Physical Linkage to Drug Resistance Genes Results in Conservation of var Genes among West Pacific Plasmodium falciparum Isolates

Abstract

The multicopy var gene family encoding the variant surface antigen Plasmodium falciparum erythrocyte membrane protein 1 is highly diverse, with little overlap between different P. falciparum isolates. We report 5 var genes (varS1–varS5) that are shared at relatively high frequency among 63 genetically diverse P. falciparum isolates collected from 5 islands in the West Pacific region. The varS1, varS2, and varS3 genes were localized to the internal region on chromosome 4, ∼200 kb from pfdhfr-ts, whereas varS4 and varS5 were mapped to an internal region of chromosome 7, within 100 kb of pfcrt. The presence of varS2 and varS3 were significantly correlated with the pyrimethamine-resistant pfdhfr genotype, whereas varS4 was strongly correlated with the chloroquine-resistant pfcrt genotype. Thus, the conservation of these var genes is the result of their physical linkage with drug-resistant genes in combination with the antimalarial drug pressure in the region.

Much of the mortality associated with Plasmodium falciparum malaria is attributable to the parasite's cytoadherent properties, which enable it to sequester in the microvasculature of several host organs [1-3]. One of these membrane proteins is P. falciparum erythrocyte membrane protein 1 (PfEMP1), a set of variant proteins responsible for antigenic variation [3, 4], cytoadherence [5-8], rosetting [9, 10], and immunoregulatory activities [11, 12]. PfEMP1 is encoded by the highly polymorphic var gene family, which has ∼50–60 genes per haploid genome [13, 14].

Studies of African and West Pacific P. falciparum isolates that measured the sequence diversity of the Duffy binding–like domain 1 (DBL1α) region have indicated that var gene repertoires are highly diverse and share minimal overlap (2.9%–10.3%) among isolates from both related and unrelated samples of origin [15-17]. This suggests that var gene conservation is a rare event. Interestingly, 2 var genes, var1 and var2csa, are relatively conserved; homologues have been characterized among numerous isolates worldwide [18-21]. These var genes have been implicated in chondroitin sulfate A (CSA) binding in vitro and play a role in pregnancy-associated malaria [22].

Resistance to chloroquine and sulfadoxine-pyrimethamine is widespread in areas where P. falciparum is endemic. Point mutations in proteins encoded by pfcrt (located centromerically on chromosome 7) and pfdhfrts (located centromerically on chromosome 4) confer resistance to chloroquine [23, 24] and pyrimethamine [25, 26], respectively. Antimalarial drug resistance has a selection effect on the P. falciparum genome that causes a significant reduction in allelic diversity in the chromosome regions flanking the chloroquine-resistant gene pfcrt globally [27] and the pyrimethamine-resistant pfdhfr-ts gene in Southeast Asia [28] and Africa [29]. This indicates that a selective sweep has occurred in association with these drug-resistance genotypes.

Although the majority of var genes are located subtelomerically on the 14 chromosomes, a subset is found at internal locations on chromosomes 4, 6, 7, 8, and 12 [13]. Although the locations of these internal var genes are conserved between different parasite strains [30], the individual var genes in these locations are specific to each isolate. In the present study, we investigated the conservation of var genes by examining the frequency of 5 previously reported shared var genes [15] in 90 field isolates, predominantly from the West Pacific, and 2 laboratory lines. We also identified the chromosome location of these 5 var genes in several isolates from the West Pacific region and investigated the conservation of var genes with respect to drug-resistance genotypes for chloroquine and pyrimethamine.

MATERIALS AND METHODS

Parasites

A total of 90 field isolates and 2 laboratory lines of P. falciparum were used in the study: the West Pacific (n = 63) and other regions (n = 29) (table 1). Isolates from Madang, Papua New Guinea (PNG) [31]; the Philippines [33]; and Solomon Islands [34] were cultured in vitro [36]. When possible, parasites were cultured for 1 week to reach ∼1 × 10⁸ parasites. The laboratory lines, FCQ27-D10 and Dd2, had been in long-term culture [37, 38]. Parasite isolates from other regions had been stored on filter papers or in 6M guanidine hydrochloride [35]. The use of the parasite isolates was approved by the Human Research Ethics Committee of the Queensland Institute of Medical Research.

Table 1.

Origin of Plasmodium falciparum parasites used in the study and sequence polymorphisms and allele frequency in pfdhfr and pfcrt of isolates used for linkage analysis.

