Abstract
Articular cartilage degeneration in osteoarthritis (OA) involves type II collagen degradation and chondrocyte differentiation (hypertrophy). Because these changes resemble growth plate remodeling, we hypothesized that collagen degradation may be inhibitable by growth factors known to suppress growth plate hypertrophy, namely transforming growth factor (TGF)-β2, fibroblast growth factor (FGF)-2, and insulin. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with TGF-β2, FGF-2, and insulin in combination (growth factors) or individually. In cultured explants from five OA patients, collagenase-mediated type II collagen cleavage was significantly down-regulated by combined growth factors as measured by enzyme-linked immunosorbent assay. Individually, FGF-2 and insulin failed to inhibit collagen cleavage in some OA explants whereas TGF-β2 reduced collagen cleavage in these 5 explants and in 19 additional explants. Moreover, TGF-β2 effectively suppressed cleavage at low concentrations. Together or individually these growth factors did not inhibit glycosaminoglycan (primarily aggrecan) degradation while TGF-β2 occasionally did. Semiquantitative reverse transcriptase-polymerase chain reaction of articular cartilage from six OA patients revealed that TGF-β2 suppressed expression of matrix metalloproteinase-13 and matrix metalloproteinase-9, early (PTHrP) and late (COL10A1) differentiation-related genes, and proinflammatory cytokines (interleukin-1β, tumor necrosis factor-α). In contrast, TGF-β2 up-regulated PGES-1 expression and prostaglandin E2 release. These observations show that TGF-β2 can suppress collagen resorption and chondrocyte differentiation in OA cartilage and that this may be mediated by prostaglandin E2. Therefore TGF-β2 could provide therapeutic control of type II collagen degeneration in OA.
The pathology of osteoarthritis (OA) involves the whole joint and is associated with focal and progressive hyaline articular cartilage loss, concomitant sclerotic changes in the subchondral bone, and the development of osteophytes. Soft tissue structures in and around the joint including synovium, ligaments, and muscles are also affected. Cartilage erosion is a fundamental pathological feature of OA. It involves damage to and resorption of the extracellular matrix, composed mainly of type II collagen and the proteoglycan aggrecan as well as many other matrix molecules. There is excessive cleavage of type II collagen in OA1,2 associated with the up-regulation of the synthesis and activities of collagenases,3 in particular matrix metalloproteinase (MMP)-13.1,2 Although OA is traditionally defined as a noninflammatory arthropathy, degenerative changes in OA cartilage are accompanied by the up-regulation of proinflammatory cytokines such as interleukin (IL)-1β and tumor necrosis factor (TNF)-α,4 which are involved in cartilage resorption.5 IL-1β has been shown to weakly induce prostaglandin (PG) E2 production in OA articular cartilage.6 Others have suggested that prostaglandins may augment IL-1β-mediated degradation of OA cartilage ex vivo.7
Cartilage pathology in OA is associated with an overall up-regulation of anabolic activity in articular cartilage, which may accompany changes in cellular phenotypes of articular chondrocytes.3,8–10 These phenotypic changes may also involve chondrocyte terminal differentiation (hypertrophy), associated with the expression of type X collagen in superficial, mid, and deep zones,11–13 and other alterations in phenotype involving onset of synthesis of type IIA collagen14 and dedifferentiation, accompanied by expression of type I and III collagens15–17 and synthesis of type III collagen.15
We have shown recently that the formation of very early age-related OA-like lesions in the knee18 is accompanied by the up-regulation of chondrocyte differentiation-related genes implicated in the regulation of chondrocyte hypertrophy in endochondral bone formation. These include parathyroid hormone-related peptide (PTHrP), fibroblast growth factor 2 (FGF-2), transforming growth factor (TGF)-β1and -β2, Indian hedgehog (Ihh), MMP-13, MMP-9, cyclin B2,and Sox 9. All of these genes are expressed in the bovine growth plate19 where early and late chondrocyte differentiation is accompanied by the sequential expression of genes responsible for extracellular matrix remodeling and regulatory growth factors. Thus, the up-regulation of PTHrPand FGF-2, TGF-β2in the early proliferative zone is followed by a hypertrophy-related increase in expression of type X collagen, MMP-13, MMP-9, TGF-β1, and Ihh. These observations suggest that chondrocyte differentiation in articular cartilage is an early event in the development of OA.18 Moreover it is now well established that chondrocyte hypertrophy results in increased expression of the collagenase MMP-13, the same protease that is up-regulated in OA cartilage.20–22 Also, inhibition22 or deletion23 of MMP-13 expression suppresses chondrocyte hypertrophy as well as collagenase activity.22 In view of these observations, the destruction of the collagen network in OA by collagenases may involve the regulatory mechanisms of extracellular matrix resorption that govern chondrocyte differentiation in development in endochondral bone formation.
Chondrocyte hypertrophy is a process that can be arrested at various checkpoints. The arrest may be temporary, such as to attenuate endochondral ossification, but it also can be more permanent, as in healthy uncalcified hyaline cartilage.24 The latter is characterized by a very low expression of collagen type II; no expression of type I, III,or X collagens; a relatively high turnover rate for aggrecan; and very restricted chondrocyte replication.25–27 It is also characterized by a limited expression of TGF-β1; a complete lack of expression of TGF-β2, PTHrP, FGF-2,insulin growth factor (IGF)-1, and Ihh;28,29 and a negligible rate of chondrocyte apoptosis.30–32
A number of growth factors are capable of arresting chondrocyte hypertrophy. FGF-2 suppresses hypertrophy.33,34 Defects in FGF-2 receptor result in a loss of suppression.35,36 TGF-β2 in synergy with FGF-2 can suppress maturation of chondrocytes in culture.37
Insulin and its structural and functional analog IGF-138 are strong stimulators of the synthesis of aggrecan and type II collagen.39–41 Also IGF-1 favors chondrocyte hypertrophic development inducing type X collagen and alkaline phosphatase in avian sternal chondrocytes.37,42 However, in combination with TGF-β2 and FGF-2, IGF-1 can increase synthesis of cartilage matrix molecules without induction of type X collagen up-regulation.37 Because TGF-β2, FGF-2, and insulin acting synergistically can suppress normal terminal differentiation in chondrocytes,42,43 and because excessive type II collagen resorption by collagenase1,2,22 and chondrocyte hypertrophy11,12 are key components of the pathology of OA we hypothesized that these growth factors may be capable of suppressing increased type II collagen cleavage by collagenase in OA, if the increased cleavage is associated with chondrocyte hypertrophy as in the growth plate.21,22
We describe in this report how type II collagen cleavage by collagenase in OA articular cartilage can indeed be arrested by growth factors that also suppress expression of IL-1β, TNF-α, and genes characteristic of chondrocyte hypertrophy. This suppression is accompanied by an up-regulation of PGE2 production and expression of PGES-1. This suggests that expression of these cytokines and development of chondrocyte hypertrophy are important components of the pathology of OA and that up-regulation of PGE2 production favors the control of collagen degradation.
