure the reproducibility of results.
To determine the applicability of the multiplex assay to the detection of V. cholerae from a model environmental niche, five different environmental water samples were collected and analyzed by the multiplex PCR assay (10). Initial PCR analysis performed directly on the collected water samples indicated that no detectable levels of naturally occurring V. cholerae were present in these samples. PCR analysis was performed directly on spiked water samples containing 10, 102, or 103 CFU of V. cholerae or 105 CFU of the other Vibrio spp. (Table 3). Analysis of water samples spiked with the mixture of non-V. cholerae Vibrio spp. resulted in the detection of a weak amplification signal, indicating small amounts of the ompW amplified product, synonymous with the findings obtained when the assay was tested using pure heat-lysed V. mimicus cells. Analysis of the samples spiked with V. cholerae resulted in the detection of the bacteria at 103 CFU per reaction, except for the seawater sample, which possibly inhibited the reaction due to its high salt content. In comparison, this was a 10-fold improvement over the 104-CFU limit of detection for the previously described SYBR green I assay (10). Upon the addition of 100 and 10 CFU of V. cholerae, the multiplex MB assay was capable of detecting the organism, although with some variability.
TABLE 3.
Fourplex detection of V. cholerae from spiked water samples
| Source | Detection of V. choleraea in:
|
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Unprocessed samples (LOD, 103 CFU/reaction)
|
Isolated DNA (LOD, 10 CFU/reaction)
|
|||||||||
| 11966 | N16961 | AI-1839 | Vibriob | − C | 11966 | N16961 | AI-1839 | Vibrio | − C | |
| Sea (Port Phillip Bay, Melbourne, Australia) | − | − | − | +/− | − | + | + | + | +/− | − |
| Estuarine (Yarra River, Melbourne, Australia) | + | + | + | +/− | − | + | + | + | +/− | − |
| River (Plenty River, Victoria, Australia) | + | + | + | +/− | − | + | + | + | +/− | − |
| Dam (South Morang, Victoria, Australia) | + | + | + | +/− | − | + | + | + | +/− | − |
| Commercial spring water | + | + | + | +/− | − | + | + | + | +/− | − |
LOD, limit of detection; − C, negative control (unspiked water sample); +, specific amplified product detected; −, no amplified product detected; +/−, limited product detected (ompW only).
Vibrio, a mixture of V. fluvialis, V. parahaemolyticus, V. alginolyticus, V. mimicus, and V. vulnificus at 1 × 105 CFU of each strain per PCR.
With the aim of increasing the sensitivity, DNA was extracted from the spiked water samples to remove inhibitory substances by using InstaGene Matrix (Bio-Rad) (10). Fourplex PCR analysis of this semipurified DNA resulted in the routine detection of as few as 10 V. cholerae CFU (lower dilutions were not assessed). This was a significant improvement over the previously described SYBR green I assay, which had a detection limit of 103 CFU per reaction (10). Several groups have similarly employed a DNA extraction step prior to PCR analysis of environmental water samples for V. cholerae (12, 15, 16, 23, 27). In comparison, a major advantage of the DNA extraction method used in this study is that it can be easily adapted to filter very large volumes of water. This can effectively provide an even greater capacity to detect low numbers of V. cholerae in large volumes of water.
Through the use of molecular beacons for the simultaneous detection of four target genes, the specificity and sensitivity of this assay surpass those of the published PCR assays for the detection of V. cholerae. The application of the assay to environmental water samples suggests that the assay could be used for the sensitive and cost-effective monitoring of environmental and drinking water samples. Importantly, this assay is the first to apply molecular beacons for the detection of V. cholerae and is the first fourplex molecular-beacon real-time PCR assay published for the detection of a single bacterial species.
REFERENCES
- 1.Albert, M. J., D. Islam, S. Nahar, F. Qadri, S. Falklind, and A. Weintraub. 1997. Rapid detection of Vibrio cholerae O139 Bengal from stool specimens by PCR. J. Clin. Microbiol. 35:1633-1635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Aridgides, L. J., M. A. Doblin, T. Berke, F. C. Dobbs, D. O. Matson, and L. A. Drake. 2004. Multiplex PCR allows simultaneous detection of pathogens in ships' ballast water. Mar. Pollut. Bull. 48:1096-1101. [DOI] [PubMed] [Google Scholar]
- 3.Chakraborty, S., A. K. Mukhopadhyay, R. K. Bhadra, A. N. Ghosh, R. Mitra, T. Shimada, S. Yamasaki, S. M. Faruque, Y. Takeda, R. R. Colwell, and G. B. Nair. 2000. Virulence genes in environmental strains of Vibrio cholerae. Appl. Environ. Microbiol. 66:4022-4028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chow, K. H., T. K. Ng, K. Y. Yuen, and W. C. Yam. 2001. Detection of RTX toxin gene in Vibrio cholerae by PCR. J. Clin. Microbiol. 39:2594-2597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chowdhury, M. A., R. T. Hill, and R. R. Colwell. 1994. A gene for the enterotoxin zonula occludens toxin is present in Vibrio mimicus and Vibrio cholerae O139. FEMS Microbiol. Lett. 119:377-380. [DOI] [PubMed] [Google Scholar]