	Amino acid in pfdhfr						Amino acid in pfcrt
Origin, parasite line/isolate	16	51	59	108	164	Allele frequency, %	72	74	75	76	220	Allele frequency, %
West Pacific region
Madang, PNG [31]
FCQ27/30/46/50/64	A	N	C	S	I		C	M	N	K	A	33.3
FCQ79/80/81	A	N	C	S	I	53.3	S	M	N	T	S
FCQ2/22/31/33/41/49/65	A	N	R	N	I	46.7	S	M	N	T	S	67.7
Bougainville, PNG [32], AN018/035/059/064/077/083/101/143/174/204/294/347	ND						[32]
Philippines [33]
PH1/3/5/6/7/8/9/10/12/16	A	N	R	N	I		C	M	N	T	A
PH2	A	N	R	N	I		S	M	N	T	A
PH4	A	I	R	N	I	100	C	I	E	T	S	100
Solomon Islands [34]
SJ15	A	N	C	S	I		C	M	N	K	A	8.3
N18	A	N	C	S	I	16.7	S	M	N	T	S
N71/S2	A	N	C	N	I		S	M	N	T	S
SJ44	A	H	C	N	I		S	M	N	T	S
N70/72/73/92/111/S55/S99	A	N	R	N	I	83.3	S	M	N	T	S	91.7
East Timor [35], ETM9/12/18/21/23/27/28/31/33/40/44/46	ND						[35]
Other regions
Thailand, AA071/072/074/TM91-C32B/TM92-734/Dd2	ND						ND
Vietnam, V2/3/4/5/8/9/10/11	ND						ND
Brazil, BR311/402/405/417/434	ND						ND
Cameroon, CM240/241/242/243/244/296	ND						ND
Sudan, 105/7,106/1,123/4	ND						ND
Zambia, ZM105	ND						ND

NOTE. The pfcrt sequences of FCQ27-D10, FCQ2, FCQ22, FCQ30, FCQ46, FCQ50, FCQ64, N18, N70, S55, S99, and all isolates from the Philippines have been published elsewhere [33]. Citations are given in brackets. Bold type indicates mutated amino acids. ND, not done; PNG, Papua New Guinea.

Genotyping and detection of resistant mutations

Genomic DNA was extracted from cultured parasites [39], filter paper, or blood–guanidine hydrochloride mixes [35]. Genotyping was performed by polymerase chain reaction (PCR) amplification of polymorphic fragments from the 3 markers pfmsp1, pfmsp2, and pfglurp [40]. Amplification and sequencing of pfcrt fragments and pfdhfr that covered the known mutations were performed as described elsewhere [33, 41].

Amplification of shared and unique var genes

Nine of 19 specific var genes previously characterized in West Pacific P. falciparum isolates [15] were amplified using var-specific forward primers and the universal αBR primer [42]. Five of these var genes were observed in ≥2 isolates (shared: varS1–varS5), and 4 were observed in only 1 of 7 isolates (unique: varU1–varU4) [15]. Their sequence name and primer sequences are shown in table 2. Cycling conditions were 10 min at 95°C, followed by 35 cycles of 40 s at 95°C, 15 s at 58°C–65°C, and 15 s at 72°C. The PCR products for varS1–varS5 (9–18 isolates) and varU1–varU4 (3–4 isolates) from a subset of isolates were sequenced to determine their homology to the published sequences.

Table 2.

Forward primer sequences for 9 specific var genes.

var gene (sequence name) [15]	Primer sequence, 5′→3′.
varS1 (S2A11)	GCTCAAAAGCAATGCCG
varS2 (S2A19)	GAAACAGAATGGGCAGGCGT
varS3 (S2A26)	TGATGCACCAGAAAAGGC
varS4 (S2A28)	CAGACTGAAGATAACTGCCAATGC
varS5 (Dd2A24)	TGCAATCAGAAGATAATAAAC
varU1 (S99A23)	GTGGAAAAGTGCAAATGTGC
varU2 (PH4A9)	ATGTAAACAAGCAGTCTC
varU3 (AN16)	GAGAACAAAACTGGCGCAAG
varU4 (S2A2)	TGGGAAGAAAGGGAAGAATG

NOTE. S, shared (i.e., observed in > 1 West Pacific isolate); U, unique (i.e., observed in 1 West Pacific isolate).