Materials and Methods
Cartilage Isolation and Preparation
Human femoral condylar cartilages were obtained at total knee arthroplasty from 30 patients (18 men, mean age, 72.2 ± 7.05 years; range, 52 to 82 years; 12 women, mean age, 73.5 ± 7.14 years; range, 58 to 82 years) with OA diagnosed according to the criteria of the American College of Rheumatology.44 Cartilages were prepared as previously described.45 In brief, OA articular cartilages were washed three times with Dulbecco’s modified Eagle’s medium A (Life Technologies, Inc., Grand Island, NY) containing 20 mmol/L HEPES buffer, pH 7.4 (Life Technologies, Inc.), 45 mmol/L NaHCO3, 100 U/ml penicillin, 100 μg/ml streptomycin, and 150 μg/ml gentamicin sulfate. Full-depth cartilage slices from a single site, ∼20 × 20 mm2, were cut vertical to the articular surface and then into cubes of ∼2 × 2 mm2. All of the articular cartilage available from each patient, regardless of the degree of degeneration (Mankin grades 4 to 12) as reported previously,46 was used. Five to seven cubes were randomly obtained and wet weights of ∼60 mg were distributed in each culture well (48-well Costar 3548 plate; Corning Inc., Corning, NY). Samples were maintained before culture for 48 hours at 37°C in 1 ml per well of medium A in 95% air and 5% CO2.
Cartilage Explant Culture
Media were changed after 48 hours (day 0) and thereafter were replaced every 4 days. The growth factor mixture (final concentrations) of 10 ng/ml TGF-β2 (R&D Systems, Minneapolis, MN), 10 ng/ml FGF-2 (R&D Systems), and 100 ng/ml insulin (Sigma Chemical Co., St. Louis, MO) was based on the concentrations used by Szuts and colleagues42 in studies of chondrocyte hypertrophy. In some dose-response studies, TGF-β2 was used in the range 0.1 to 10 ng/ml. Final concentrations of growth factors were freshly added to medium A from day 0 at each medium change. The cartilage (triplicate cultures for each analytical point) was cultured for a total of 16 days and analyzed at day 16 for collagen cleavage and proteoglycan release. The conditioned media were collected every 4 days at each medium change from day 4 to day 16 and stored at −20°C until analyzed. For analyses of gene expression, cultures were maintained for up to 48 hours and analyzed as described below.
Enzyme-Linked Immunosorbent Assay of Collagenase-Cleaved Type II Collagen
The OA cartilage explants from day 16 of culture were digested and extracted with α-chymotrypsin to cleave and solubilize denatured collagen, including the carboxyterminal neo-epitope COL2–3/4C short (C1,2C) epitope generated by cleavage of type II collagen by collagenase. This was measured by enzyme-linked immunosorbent assay as described previously in α-chymotrypsin extracts and conditioned media.1,2 Total cleavage neo-epitope in cartilages and media was calculated by summation of the data from each medium change and cartilage analysis. Results were expressed as pmol of epitope/mg wet weight of cartilage, based on a molecular weight of the standard peptide epitope of 608 d.
Determination of Proteoglycan Content and Release
This was determined in cartilage extracts and conditioned media as sulfated glycosaminoglycans (GAG), which is primarily a measure of proteoglycan aggrecan content, using a modification of the colorimetric 1,9-di-methylmethylene blue dye-binding assay.47 Cumulative proteoglycan release (GAG in the media) and its content in cartilages (GAG in the cartilage) were expressed as μg GAG/mg wet weight of cartilage. GAG release into medium was represented as a percentage of the total cumulative GAG in the cartilage plus cumulative GAG released into medium. This provides an accurate measure of release accounting for the marked variation in cartilage GAG content in OA cartilage.2,48
Quantification of PGE2 Release
PGE2 concentrations were determined in the undiluted conditioned medium collected at each media change using a commercially available competitive enzyme-linked immunosorbent assay kit (Cayman Chemical Company, Ann-Arbor, MI) according to the manufacturer’s instructions. Results were expressed in pg/mg of cartilage wet weight. PGE2 standards provided with the kit were diluted with Dulbecco’s modified Eagle’s medium A.
Total RNA Isolation
Total RNA was isolated from OA cartilage explants after culturing for 6, 24, or 48 hours by a modification of the method described previously.19 Fresh cartilage tissue in solution D (4 mol/L guanidine isothiocyanate, 25 mmol/L sodium citrate, pH 7.0, 0.5% laurylsarcosine, and 0.1 mol/L 2-mercaptoethanol) was immediately frozen in liquid nitrogen and kept at −80°C until all of the samples were collected. Samples were defrosted at room temperature and vortexed vigorously for 30 minutes. The debris was removed by centrifugation at 5000 × g for 10 minutes at 4°C. Proteins and nucleic acids in the supernatant were precipitated with 1 vol of isopropanol overnight at −20°C. The precipitate was removed at 10,000 × g for 20 minutes at 4°C and resuspended in digestion buffer (10 mmol/L Tris-HCl, 5 mmol/L ethylenediaminetetraacetic acid, 1% sodium dodecyl sulfate, pH 8.0, with 2 mg/ml of proteinase K (Life Technologies, Inc.) and incubated at 50°C until the pellet disappeared. After extraction with 1 vol of phenol, 0.2 vol of chloroform and 0.1 vol of 2 mol/L sodium acetate, pH 4.0, the aqueous phase was recovered by centrifugation (10,000 × g for 30 minutes at 4°C). An equal volume of 70% ethanol was added to each sample’s aqueous phase and loaded onto an RNeasy spin column (Qiagen, Valencia, CA). Further RNA purification was performed using RNeasy kit (Qiagen) according to the manufacturer’s instructions.