- 6.Di Pinto, A., G. Ciccarese, G. Tantillo, D. Catalano, and V. T. Forte. 2005. A collagenase-targeted multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus. J. Food Prot. 68:150-153. [DOI] [PubMed] [Google Scholar]
- 7.Faruque, S. M., M. Kamruzzaman, I. M. Meraj, N. Chowdhury, G. B. Nair, R. B. Sack, R. R. Colwell, and D. A. Sack. 2003. Pathogenic potential of environmental Vibrio cholerae strains carrying genetic variants of the toxin-coregulated pilus pathogenicity island. Infect. Immun. 71:1020-1025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Fields, P. I., T. Popovic, K. Wachsmuth, and O. Olsvik. 1992. Use of polymerase chain reaction for detection of toxigenic Vibrio cholerae O1 strains from the Latin American cholera epidemic. J. Clin. Microbiol. 30:2118-2121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Fukushima, H., Y. Tsunomori, and R. Seki. 2003. Duplex real-time SYBR green PCR assays for detection of 17 species of food- or waterborne pathogens in stools. J. Clin. Microbiol. 41:5134-5146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gubala, A. J. 2005. Multiplex real-time PCR detection of Vibrio cholerae. J Microbiol. Methods 65:278-293. (First published 8 September 2005; doi: 10.1016/j.mimet.2005.07.017.) [DOI] [PubMed] [Google Scholar]
- 11.Hoshino, K., S. Yamasaki, A. K. Mukhopadhyay, S. Chakraborty, A. Basu, S. K. Bhattacharya, G. B. Nair, T. Shimada, and Y. Takeda. 1998. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol. Med. Microbiol. 20:201-207. [DOI] [PubMed] [Google Scholar]
- 12.Kapley, A., and H. J. Purohit. 2001. Detection of etiological agent for cholera by PCR protocol. Med. Sci. Monit. 7:242-245. [PubMed] [Google Scholar]
- 13.Keasler, S. P., and R. H. Hall. 1993. Detecting and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction. Lancet 341:1661. [DOI] [PubMed] [Google Scholar]
- 14.Kong, R. Y., S. K. Lee, T. W. Law, S. H. Law, and R. S. Wu. 2002. Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR. Water Res. 36:2802-2812. [DOI] [PubMed] [Google Scholar]
- 15.Lipp, E. K., I. N. Rivera, A. I. Gil, E. M. Espeland, N. Choopun, V. R. Louis, E. Russek-Cohen, A. Huq, and R. R. Colwell. 2003. Direct detection of Vibrio cholerae and ctxA in Peruvian coastal water and plankton by PCR. Appl. Environ. Microbiol. 69:3676-3680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lyon, W. J. 2001. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure cultures, raw oysters, and synthetic seawater. Appl. Environ. Microbiol. 67:4685-4693. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Morin, N. J., Z. Gong, and X. F. Li. 2004. Reverse transcription-multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Vibrio cholerae O1, and Salmonella Typhi. Clin. Chem. 50:2037-2044. [DOI] [PubMed] [Google Scholar]
- 18.Mukhopadhyay, A. K., S. Chakraborty, Y. Takeda, G. B. Nair, and D. E. Berg. 2001. Characterization of VPI pathogenicity island and CTXφ prophage in environmental strains of Vibrio cholerae. J. Bacteriol. 183:4737-4746. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Nandi, B., R. K. Nandy, S. Mukhopadhyay, G. B. Nair, T. Shimada, and A. C. Ghose. 2000. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J. Clin. Microbiol. 38:4145-4151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Novais, R. C., A. Coelho, C. A. Salles, and A. C. Vicente. 1999. Toxin-co-regulated pilus cluster in non-O1, non-toxigenic Vibrio cholerae: evidence of a third allele of pilin gene. FEMS Microbiol. Lett. 171:49-55. [DOI] [PubMed] [Google Scholar]
- 21.Panicker, G., D. R. Call, M. J. Krug, and A. K. Bej. 2004. Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays. Appl. Environ. Microbiol. 70:7436-7444. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Rivera, I. N., J. Chun, A. Huq, R. B. Sack, and R. R. Colwell. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl. Environ. Microbiol. 67:2421-2429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Rivera, I. N., E. K. Lipp, A. Gil, N. Choopun, A. Huq, and R. R. Colwell. 2003. Method of DNA extraction and application of multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae O1 and O139 from aquatic ecosystems. Environ. Microbiol. 5:599-606. [DOI] [PubMed] [Google Scholar]
- 24.Shangkuan, Y. H., Y. S. Show, and T. M. Wang. 1995. Multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae and to biotype Vibrio cholerae O1. J. Appl. Bacteriol. 79:264-273. [DOI] [PubMed] [Google Scholar]
- 25.Shirai, H., M. Nishibuchi, T. Ramamurthy, S. K. Bhattacharya, S. C. Pal, and Y. Takeda. 1991. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae. J. Clin. Microbiol. 29:2517-2521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Singh, D. V., S. R. Isac, and R. R. Colwell. 2002. Development of a hexaplex PCR assay for rapid detection of virulence and regulatory genes in Vibrio cholerae and Vibrio mimicus. J. Clin. Microbiol. 40:4321-4324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Theron, J., J. Cilliers, M. Du Preez, V. S. Brozel, and S. N. Venter. 2000. Detection of toxigenic Vibrio cholerae from environmental water samples by an enrichment broth cultivation-pit-stop seminested PCR procedure. J. Appl. Microbiol. 89:539-546. [DOI] [PubMed] [Google Scholar]
- 28.WHO. 23. September 2005, posting date. Health topics: cholera. [Online.] http://www.who.int/topics/cholera/en/.