Interchromosomal localization of shared var genes

Parasite chromosomal DNA was prepared in agarose blocks [43] and separated by pulsed-field gel electrophoresis (PFGE) [13] using the CHEF-DR III system (Bio-Rad Laboratories). PFGE was performed for 24 h at 3.3 V/cm with a switch time of 90–300 s, followed by 24 h at 3.0 V/cm with a switch time of 300–720 s. After PFGE, DNA was transferred to a nylon membrane (Roche Diagnostics) using capillary blotting. Digoxigenin (DIG)–labeled probes were generated by PCR using DIG-labeled dUTPs (Roche Diagnostics) and sequence-specific primers. Copy-specific var gene probes were generated from a bacterial colony containing the specific var gene fragment [15], using αAF/BR primers and amplification conditions reported elsewhere [44]. Probes were purified using QIAquick spin columns (Qiagen). Hybridizations were performed at 42°C in the Easy Hyb hybridization buffer (Roche Diagnostics), then washed twice in 2× standard saline citrate (SSC) and 0.1% SDS for 5 min at room temperature and twice in 0.1× SSC and 0.1% SDS for 15 min at 65°C. DIG-labeled probes were detected using anti-DIG AP Fab fragments, CDP-star substrate, and the DIG Wash and Block Buffer Set (Roche Diagnostics), in accordance with the manufacturer's instructions. The locations of specific chromosomes were confirmed by hybridization with DIG-labeled chromosome-specific probes: pfdhfr (chromosome 4), pfmdr1 (chromosome 5), pf12 (chromosome 6), and pfcrt (chromosome 7). These probes were generated using FCQ2 genomic DNA by PCR incorporation of DIG dUTP with the following primer sets: (1) DHFR3 and DHFR4 [41], (2) MDR1F and MDR1R [45], (3) PF12F (5′-ATGGTTCCAATGGAAATCC-3′) and PF12R (5′-GATGAAATGCTTGCTTCTACG-3′), and (4) CRTD1/3 [32, 33]. Cycling conditions were 10 min at 95°C for 1 cycle, followed by 50 cycles of 50 s at 95°C, 50 s at 50°C, and 1 min at 72°C.

Intrachromosome mapping of the shared var genes

The chromosome blocks of 8 randomly selected isolates (AN143, N72, S99, FCQ22, FCQ31, FCQ33, FCQ41, and FCQ49) whose shared var genes were mapped to chromosomes 4 and 7 and 3D7 were digested with 160 U of ApaI (NEB), SgrAI (Roche Diagnostics), or SanDI (Stratagene) for ∼20 h at 37°C and separated by PFGE for 16.5 h at 6 V/cm, with a switch time of 25–50 s. The DNA was then transferred to a nylon membrane as described above. Chromosomes digested with ApaI and SgrAI were hybridized with DIG-labeled varS1, varS2, varS3, pfdhfr, Rep20, pfD1050c, and pfD0285c probes separately, and chromosomes digested with ApaI and SanDI were hybridized with varS4, varS5, pfcrt, Rep20, and pfD0285c separately. The hybridization, washing, and development conditions were as described above.

Data analysis

Fisher's exact test for 2 × 2 tables (or the likelihood-ratio test for >2 × 2 tables) was used to compare the frequencies of the shared and unique var genes, and to compare shared var gene frequencies between locations (where n ≥ 5) for the West Pacific isolates and global isolates. The χ² test was used to test for association between shared var genes and location on either chromosome 4 or chromosome 7. Fisher's exact test was used to determine whether any var genes located on chromosome 4 or 7 were significantly associated with drug resistant pfdhfr or pfcrt.

RESULTS

Genetic diversity of West Pacific and other isolates

Genotyping of the isolates revealed 22, 36, and 34 alleles for pfmsp1, pfmsp2, and pfglurp, respectively. Unique genotypes (a combined 3-loci genotype) were observed in 90.2% (83/92) of isolates with 78.3% (72/92) of isolates having a single allelic type at all 3 loci. Four allelic types were shared among 9 isolates originating from 4 geographic areas. The most frequent shared allelic type was observed in 3 isolates from Madang (FCQ22, FCQ31 and FCQ49). These 3 isolates had different hybridization patterns of Rep20, a commonly used DNA fingerprinting marker, and are therefore genetically different. These data indicate that the isolates analyzed were highly diverse and that the majority of them were likely to be clonal infections.