Reverse-Transcriptase (RT) and Polymerase Chain Reaction (PCR)
The RT reaction was performed using total RNA isolated from OA cartilage explants and SuperScript TMII H− reverse transcriptase as recommended by Gibco BRL-Invitrogen, Ontario, Canada, and as described previously.19 Genes analyzed and oligo sequences used for PCR are shown in Table 1. PCR was performed in a total volume of 25 μl as described previously.19 PCR products were visualized by ethidium bromide staining. 18S RNA was used as reference for gel loading. The 18S RNA amplicon levels were weak because the PCR reaction was performed using equally diluted samples to ensure that band intensities were below saturation. Each analysis was performed at least three times at different dilutions of each sample of the original cDNA. The result of single dilution for all of the samples in a given set that most clearly showed differences in expression is presented in Figure 4. Care was taken to ensure that the number of cycles used was standardized for each comparative analysis and accurately represented the amount of PCR product in relationship to the cycle number.
Table 1.
Oligosequences for PCR
Collagenase 3 (MMP-13) | D (1241–1259) GATAAAGACTATCCGAGAC | R (1369–1386) GAGTAACCGTATTGTTCG |
Gelatinase B (MMP-9) | D (139–156) GCAGAGGAATACCTGTAC | R (361–377) CACAACATCACCTACTG |
Parathyroid hormone-related peptide (PTHrP) | D (233–253) GAAATCAGAGCTACCTCGGAG | R (317–336) GATGAGGGCAGATACCTAAC |
Procollagen type X(α1) (COL10A1) | D (1655–1680) CAGGAATGCCTGTGTCTGCTTTTAC | R (1957–1980) GACCAGGTGTGGCTCCAGCTTCCC |
Interleukin 1β (IL-1β) | D (710–728) GGAAAAGCGATTTGTCTTC | R (844–863) GCCAGGATATAACTGACTTC |
Tumor necrosis factor- α (TNF-α) | D (633–650) GTCTCCTACCAGACCAAG | R (816–837) GAGTCTGGGCAGGTCTACTTTG |
Prostaglandin E synthase (PGES)-1 | D (311–329) CTTCGTCTACTCCTTTCTG | R (577–595) GACTTGATGTTCCTTCCAG |
18sRNA | D (29–52) CTACTTGGATAACTGTGGTAATTC | R (181–197) GACTCTAGATAACCTTCG |
Figure 4.
Gene expression, measured by RT-PCR in human OA articular cartilage of a 79-year-old male (A), an 82-year-old male (C), an 82-year-old female (E), a 71-year-old female (B), a 73-year-old male (D), and a 64-year-old female (F) cultured with (+) and without (−)10 ng/ml TGF-β2. 18sRNA is used as a gel loading reference.
The isolated clones of each amplified cDNA fragment were sequenced to verify the identity of the cDNA products. Only RNA samples having no DNA contamination were used. The lack of chromosomal DNA contamination in RNA samples was confirmed by amplification in PCR aliquots of nonreverse-transcribed RNA as a template. To avoid potential variation in efficiency between experiments, all samples were simultaneously subjected to reverse transcription, and all samples of cDNA were simultaneously amplified in PCR.
Statistical Analysis
Quantitative data were expressed as the mean ± SD. Assays were run at least in triplicate. A normality test showed that data are distributed according to a Gaussian distribution curve. To analyze treatment effects, Mann-Whitney and paired t-test analyses were used. P values less than 0.05 were considered significant.
Results
Inhibition of Collagenase Activity by Growth Factors
Growth factors TGF-β2 (10 ng/ml), FGF-2 (10 ng/ml), and insulin (100 ng/ml) alone and in combination (GF), previously used to suppress hypertrophy in growth plate chondrocytes,42 were capable of inhibiting type II collagen cleavage by collagenase in cultured OA articular cartilages (Figure 1a). Collagenase activity varied, as revealed by C1,2C values in control explants. Inhibition by growth factors also varied among specimens. As shown in five representative individual studies, the mean combined growth factor inhibition was 56.5%, and individual results varied from 45 to 70.3% inhibition.
Figure 1.
Inhibition of collagen cleavage by collagenase (a) and release of total proteoglycan (GAG release) in conditioned media (b) in human OA cartilage explants treated with combined growth factors (10 ng/ml TGF-β2, 10 ng/ml FGF-2, and 100 ng/ml insulin) and individually: 10 ng/ml TGF-β2, 10 ng/ml FGF-2, or 100 ng/ml insulin. The ages and sexes of patients are indicated. P value (paired t-test analysis) less than 0.05 is considered significant and is shown compared to control (*).
TGF-β2 alone inhibited collagenase activity in all five individual studies (Figure 1a) and in 19 other explants (Figure 2). Analysis of the five individual cases revealed a mean inhibition of 59.2% (range, 54.6 to 62.4%), which was as effective as the growth factors. It was more potent than insulin (mean, 48.5%; range, 25.8 to 64.5%), which significantly inhibited collagen cleavage in four of five explant cultures. FGF-2 alone down-regulated collagen cleavage by only 26.5% (mean) (range, 0 to 61%) and showed significant inhibition in only two of five explants.
Figure 2.
