Abstract
Spoligotyping and mycobacterial interspersed repetitive unit-variable-number tandem repeat analysis (MIRU-VNTR) were evaluated for the ability to differentiate 64 Mycobacterium tuberculosis isolates from 10 IS6110-defined clusters. MIRU-VNTR performed slightly better than spoligotyping in reducing the number of clustered isolates and the sizes of the clusters. All epidemiologically related isolates remained clustered by MIRU-VNTR but not by spoligotyping.
DNA fingerprinting of Mycobacterium tuberculosis isolates is a powerful tool for studying the molecular epidemiology of tuberculosis (TB). IS6110 fingerprinting has proven useful for detecting outbreaks (5) and for conducting population-based studies of recent transmission (1, 9). However, for low-copy-number strains (fewer than six copies of IS6110), it is a less reliable indicator of clonality and therefore a poor predictor of epidemiologic relationships (6, 12, 13). Secondary typing is often recommended for these isolates to decrease the number of falsely clustered isolates. Spoligotyping is the most widely used method for secondary typing; however, recent reports indicate that it does not appreciably improve strain differentiation and suggest that more discriminating methods should be used (3). Mycobacterial interspersed repetitive unit-variable-number tandem repeat analysis (MIRU-VNTR) is a relatively new typing method that determines the number of repeated mycobacterial interspersed repetitive units at 12 independent loci (7). In an initial study, 12 sets of epidemiologically related isolates remained clustered by MIRU-VNTR (7). In a study of low-copy-number isolates, MIRU-VNTR analysis was shown to further resolve some IS6110 clusters, but the epidemiological significance was not investigated (2). In this study, we compared spoligotyping and MIRU-VNTR for the secondary typing of isolates that were previously clustered by IS6110 and correlated the genotyping results with the epidemiologic data.
The study included 64 isolates from patients with TB diagnosed between 1999 and 2001. These isolates represent 74% of 87 IS6110-clustered isolates identified during an investigation of TB transmission in metropolitan New Orleans, La. The institutional review boards of Tulane University and Louisiana State University approved the study, and the consent form waiver was granted in accordance with federal regulatory code (45 CFR 46.116(d) [available online at http://ohrp .osophs.dhhs.gov/humansubjects/guidance/45cfr46.htm#46-116]). IS6110 analysis was performed by the standard method (11), with some modifications. The PCR DIG probe synthesis kit and the DIG nucleic acid detection kit (Roche Diagnostics) were used to detect IS6110 fragments. Images were analyzed with Molecular Analyst v. 1.6 (Bio-Rad, Hercules, Calif.). Spoligotyping (Isogen Bioscience BV, Maarssen, The Netherlands) was performed in accordance with previously published methods (8). Results were recorded as an octal code (4). MIRU loci (10) were amplified with primers specific for sequences flanking each locus (Table 1). The reaction mixture (20 μl) contained a 1-μl DNA sample, 1× Taq PCR buffer, 1× Q solution, 3 mM magnesium chloride, deoxynucleoside triphosphates (each at 0.2 mM), 1 U of AmpliTaq DNA polymerase (Qiagen, Valencia, Calif.), and the primer pair at 0.6 μM (each primer at 0.3 μM). The amplification profile consisted of 1 min at 94°C, followed by 40 cycles of 30 s at 94°C, 10 s at 60°C, and 1 min at 72°C in a GeneAmp 9700 PCR System (Perkin-Elmer Applied Biosystems, Foster City, Calif.). The size of each amplicon was determined with a CEQ2000 capillary sequencer (Beckman Coulter, Fullerton, Calif.). The number of MIRUs was determined in accordance with the convention described in Table 1. The results were recorded as a 12-digit number as previously described (2). Patient data were collected retrospectively from hospital and TB clinic records and from contact-tracing data obtained by TB control disease intervention specialists or by inpatient coordinators. A transmission link was said to exist if two patients lived or worked in the same facility at a time when one of the individuals was likely to have been infectious or if two patients independently identified contact with a prior common case.
TABLE 1.