Conservation of shared var genes in isolates from the West Pacific

We analyzed 63 isolates from the West Pacific by PCR for the presence of 9 selected var genes. Sequence analysis of the PCR product from randomly selected isolates showed that 90% (54/60) of samples had ≥95% homology (77% were identical) to previously published varS1–varS5 sequences. The 6 samples that had <95% homology belonged to varS2 (n = 4) and varS3 (n = 2), which suggests the PCR primers for these 2 var genes were able to amplify less homologous genes. This may result in a slight overestimation of the frequency of these 2 var genes in the population.

The overall frequency (f) of each of these 9 var genes in the West Pacific region was 0.063–0.746. The 5 shared var genes were detected with frequencies of 0.508–0.746. The 4 unique var genes were observed at significantly lower frequencies (f = 0.063–0.127; P < .001). At any of the selected sites in the West Pacific region, the shared var genes were observed at moderate to high frequency (f = 0.400–1.000), with 3 exceptions (figure 1): varS1 and varS2 were each observed in only 1 isolate from East Timor (f = 0.083), and varS4 was observed in only 1 isolate from the Philippines (f = 0.083). At these sites, the observed frequency of these 3 var genes was significantly lower than that at other sites in the region (P < .001). The frequency that each unique var gene was detected at any particular site was low (α), with the exception of varU2 in isolates from Madang (f = 0.467), which had a frequency significantly higher than that of all other unique var genes within the region (P < .001) (figure 1).

Figure 1.

Frequency of the shared and unique var genes in Plasmodium falciparum isolates obtained from 5 West Pacific islands. PNG, Papua New Guinea.

Frequency of shared var genes in isolates from other locations

When 29 isolates from outside the West Pacific region were compared with isolates from the West Pacific, the overall frequency of varS1 (f = 0.517) was similar, frequencies of varS2 (f = 0.345) and varS5 (f = 0.586) were slightly lower, and frequencies of varS3 (f = 0.172) and varS4 (f = 0.241) were lower (P < .001). When isolates were analyzed by country of origin, lower frequencies were observed for varS1 in Vietnam (f = 0.250), varS2 in Thailand (f = 0.167), and varS3 in Brazil (f = 0.200), whereas varS3 and varS4 were not detected in the Vietnam isolates. Additionally, varS2, varS3, and varS4 were also not observed in the 4 isolates from Sudan and Zambia.

Conservation of the chromosomal location of shared var genes

In isolates originating from the Philippines, PNG, and Solomon Islands, varS2 and varS3 were found more frequently on chromosome 4, compared with other chromosomes (P = .039 and P < .001, respectively), whereas varS4 and varS5 were located more frequently on chromosome 7, compared with the other chromosomes (P < .001 and P = .05, respectively) (table 3). The varS1 gene was not significantly associated with either chromosomal location. For several isolates, varS1 (n = 7), varS2 (n = 3), and varS5 (n = 4) were detected at 2 or 3 chromosomal locations, including chromosomes 4 and/or 7 (data not shown); however, these data were excluded for the frequency estimates.

Table 3.

Frequency of shared (S; observed in >1 West Pacific isolate) and unique (U; observed in 1 West Pacific isolate) var gene located on 4, 7, or other chromosomes among isolates from the West Pacific.

Chromosome location	varS1 (n = 14)	varS2 (n = 19)	varS3 (n = 19)	varS4 (n = 21)	varS5 (n = 21)	varU1 (n = 3)	varU2 (n = 4)	varU3 (n = 3)	varU4 (n = 4)
4	0.572	0.737	0.842	0.048	0.000	0.000	0.250	0.667	0.500
7	0.214	0.263	0.053	0.905	0.714	0.000	0.250	0.000	0.250
Other	0.214	0.000	0.105	0.048	0.286	1.000	0.500	0.333	0.250

We also determined the chromosomal location of the 4 unique var genes (varU1–varU4). Because of a low observed frequency in the West Pacific isolates, only a limited number (3–4) could be examined, and no statistical test of association with chromosomal location was performed. However, in contrast to the shared var genes, only 50% of the unique var genes tested were located on chromosomes 4 and 7 (table 3).

Linkage of PfEMP1 type to drug-resistance markers

Key sequence polymorphisms in pfdhfr and pfcrt in the isolates from Madang, Solomon Islands, and the Philippines were examined (table 1). Overall, the chromosomal location of the varS2 and varS3 genes (chromosome 4 vs. other chromosomes combined) was associated with the pfdhfr resistance genotype (P < .04). A similar result was obtained for the varS4 gene; its chromosome location (chromosome 7 vs. other chromosomes combined) was associated with the pfcrt resistance genotype (P = .004). The varS1 and varS5 genes were not significantly associated with either drug-resistance marker (P > .3).