Inhibition of type II collagen cleavage by collagenase in human OA articular cartilage explants by 10 ng/ml TGF-β2 alone. P value (Mann-Whitney analysis) less than 0.05 is considered significant and is shown compared to control (*).
Although we used a TGF-β2 concentration of 10 ng/ml based on its previous usage for growth plate chondrocytes,42 collagen degradation in some OA articular cartilage samples was inhibited by as little as 0.1 or 1 ng/ml of TGF-β2 depending on the patient studied. Three representative examples of these dose-response studies are shown in Figure 3. However, as we did not routinely have sufficient cartilage from a single patient to examine this range of TGF-β2 concentrations, we ordinarily used the higher concentration (10 ng/ml) that was known to potently suppress normal chondrocyte hypertrophy.42
Figure 3.
Concentration-dependent inhibition of collagen cleavage by TGF-β2 in human OA explants. The ages and sexes of patients are indicated. P value (paired t-test analysis) less than 0.05 is considered significant and is shown compared to control (*).
Proteoglycan Release Is Not Significantly Affected by Treatment with Growth Factors
Down-regulation of collagen cleavage by growth factors in combination or individually was never accompanied by inhibition in GAG release (Figure 1b). Treatment with the growth factor combination or TGF-β2 alone resulted in a significant increase in GAG release in one of five cases. There were no effects of the other growth factors on this GAG release.
Alterations of Gene Expression in OA Cartilage Explants by Growth Factors
Cartilage explants from six OA patients were examined in culture with or without TGF-β2 (10 ng/ml) for expression of genes characteristic of chondrocyte hypertrophy. Generation of C1,2C epitope was always significantly down-regulated in all cultures in the manner shown in Figure 2 (data not shown). The analysis of the effects of TGF-β2 at 10 ng/ml for these six patients was conducted throughout a 48-hour period, with changes in gene expression being recorded at 6, 24, and 48 hours. The individual results are presented in Figure 4 and summarized in Table 2 to permit a clear appreciation of this data. The summary was prepared by recording the total changes (down-regulation, up-regulation, no change, or no detectable expression) for either control or plus TGF-β2 at each time point and for each patient (total possible score is therefore 18 for the three time points and six patients).
Table 2.
Summary of Gene Expression in OA Articular Cartilage Explants
Gene expression response in patients treated with TGF-β*
|
||||
---|---|---|---|---|
Down-regulation | Up-regulation | No change | No expression | |
COL10A1 | 18 | 0 | 0 | 0 |
PTHrP | 10 | 4 | 3 | 1 |
MMP-13 | 10 | 0 | 2 | 6 |
MMP-9 | 11 | 0 | 2 | 5 |
IL-1β | 15 | 0 | 1 | 2 |
TNFα | 11 | 0 | 0 | 7 |
PGES-1 | 0 | 16 | 2 | 0 |
The data represents the results of TGF-β2 treatments shown in Figure 4 of all OA explants for all time points and for all six patients. A maximum score is 3 for each gene and for each patient. Thus the maximum score for six patients is 18.
It can be seen that in a majority of cases gene expression was recorded. For all genes examined, with the exception of PGE synthase-1 that was usually up-regulated (16 of 18), TGF-β2 down-regulated gene expression in a majority of cases (range, 10 to 18 of 18). Except for PGES-1 only one other gene showed any evidence for a weak up-regulation. This was PTHrP (4 of 18), which has the capacity to suppress chondrocyte hypertrophy.49–51 In a minority of cases (range, 0 to 3 of 18 for each gene) no changes were observed. Thus, TGF-β2 suppresses the expression of the cytokines IL-1β(15 of 16 detected) and TNF-α (11 of 12 detected) and suppresses expression of differentiation markers, namely COL10A1 (18 of 18 detected), MMP-13 (10 of 12 detected), and MMP-9 (11 of 13 detected). PGE synthase-1 was increased in 16 of 18 cases.
Up-Regulation of PGE2 Production on Treatment with TGF-β2
Up-regulation of PGES-1 expression by TGF-β2 in the same cartilages analyzed for gene expression was accompanied by the up-regulation of PGE2 release into the conditioned medium (Figure 5). The treatment with the growth factor resulted in a significant increase in PGE2 in four of six explants tested. The results for PGE2 assay are not dissimilar to the results obtained for gene expression in which the latter was strongest for the 64-year-old female and weakest for the 82-year-old male, the same upper and lower limits being seen on immunoassay.
Figure 5.
PGE2 release induced by TGF-β2 in OA articular cartilage explants. The ages and sexes of patients are indicated. P value (paired t-test analysis) less than 0.05 is considered significant and is shown compared to control (*).
Discussion
Inhibition of articular cartilage degeneration is a priority in the effective treatment of OA because there are no disease-modifying therapies available. As excessive damage to type II collagen is considered an irreversible step of cartilage degradation in OA, in contrast to proteoglycan loss,4 down-regulation of collagen cleavage is viewed as an important endpoint in the inhibition of cartilage degeneration. The similarity between type II collagen degradation in OA to that in the hypertrophic zone of the primary growth plate include up-regulation of cleavage of type II collagen by collagenases and the expression of differentiation-related genes associated with chondrocyte hypertrophy.1,3,11,12 Therefore, it was very interesting to find that down-regulation of type II collagen cleavage in human cultured OA explants can be induced by the same growth factors that can suppress hypertrophy of growth plate chondrocytes in culture.37,42 Of these three growth factors, TGF-β2 was the most potent in suppressing the cleavage of type II collagen. It also suppressed the expression of chondrocyte hypertrophy-associated genes such as COL10A1, MMP-9, and PTHrP, as well as MMP-13, a collagenase believed to be mainly involved in matrix degradation in OA cartilage.1,2 In the case of PTHrP, a weak up-regulation was observed in four cases. This would favor suppression of any progression in hypertrophy, besides being an early differentiation marker.49–51 Therefore, TGF-β2 inhibition of collagen cleavage involves suppression of full chondrocyte differentiation.