Sequences of oligonucleotides used in MIRU-VNTR
| Oligo- nucleotidea | Sequence | Size (bp)b |
|---|---|---|
| 2c(D3) | 5′ CAGGTGCCCTATCTGCTGACG | 236 + 47 |
| 2d | 5′ GTTGCGTCCGGCATACCAAC | |
| 4a(D2) | 5′ GTCAAACAGGTCACAACGAGAGGAA | 182 + 77 |
| 4b | 5′ CCTCCACAATCAACACACTGGTCAT | |
| 10a(D4) | 5′ ACCGTCTTATCGGACTGCACTATCAA | 272 + 53 |
| 10c | 5′ CACCTTGGTGATCAGCTACCTCGAT | |
| 16a(D2) | 5′ CGGGTCCAGTCCAACTACCTCAAT | 419 + 52 |
| 16b | 5′ GATCCTCCTGATTGCCCTGACCTA | |
| 20a(D2) | 5′ CCCCTTCGAGTTAGTATCGTCGGTT | 292 + 72 |
| 20b | 5′ CAATCACCGTTACATCGACGTCATC | |
| 23a(D4) | 5′ CGAATTCTTCGGTGGTCTCGAGT | 131 + 52 |
| 23b | 5′ ACCGTCTGACTCATGGTGTCCAA | |
| 24a(D3) | 5′ GAAGGCTATCCGTCGATCGGTT | 365 + 53 |
| 24b | 5′ GGGCGAGTTGAGCTCACAGAAC | |
| 26a(D4) | 5′ GCGGATAGGTCTACCGTCGAAATC | 291 + 48 |
| 26b | 5′ TCCGGGTCATACAGCATGATCA | |
| 27a(D4) | 5′ TCTGCTTGCCAGTAAGAGCCA | 321 + 52 |
| 27b | 5′ GTGATGGTGACTTCGGTGCCTT | |
| 31a(D3) | 5′ CGTCGAAGAGAGCCTCATCAATCAT | 160 + 52 |
| 31b | 5′ AACCTGCTGACCGATGGCAATATC | |
| 39a(D2) | 5′ CGGTCAAGTTCAGCACCTTCTACATC | 238 + 47 |
| 39c | 5′ GCGTCCGTACTTCCGGTTCAG | |
| 40a(D3) | 5′ GATTCCAACAAGACGCAGATCAAGA | 276 + 50 |
| 40b | 5′ TCAGGTCTTTCTCTCACGCTCTCG |
One primer in each pair was 5′ end labeled with Beckman dye D2, D3, or D4.
Predicted size of amplicons containing one MIRU copy plus size of additional copies.
Sixty-four isolates from 10 IS6110 clusters were available for secondary typing; 30 were low-copy-number isolates, and 34 were high-copy-number isolates. The IS6110 patterns are shown in Fig. 1. Spoligotyping identified eight types that defined seven clusters (63 isolates) and one unique isolate. Only one IS6110-defined cluster was further spilt by spoligotyping (Table 2). Of the 13 isolates in this cluster, 1 had a spoligotype that differed from that of the others by a single spacer. MIRU-VNTR identified 14 types that defined 11 clusters (61 isolates) and three unique isolates (Table 2). Three of the four largest IS6110 clusters were subdivided into four subclusters and four unique isolates. Two of these clusters contained low-copy-number isolates, and the third contained high-copy-number isolates. The combination of all three methods identified 16 genotypes that defined 12 clusters (60 isolates) and four unique isolates (Table 2). The isolate that was unique by spoligotyping remained clustered by MIRU-VNTR.
FIG. 1.
Representative patterns of clustered isolates identified by IS6110 RFLP. Numbers indicate pattern designations (LTBx) and numbers of IS6110 bands. Clusters of the LTB55, LTB44, LTB32, LTB60, LTB36, LTB35, and LTB30 genotypes were excluded from this study because the isolates were not available for MIRU-VNTR typing.
TABLE 2.