In Madang isolates, the presence of the varS2 and varS3 genes on chromosome 4 was significantly associated with the pfdhfr resistant genotype (P < .05), whereas the location of the varS4 gene on chromosome 7 was significantly associated with the pfcrt resistant genotype (P < .001). Only limited linkage data were obtained for isolates from Solomon Islands and the Philippines because a large number of them had resistant genotypes. Therefore, although some associations were apparent, no statistical tests were performed. In isolates from Solomon Islands, varS4 and varS5 were observed on chromosome 7 in 7 of 8 and 5 of 6 isolates with resistant pfcrt, respectively. In isolates from the Philippines, varS2 was observed on chromosome 4 in 4 of 6 isolates with resistant pfdhfr. Interestingly, the varS4 gene was detected by PCR in only 1 isolate from the Philippines (PH-4); although all isolates from the Philippines were resistant to chloroquine, the PH-4 isolate was the only one to have an Asian pfcrt type. The remaining isolates from the Philippines had a unique pfcrt genotype [33, 46].

Intrachromosomal location of var genes associated with drug resistance

The intrachromosomal location of the 5 shared var genes was determined for 8 West Pacific isolates. The varS2 gene colocalized with the pfdhfr-ts gene on the 500-kb SgrAI fragment in 7 of 8 isolates and 350 kb in AN143 (figure 2A), whereas varS1 and varS3 were mapped to a 250-kb SgrAI fragment (figure 2A). The varS3 gene also hybridized to the larger SgrAI fragment, although the hybridization signal was weaker. varS1, varS2, and varS3 colocalized with the pfdhfrts gene on a 590-kb centromeric ApaI fragment (figure 2B). None of these var gene probes hybridized to 3D7 DNA. The varS4 and varS5 colocalized with pfcrt on 250- and 790-kb centromeric SanDI and ApaI fragments, respectively, of chromosome 7 (figure 3). All fragments identified by the 5 var genes were negative for a subtelomeric probe, Rep20 [47] (figures 2 and 3).

Figure 2.

Pulsed-field gel electrophoresis and Southern blots of chromosomes from 8 Plasmodium falciparum isolates and 3D7 using pfdhfr, the varS1, varS2, and varS3 genes, and Rep20. Parasite chromosomes were digested with SgrAI (A) and ApaI (B).

Figure 3.

Pulsed-field gel electrophoresis and Southern blots of 8 Plasmodium falciparum chromosomes using pfcrt, the varS4 and varS5 genes, and Rep20. Parasite chromosomes were digested with SanDI (A) and ApaI (B).

We constructed restriction maps for chromosome 4 and 7 (based on the 3D7 genome) illustrating the locations of the 5 shared var genes and drug-resistance markers. The varS1, varS2, and varS3 genes were identified in the internal region on chromosome 4, ∼200 kb to pfdhfr-ts, whereas the varS4 and varS5 genes were mapped to an internal region within 100 kb of pfcrt on chromosome 7 (figure 4).

Figure 4.

Chromosomal map for shared var genes on chromosomes (chr) 4 and 7. Asterisks indicate a second possible location.

DISCUSSION

We investigated the conservation of var genes among a collection of isolates from 5 islands in the West Pacific region. The 63 West Pacific isolates have a highly diverse genetic background, with many pfmsp1, pfmsp2, and pfglurp alleles observed in mostly clonal infections. All countries studied, except for the Philippines, have medium to high malaria transmission, with high levels of clinical immunity. As a consequence, the diversity of var genes in these countries was high, with only a minimum number of shared var genes [15]. Interestingly, we found that a small group of var genes occurred at relatively high frequency in these genetically diverse parasites.

There are several possible mechanisms by which the “shared” var genes have remained conserved among genetically diverse parasites in several countries. The conservation of a specific var gene may be due to functional constraints. There have been reports describing 2 globally conserved var genes—var1 and var2csa [18-21]. Although the mechanism by which these var genes are conserved is not fully understood, it has been associated with pregnancy-related malaria and the CSA-binding capability of the parasites [19-21]. The var1 and var2csa genes presumably are not under intense host immune selection, given the limited abundance of CSA in a nonpregnant host. Sequence comparisons revealed 100% sequence homology between the DBL1α regions of var1 and the varS5 gene, which indicates that it belongs to this conserved var gene subfamily. This suggests that the varS5 gene is conserved among the West Pacific isolates using a mechanism similar to that of var1. The remaining 4 shared var genes showed no significant homology with either var1 or var2csa.