The importance of molecules of the TGF-β superfamily in the maintenance of a healthy articular cartilage has been suggested by genetic manipulations in mice that produce either overexpression of a functionless type II receptor52 or the deletion of a SMAD signaling component53 used by ligands of the TGF-β family. In both cases these genetic alterations lead to the degeneration and loss of articular cartilage in aging mice resembling OA. This was accompanied by the extensive development of chondrocyte hypertrophy and the formation of large osteophytes. Moreover, TGF-β2-null mice exhibit multiple skeletal abnormalities that result in size reductions of normal tissues, reflecting abnormalities in the process of endochondral bone formation.54 These mice differ from TGF-β1-null mice, which have an autoimmune-like inflammatory disease.55
Although it is difficult to predict whether the results from in vitro studies directly reflect the in vivo situation, the available evidence suggests that the presence of TGF-β2 in articular cartilage favors the formation and maintenance of articular cartilage in vivo. TGF-β2 is the most widely and highly expressed isoform in all zones of the developing human bone,56 and its expression is reduced in adult rat articular cartilage when degenerative changes occur.57 Because OA affects mostly the aging population, a deficiency of TGF-β2 would favor degeneration. This is supported by the observation that the expression of TGF-β2 is significantly decreased in advanced stages of human or experimental OA articular cartilage.58–60 In osteoarthritic cartilage there may be deficiency in TGF-β2 activation resulting from the lack of its activator plasmin, the activity of which may be limited by high concentrations of plasminogen activator inhibitor (PAI-1) seen in OA patients.61,62
There is no evidence from our studies that TGF-β2 acts catabolically in OA articular cartilage. However it may be destructive for normal articular cartilage in vivo because intra-articular injections of TGF-β2 in high concentration produce catabolic effects in rabbit joints resulting in joint swelling, fibroblastic proliferation of synovial membrane, and profound loss of articular cartilage proteoglycan.63
The observed reduction in MMP-13 expression and the reduced collagen cleavage produced by TGF-β2 is also in agreement with observations that TGF-β family members can individually down-regulate expression of the collagenase MMP-13.28,64,65 In contrast others have shown that TGF-β1 and -2 can induce collagenaseexpression.66–68 We never observed any evidence for an increase in type II collagen cleavage by TGF-β2. In fact the opposite was seen. The fact that proteoglycan degradation was unaffected suggests that collagen and aggrecan degradation in OA cartilage are differently regulated. When chondrocytes become hypertrophic in the growth plate, collagen cleavage and loss is not accompanied by a net loss of proteoglycan.21
Down-regulation of MMP-9 by TGF-β2 may be important for the control of degradation of articular cartilage collagen after its primary cleavage by collagenase.3 In OA cartilage increased MMP-9 expression69 and protein staining70 has also been detected. MMP-9 may also be directly involved in chondrocyte differentiation because it is expressed in the hypertrophic zone of the bovine19 and rabbit71 growth plates and has been found in human72,73 and chick74 fetal hypertrophic chondrocytes.
Although TGF-β2 alone was effective in controlling collagen degradation and the other growth factors did not interfere with this property, a combination of growth factors such as we studied here could be more beneficial in vivo when it is desirable to combine an inhibition of excessive collagen cleavage with a stimulation of extracellular matrix repair. Thus, in responsive individuals insulin may facilitate tissue repair because it is a principal anabolic agent in the articular cartilage.75 FGF-2 can also promote cartilage repair76–79 by itself as well as induce local TGF-β or its own expression.80 In addition combinations of these and other growth factors produce synergistic effects in maintaining synthesis of matrix molecules in articular and growth plate chondrocytes.37,81,82 In contrast TGF-β2 alone may not be capable of restoring the anabolic functions of healthy articular cartilage since it has been reported to down-regulate type II collagen and aggrecan synthesis,37,63 although these different effects of TGF-β2 may be very dose-dependent. The potency of TGF-β2 in the down-regulation of collagen cleavage may be associated with the increased responsiveness of OA chondrocytes to this growth factor.83 In contrast, responsiveness to insulin-like growth factor 1 and FGF-2 decreases with age, joint inflammation, and OA.75,84,85
In our in vitro study, TGF-β2 was shown to suppress expression of the genes for IL-1β and TNF-α, which, like the other genes we studied, are not usually expressed in normal articular cartilage.20,27,86 The down-regulation of cytokine IL-1β and TNF-α expression is noteworthy because these cytokines are considered to be important chondrocyte catabolic factors in OA,9 and inhibition of these cytokines also suppresses collagenase activity and proteoglycan degradation in OA cartilage.5 The ability of TGF-β1 to counteract the catabolic effects of paracrine IL-1β in rodent articular chondrocytes has been also shown.28,87,88
PGE2 can produce both catabolic and anabolic effects in articular chondrocytes.89 The up-regulation of prostaglandin E synthase-1, as well as PGE2 release by TGF-β2 observed here, confirms earlier results that demonstrated PGE2 release into the normal rabbit knee joint after intra-articular injections of the growth factor.63 In this case it resulted in joint swelling and cartilage proteoglycan loss. In our explants TGF-β2 treatment did not produce evidence of proteoglycan release in the majority of tested cartilages. This may result from PGE2 signaling through the EP2 receptor subtype, which has been shown to mediate anabolic responses of PGE2 in human articular chondrocytes promoting growth, protecting against apoptosis, and counteracting IL-1-induced production of IL-6.89,90 Inhibition of chondrocyte terminal differentiation by PGE2 has also been observed in animal studies.91,92 Our results clearly demonstrate that increased expression of PGE synthase-1 and PGE2 production occur in association with the suppression of collagen cleavage. The significance of this observation awaits further study.
In conclusion, our results suggest that the excessive cleavage of type II collagen by collagenase observed in cultured OA articular cartilage can be suppressed by TGF-β2 and that this involves cellular events associated with suppression of chondrocyte hypertrophy and arrest of IL-1β and TNF-αexpression, accompanied by increased PGE2 production. Because TGF-β2 may play a role that favors the maintenance of a prehypertrophic phenotype, therapy aimed at controlling the activity of cytokines and chondrocyte differentiation may be of value in the management of cartilage degeneration in patients with OA.