Genotyping results
| IS6110 RFLP (no. of bands) | No. of patients | Spoligotype | No. of patients | MIRU-VNTR | No. of patients |
|---|---|---|---|---|---|
| LTB2 (2) | 20 | 777776777760601 | 20 | 224325153323 | 16 |
| 223325153323 | 2 | ||||
| 224315153323 | 1 | ||||
| 224325163323 | 1 | ||||
| LTB3 (3) | 5 | 777776777760771 | 5 | 225325123421 | 4 |
| 245225123421 | 1 | ||||
| LTB13 (3) | 3 | 700036777760771 | 3 | 222325153324 | 3 |
| LTB14 (3) | 2 | 777776777760601 | 2 | 224325153323 | 2 |
| LTB6 (6) | 13 | 777776777760771 | 12 | 224325153324 | 13 |
| 777776777760731 | 1 | ||||
| LTB8 (7) | 3 | 777777777720771 | 3 | 225325153323 | 3 |
| LTB9 (9) | 12 | 000000000003771a | 12 | 223425173563 | 10b |
| 223425173564 | 2 | ||||
| LTB38 (11) | 2 | 776037777760771 | 2 | 223125163324 | 2 |
| LTB34 (12) | 2 | 677777607760771 | 2 | 223226153321 | 2 |
| LTB31 (18) | 2 | 000000000003771a | 2 | 223325173533 | 2 |
Cluster with the Beijing genotype.
Two of the isolates in this cluster were a result of laboratory cross-contamination.
Epidemiologic data were available for 61 patients; 16 (25%) patients had definite transmission links with another patient. With one exception, the genotypes of the isolates from these patients were identical (Table 3). Isolates from three family members were identical by IS6110 and MIRU-VNTR, but one isolate had a slightly different spoligotype in that it was missing spacer 40. Such minor variations have been previously reported among outbreak isolates (6). Two of the patients in this study were diagnosed with TB as a result of laboratory cross-contamination. The genotypes of these three isolates were identical.
TABLE 3.
Genotypes of isolates with documented transmission links
| Type of transmission link | No. of patients | IS6110 RFLP | Spoligotype (no. of patients) | MIRU-VNTR |
|---|---|---|---|---|
| Family contact | 2 | LTB2 | 777776777760601 | 224325153323 |
| Family contact | 2 | LTB3 | 777776777760771 | 225325123421 |
| Family contact | 3 | LTB6 | 777776777760771 (2) | 224325153324 |
| 777776777760731 (1) | ||||
| Family contact | 2 | LTB13 | 700036777760771 | 222325153324 |
| Work contact | 2 | LTB6 | 777776777760771 | 224325153324 |
| Contact with common case | 3 | LTB9 | 000000000003771 | 223425173563 |
| Social contact | 2 | LTB2 | 777776777760601 | 224325153323 |
Genotyping of M. tuberculosis isolates from a given community is useful to the TB controller by identifying unsuspected cases of recently transmitted disease and areas in which traditional contact tracing has failed. However, large clusters of unrelated strains can confound these efforts, and therefore, a combination of genotyping techniques that provides the greatest level of discrimination is necessary for molecular typing to be useful to TB control programs. In this study, spoligotyping of IS6110-defined clusters did not improve strain differentiation. The only IS6110-clustered isolates that were subdivided by spoligotyping were epidemiologically related. In contrast, MIRU-VNTR had greater resolving power than spoligotyping and defined four additional genotypes; all epidemiologically related isolates remained clustered. We found that MIRU-VNTR is useful for secondary typing of IS6110-clustered isolates with both low and high numbers of IS6110 copies. MIRU-VNTR further resolved two low-copy-number IS6110 clusters and a high-copy-number cluster containing isolates with the Beijing spoligotype. The reduction in the number of falsely clustered isolates should allow more effective focused contact investigations. The ability of MIRU-VNTR to differentiate some IS6110-spoligotype-defined clusters suggests that the widely used genotyping combination of IS6110 and spoligotyping may result in overestimation of recently transmitted disease.
Acknowledgments
We thank the nurses and staff at the Wetmore TB Clinic, James Rigol and Richard Adams of the Louisiana Department of Health and Hospitals Office of Public Health Region 1, and Michelle Fernandez and Charlee Jones of the Medical Center of Louisiana in New Orleans for collecting the patient data. We thank Kerri Gerage and Arlene Lefebre of the Louisiana Department of Health and Hospitals Office of Public Health Central Laboratory for assistance with validation of the IS6110 RFLP procedure and with computer analysis of the patterns. We also thank Steven Styron for assistance with graphics and illustrations.