Alternatively, conservation of these var genes may be maintained because they are located centromerically, where recombination occurs less frequently [30]. It has been demonstrated that var gene diversity is frequently generated by ectopic recombination between genes located on different chromosomes [48]. The subtelomeric location of most var genes is thought to facilitate this process and is likely to be a valuable method by which the parasite generates the large amount of diversity observed in this gene family. We demonstrated that these 4 shared var genes were often located in the internal regions of chromosomes 4 and 7.

This result also raises the question of why these conserved var genes were most commonly found on chromosomes 4 and 7 but not on chromosomes 6, 8, and 12, which also have var genes located on internal regions [13, 30]. This led us to investigate whether the shared var genes might be associated with the genes that are implicated in pyrimethamine (pfdhfr) or chloroquine (pfcrt) resistance, located on chromosomes 4 and 7, respectively. The mapping results revealed that the varS1, varS2, and varS3 were localized to the internal region on chromosome 4, ∼200 kb from pfdhfr-ts, whereas varS4 and varS5 were mapped to an internal region of chromosome 7, within 100 kb of pfcrt. Analysis showed that the presence of varS2 and varS3 on chromosome 4 and varS4 on chromosome 7 was significantly associated with a resistant pfdhfr or pfcrt genotype, respectively, which suggests that the conservation of these genes in the West Pacific region is most likely due to drug selection. The results are consistent with chloroquine and sulfadoxine-pyrimethamine selective sweeps reported globally [27-29] and suggest that similar selective sweeps have also occurred in the West Pacific region. However, the number of selection events that may have occurred requires further investigation of more parasites from the countries in this region.

Further evidence in support of a selective sweep driven by chloroquine comes from the almost complete absence of the chloroquine resistance–associated varS4 in isolates from the Philippines, compared with the highly significant association in isolates from Madang. The chloroquine-resistant isolates from these 2 locations were found to have different pfcrt alleles and adjacent microsatellite markers. This indicates that they arose from 2 different mutation events [33, 46] and explains why the var gene associated with this locus would also be different. Hence, the evolution of drug resistance in a region appears to be linked to the conservation of var genes. On the basis of the study results, we hypothesize that the drug-resistant phenotype has driven the parasites through the population, taking with them a conserved genomic segment that contains, among other genes, a set of conserved var genes.

In the present study, the chromosomal segment of linkage appears to include at least 100–200 kb flanking pfcrt and pfdhfr, which is consistent with previous findings [27-29]. The length of this linked segment may be a consequence of the internal location resulting in a lower frequency of recombination within the segment or of a lower frequency of recombination with drug-sensitive alleles that is caused by a lack of sensitive parasites in many areas. The negative aspect of carrying conserved var genes, such as recognition by the host immune system, has been outweighed by the advantage of having the resistant genotype in the presence of antimalarial drug pressure, thereby allowing the parasite population to expand. With the removal of drug pressure, the parasites carrying these shared var genes may be at a disadvantage and subsequently lost in competition with other parasites that have a more diverse var gene repertoire.

The exception to this hypothesis may be varS5, which appears to provide the parasite with a selective advantage in a subset of the population: the ability to bind CSA in pregnant women. The physical association of this conserved var gene with pfcrt may explain its wide geographic distribution, and its functional characteristics allow it to persist in the absence of chloroquine use.

Several studies have indicated an association between host exposure to PfEMP1 and clinical immunity, which suggests that an introduced parasite with a unique set of var genes has an advantage over existing parasites in a semi-immune population. If such a parasite carries the drug-resistant phenotype, its physical linkage with the neighboring var genes may allow it to spread through the community, irrespective of the current drug usage. This mechanism has the potential to introduce drug-resistance genotypes into a population at a relatively high prevalence before the population is ever exposed to the drug.

Although it is apparent that the generation and maintenance of var gene diversity is largely driven by host immune pressure, our results provide evidence that a strong selection force exists that facilitates the conservation of some internal var genes. These var genes are maintained in the parasite population primarily through their physical link to loci that determine responses to drugs. Hence, it is evident that physical linkage has the potential to shape the parasite population when this parasite has a selection advantage over others.