Footnotes
Address reprint requests to Elena Tchetina, Ph.D., Joint Diseases Laboratory, Shriners Hospitals for Children, 1529 Cedar Ave., Quebec, H3G 1A6, Canada. E-mail: etchetina@shriners.mcgill.ca.
Supported by the Shriners Hospitals for Children (grant no. 8660); the Canadian Institutes of Health Research (grant no. 9276); the Canadian Arthritis Network; and the National Institutes of Health, National Institute of Aging (grant no. 2RO1AG13857-05 to A.R.P.).
References
- Billinghurst RC, Dahlberg L, Ionescu M, Reiner A, Bourne R, Rorabeck R, Mitchell P, Hambor J, Diekmann O, Tschesche H, Chen J, van Wart H, Poole AR. Enhanced cleavage of type II collagen by collagenases in osteoarthritic cartilage. J Clin Invest. 1997;99:1534–1545. doi: 10.1172/JCI119316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dahlberg L, Billinghurst RC, Manner P, Nelson F, Webb G, Ionescu M, Reiner A, Tanzer M, Zukor D, Chen J, van Wart HE, Poole AR. Selective enhancement of collagenase-mediated cleavage of resident type II collagen in cultured osteoarthritic cartilage and arrest with a synthetic inhibitor that’s speres collagenase (matrix metalloproteinase). Arthritis Rheum. 2000;43:673–682. doi: 10.1002/1529-0131(200003)43:3<673::AID-ANR25>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
- Poole AR, Howell DS. Etiopathogenesis of osteoarthritis. RW Moskowitz, Howell DS, Altman RD, Buckwalter JA, Goldberg VM., editors. Philadelphia: WB Saunders Co.,; OsteoarthritisDiagnosis and Medical/Surgical Management. (ed 3) 2001:pp 29–47. [Google Scholar]
- Poole AR. Cartilage in health and disease. Koopman W, editor. Philadelphia: Lippincott, Williams, and Wilkins,; Arthritis and Allied ConditionsA Textbook of Rheumatology. (ed 15) 2005:pp 223–269. [Google Scholar]
- Kobayashi M, Squires GR, Mousa A, Tanzer M, Zukor DJ, Antoniou J, Feige U, Poole AR. Pole of interleukin-1 and tumor necrosis factor alpha in matrix degradation of human osteoarthritic cartilage. Arthritis Rheum. 2005;52:128–135. doi: 10.1002/art.20776. [DOI] [PubMed] [Google Scholar]
- Hardy MM, Seibert K, Manning PT, Currie MG, Woerner BM, Edwards D, Koki A, Tripp CS. Cyclooxygenase 2-dependent prostaglandin E2 modulates cartilage proteoglycan degradation in human osteoarthritic explants. Arthritis Rheum. 2002;46:1789–1803. doi: 10.1002/art.10356. [DOI] [PubMed] [Google Scholar]
- Pelletier JP, Martel-Pelletier J. Evidence for the involvement of interleukin 1 in human osteoarthritic cartilage degradation: protective effect of NSAID. J Rheumatol Suppl. 1989;18:19–27. [PubMed] [Google Scholar]
- Aigner T, Kurz B, Fukui N, Sandell L. Roles of chondrocytes in the pathogenesis of osteoarthritis. Curr Opin Rheumatol. 2002;14:578–584. doi: 10.1097/00002281-200209000-00018. [DOI] [PubMed] [Google Scholar]
- Sandel LJ, Aigner T. Articular cartilage and changes in arthritis. An introduction: cell biology of osteoarthritis. Arthritis Res. 2001;3:107–113. doi: 10.1186/ar148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nelson F, Dahlberg L, Laverty S, Reiner A, Pidoux I, Ionescu M, Fraser GL, Brooks E, Tanzer M, Rosenberg LC, Dieppe P, Poole AR. Evidence for altered synthesis of type II collagen in patients with osteoarthritis. J Clin Invest. 1998;102:2115–2125. doi: 10.1172/JCI4853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- von der Mark K, Kirsch T, Nerlich A, Kuss A, Weseloh G, Gluckert K, Stoss H. Type X collagen synthesis in human osteoarthritic cartilage—indication of chondrocyte hypertrophy. Arthritis Rheum. 1992;35:806–811. doi: 10.1002/art.1780350715. [DOI] [PubMed] [Google Scholar]
- Kirsch T, Swoboda B, Nah H. Activation of annexin II and V expression, terminal differentiation, mineralization and apoptosis in human osteoarthritic cartilage. Osteoarthritis Cartilage. 2000;8:294–302. doi: 10.1053/joca.1999.0304. [DOI] [PubMed] [Google Scholar]
- Girkontaite I, Frischholz S, Lammli P, Wagner K, Swoboda B, Aigner T, von der Mark K. Immunolocalization of type X collagen in normal fetal and adult articular cartilage with monoclonal antibodies. Matrix Biol. 1996;15:231–238. doi: 10.1016/s0945-053x(96)90114-6. [DOI] [PubMed] [Google Scholar]
- Aigner T, Zhu Y, Chanksi H, Matsen FA, Maloney WJ, Sandell LJ. Reexpression of procollagen type IIA by adult articular chondrocytes in osteoarthritic cartilage. Arthritis Rheum. 1999;42:1443–1450. doi: 10.1002/1529-0131(199907)42:7<1443::AID-ANR18>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
- Aigner T, Berting W, Stoss H, Weseloh G, von der Mark K. Independent expression of fibril-forming collagens I, II and III in chondrocytes in human osteoarthritic cartilage. J Clin Invest. 1993;91:829–837. doi: 10.1172/JCI116303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nerlich AG, Wiest I, von der Mark K. Immunohistochemical analysis of interstitial collagens in cartilage of different stages of osteoarthrosis. Virchows Arch. 1993;B63:249–255. doi: 10.1007/BF02899269. [DOI] [PubMed] [Google Scholar]