A. Kwara was supported by the Wetmore Foundation.
REFERENCES
- 1.Alland, D., G. E. Kalkut, A. R. Moss, R. A. McAdam, J. A. Hahn, W. Bosworth, E. Drucker, and B. R. Bloom. 1994. Transmission of tuberculosis in New York City. An analysis by DNA fingerprinting and conventional epidemiologic methods. N. Engl. J. Med. 330:1710-1716. [DOI] [PubMed] [Google Scholar]
- 2.Cowan, L. S., L. Mosher, L. Diem, J. P. Massey, and J. T. Crawford. 2002. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J. Clin. Microbiol. 40:1592-1602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cronin, W. A., J. E. Golub, L. S. Magder, N. G. Baruch, M. J. Lathan, L. N. Mukasa, N. Hooper, J. H. Razeq, D. Mulcahy, W. H. Benjamin, and W. R. Bishai. 2001. Epidemiologic usefulness of spoligotyping for secondary typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110. J. Clin. Microbiol. 39:3709-3711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Dale, J. W., D. Brittain, A. A. Cataldi, D. Cousins, J. T. Crawford, J. Driscoll, H. Heersma, T. Lillebaek, T. Quitugua, N. Rastogi, R. A. Skuce, C. Sola, D. van Soolingen, and V. Vincent. 2001. Spacer oligonucleotide typing of bacteria of the Mycobacterium tuberculosis complex: recommendations for standard nomenclature. Int. J. Tuber. Lung Dis. 5:216-219. [PubMed] [Google Scholar]
- 5.Edlin, B. R., J. I. Tokars, M. H. Grieco, J. T. Crawford, J. Williams, E. M. Sordillo, K. R. Ong, J. O. Kilburn, S. W. Dooley, K. G. Castro, W. R. Jarvis, and S. D. Holmberg. 1992. An outbreak of multidrug-resistant tuberculosis among hospitalized patients with the acquired immunodeficiency syndrome. N. Engl. J. Med. 326:1514-1521. [DOI] [PubMed] [Google Scholar]
- 6.Kamerbeek, J., L. Schouls, A. Kolk, M. van Agterveld, D. van Soolingen, S. Kuijper, A. Bunschoten, H. Molhuizen, R. Shaw, M. Goyal, and J. van Embden. 1997. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J. Clin. Microbiol. 35:907-914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Mazars, E., S. Lesjean, A. L. Banuls, M. Gilbert, V. Vincent, B. Gicquel, M. Tibayrenc, C. Locht, and P. Supply. 2001. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology. Proc. Natl. Acad. Sci. USA 98:1901-1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Molhuizen, H. O., A. E. Bunschoten, L. M. Schouls, and J. D. van Embden. 1998. Rapid detection and simultaneous strain differentiation of Mycobacterium tuberculosis complex bacteria by spoligotyping. Methods Mol. Biol. 101:381-394. [DOI] [PubMed] [Google Scholar]
- 9.Small, P. M., P. C. Hopewell, S. P. Singh, A. Paz, J. Parsonnet, D. C. Ruston, G. F. Schecter, C. L. Daley, and G. K. Schoolnik. 1994. The epidemiology of tuberculosis in San Francisco: a population-based study using conventional and molecular methods. N. Engl. J. Med. 330:1703-1709. [DOI] [PubMed] [Google Scholar]
- 10.Supply, P., E. Mazars, S. Lesjean, V. Vincent, B. Gicquel, and C. Locht. 2000. Variable human mini-satellite-like regions in the Mycobacterium tuberculosis genome. Mol. Microbiol. 36:762-771. [DOI] [PubMed] [Google Scholar]
- 11.van Embden, J. D. A., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and P. M. Small. 1993. Strains identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J. Clin. Microbiol. 31:406-409. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.van Soolingen, D., P. E. W. De Haas, P. W. M. Hermans, P. M. A. Groenen, and J. D. A. van Embden. 1993. Comparison of various repetitive DNA elements as genetic markers for strain differentiation and epidemiology of Mycobacterium tuberculosis. J. Clin. Microbiol. 31:1987-1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Warren, R., M. Richardson, S. Sampson, J. H. Hauman, N. Beyers, P. R. Donald, and P. D. van Helden. 1996. Genotyping of Mycobacterium tuberculosis with additional markers enhances accuracy in epidemiological studies. J. Clin. Microbiol. 34:2219-2224. [DOI] [PMC free article] [PubMed] [Google Scholar]