- Martin I, Jakob M, Schafer D, Dick W, Spagnoli G, Heberer M. Quantitative analysis of gene expression in human articular cartilage from normal and osteoarthritic joints. Osteoarthritis Cartilage. 2000;9:112–118. doi: 10.1053/joca.2000.0366. [DOI] [PubMed] [Google Scholar]
- Tchetina EV, Squires G, Poole AR. Increased type II collagen degradation and very early focal cartilage degeneration is associated with the upregulation of chondrocyte differentiation related genes in early human articular cartilage lesions. J Rheumatol. 2005;32:876–886. [PubMed] [Google Scholar]
- Tchetina EV, Mwale F, Poole AR. Distinct phases of coordinated early and late gene expression in growth plate chondrocytes in relationship to cell proliferation, matrix assembly, remodelling, and cell differentiation. J Bone Miner Res. 2003;18:844–851. doi: 10.1359/jbmr.2003.18.5.844. [DOI] [PubMed] [Google Scholar]
- Poole AR. What type of cartilage repair are we attempting to attain? J Bone Joint Surg. 2003;85A(Suppl 2):40–44. doi: 10.2106/00004623-200300002-00006. [DOI] [PubMed] [Google Scholar]
- Mwale F, Tchetina E, Wu W, Poole AR. The assembly and remodelling of the extracellular matrix in the growth plate in relationship to mineral deposition and cellular hypertrophy: an in situ study of collagens II and IV and proteoglycan. J Bone Miner Res. 2002;17:275–283. doi: 10.1359/jbmr.2002.17.2.275. [DOI] [PubMed] [Google Scholar]
- Wu W, Tchetina E, Mwale F, Hasty K, Pidoux I, Reiner A, Chen J, van Wart HE, Poole AR. Proteolysis involving MMP-13 (collagenase-3) and the expression of the chondrocyte hypertrophic phenotype. J Bone Miner Res. 2002;17:639–651. doi: 10.1359/jbmr.2002.17.4.639. [DOI] [PubMed] [Google Scholar]
- Stickens D, Behonick DJ, Ortega N, Heyer B, Hartenstein B, Yu Y, Fasang AJ, Schorpp-Kistner M, Angel P, Werb Z. Altered endochondral bone development in matrix metalloproteinase 13-deficient mice. Development. 2005;131:5883–5895. doi: 10.1242/dev.01461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Babarina AV, Mollers U, Bittner K, Vischer P, Bruckner P. Role of subchondral vascular system in endochondral ossification: endothelial cell-derived proteinases derepress late cartilage differentiation in vitro. Matrix Biol. 2001;20:205–213. doi: 10.1016/s0945-053x(01)00132-9. [DOI] [PubMed] [Google Scholar]
- Aigner T, Vornehm SI, Zeiler G, Dudhia J, von der Mark K, Bayliss MT. Suppression of cartilage matrix gene expression in upper zone chondrocytes of osteoarthritic cartilage. Arthritis Rheum. 1997;40:562–569. doi: 10.1002/art.1780400323. [DOI] [PubMed] [Google Scholar]
- Aigner T, Gluckert K, von der Mark K. Activation of fibrillar collagen synthesis and phenotypic modulation of chondrocytes in early human osteoarthritic cartilage lesions. Osteoarthritis Cartilage. 1997;5:183–189. doi: 10.1016/s1063-4584(97)80013-1. [DOI] [PubMed] [Google Scholar]
- Aigner T, McKenna L. Molecular pathology and pathobiology of osteoarthritic cartilage. Cell Mol Life Sci. 2002;59:5–18. doi: 10.1007/s00018-002-8400-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Scharstuhl A, Glansbeek HL, van Beuningen HM, Vitters EL, van der Kraan PM, van den Berg WB. Inhibition of endogenous TGF-β during experimental osteoarthritis prevents osteophyte formation and impairs cartilage repair. J Immunol. 2002;169:507–514. doi: 10.4049/jimmunol.169.1.507. [DOI] [PubMed] [Google Scholar]
- Bos PK, van Osch JVM, Frenz DA, Verhaar JAN, Verwoerd-Verhoef HL. Growth factor expression in cartilage wound healing: temporal and spatial immunolocalization in a rabbit auricular cartilage wound model. Osteoarthritis Cartilage. 2001;9:382–389. doi: 10.1053/joca.2000.0399. [DOI] [PubMed] [Google Scholar]
- Goggs R, Carter SD, Schulze-Tanzil G, Shakibaei M, Mobasheri A. Apoptosis and the loss of chondrocyte survival signals contribute to articular cartilage degradation in osteoarthritis. Veterinary J. 2003;166:140–158. doi: 10.1016/s1090-0233(02)00331-3. [DOI] [PubMed] [Google Scholar]
- Lotz M, Hashimoto S, Kuhn K. Mechanisms of chondrocyte apoptosis. Osteoarthritis Cartilage. 1999;7:389–391. doi: 10.1053/joca.1998.0220. [DOI] [PubMed] [Google Scholar]
- Kuhn K, D’Lima DD, Hashimoto S, Lotz M. Cell death in cartilage. Osteoarthritis Cartilage. 2004;12:1–16. doi: 10.1016/j.joca.2003.09.015. [DOI] [PubMed] [Google Scholar]
- Kato Y, Iwamoto M. Fibroblast growth factor is an inhibitor of terminal differentiation. J Biol Chem. 1990;110:1417–1426. [PubMed] [Google Scholar]
- Iwamoto M, Shimazu A, Nakashima K, Suzuki F, Kato Y. Reduction in basic fibroblast growth factor receptor is coupled with terminal differentiation of chondrocytes. J Biol Chem. 1991;266:461–467. [PubMed] [Google Scholar]
- Iwamoto M, Shimazu A, Pacifici M. Regulation of chondrocyte maturation by fibroblast growth factor-2 and parathyroid hormone. J Orthop Res. 1995;13:838–845. doi: 10.1002/jor.1100130606. [DOI] [PubMed] [Google Scholar]
- Deng CX, Wynshaw-Boris A, Zhou F, Kuo A, Leder P. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell. 1996;84:911–921. doi: 10.1016/s0092-8674(00)81069-7. [DOI] [PubMed] [Google Scholar]
- Bohme K, Winterhalter KH, Bruckner P. Terminal differentiation of chondrocytes is a spontaneous process and is arrested by transforming growth factor-beta-2 and basic fibroblast growth factor in synergy. Exp Cell Res. 1995;216:191–198. doi: 10.1006/excr.1995.1024. [DOI] [PubMed] [Google Scholar]
- Laron Z. Insulin growth factor 1 (IGF-1): a growth hormone. Mol Pathol. 2001;54:311–316. doi: 10.1136/mp.54.5.311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fenton JI, Chlebek-Brown KA, Peters TL, Caron JP, Orth MW. Glucosamine HCl reduces equine articular cartilage degradation in explant culture. Osteoarthritis Cartilage. 2000;8:258–265. doi: 10.1053/joca.1999.0299. [DOI] [PubMed] [Google Scholar]
- Hui W, Rowan AD, Cawston TE. Transforming growth factor β1 blocks the release of collagen fragments from bovine nasal cartilage stimulated by oncostatin M in combination with interleukin-1. Cytokine. 2000;12:765–769. doi: 10.1006/cyto.1999.0625. [DOI] [PubMed] [Google Scholar]
- Trippel SB. Growth factor actions on articular cartilage. J Rheumatol. 1995;22:S43–S129. [PubMed] [Google Scholar]
- Szuts V, Mollers U, Bittner K, Schurmann G, Muratoglu S, Deak F, Kiss I, Bruckner P. Terminal differentiation of chondrocytes is arrested at distinct stages identified by their expression repertoire of marker genes. Matrix Biol. 1998;17:435–448. doi: 10.1016/s0945-053x(98)90103-2. [DOI] [PubMed] [Google Scholar]
- Crabb ID, O’Keefe RJ, Puzas JE, Rosier RN. Synergistic effect of transforming growth factor-beta and fibroblast growth factor on DNA synthesis in chick growth plate chondrocytes. J Bone Miner Res. 1990;5:1105–1112. doi: 10.1002/jbmr.5650051103. [DOI] [PubMed] [Google Scholar]
- Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, Christy W, Cooke TD, Greenwald R, Hochberg M, Howell D, Kaplan D, Koopman W, Longley S, Mankin H, McShane DJ, Medsger T, Meenan R, Mikkelsen W, Moskowitz R, Murphy W, Rothschild B, Segal M, Sokoloff L, Wolfe F. Development of criteria for the classification and reporting of osteoarthritis: classification of osteoarthritis of the knee. Arthritis Rheum. 1986;29:1039–1149. doi: 10.1002/art.1780290816. [DOI] [PubMed] [Google Scholar]
- Billinghurst RC, Wu W, Ionescu M, Reiner A, Dahlberg L, Chen J, van Wart H, Poole AR. Comparison of the degradation of type II collagen and proteoglycan in nasal and articular cartilages induced by interleukin-1 and the selective inhibition of type II collagen cleavage by collagenase. Arthritis Rheum. 2000;43:664–672. doi: 10.1002/1529-0131(200003)43:3<664::AID-ANR24>3.0.CO;2-D. [DOI] [PubMed] [Google Scholar]
- Squires G, Pidoux I, Okouneff S, Ionescu M, Poole AR. The development of focal lesions in aging human articular cartilage involves molecular changes in type II collagen and aggrecan characteristic of osteoarthritis. Arthritis Rheum. 2003;48:1261–1270. doi: 10.1002/art.10976. [DOI] [PubMed] [Google Scholar]
- Farndale RW, Buttle GJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta. 1986;883:173–177. doi: 10.1016/0304-4165(86)90306-5. [DOI] [PubMed] [Google Scholar]
- Rizkalla G, Reiner A, Bogoch E, Poole AR. Studies of the articular cartilage proteoglycan aggrecan in health and arthritis: evidence for molecular heterogeneity and extensive molecular changes in disease. J Clin Invest. 1992;90:2268–2277. doi: 10.1172/JCI116113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karaplis AC, Luz J, Gowacki J, Bronson RT, Tybulewicz VL, Kronenberg HM, Mulligan RC. Lethal skeletal dysplasia from targeted disruption of the parathyroid-hormone-related peptide gene. Genes Dev. 1994;8:277–289. doi: 10.1101/gad.8.3.277. [DOI] [PubMed] [Google Scholar]
- Amizuka N, Warshawsky H, Henderson JD, Goltzman D, Karaplis AC. Parathyroid hormone-related peptide-depleted mice show abnormal epiphyseal cartilage development and altered endochondral bone formation. J Cell Biol. 1994;126:1611–1623. doi: 10.1083/jcb.126.6.1611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weir EC, Philbrick WM, Amling LA, Neff LA, Baron R, Broadus AE. Targeted overexpression of parathyroid hormone-related peptide in chondrocytes ceases chondrodysplasia and delayed endochondral bone formation. Proc Natl Acad Sci USA. 1996;93:10240–10245. doi: 10.1073/pnas.93.19.10240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Serra R, Johnson M, Filvaroff EH, LaBorde J, Sheehan DM, Derynck R, Moses HL. Expression of a truncated, kinase-defective TGFβ type II receptor in mouse skeletal tissue promotes terminal chondrocyte differentiation and osteoarthritis. J Cell Biol. 1997;139:541–552. doi: 10.1083/jcb.139.2.541. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang X, Chen L, Xu X, Li C, Huang C, Deng C-X. TGFβ2/Smad signals repress chondrocyte hypertrophic differentiation and are required for maintaining articular cartilage. J Cell Biol. 2001;153:35–46. doi: 10.1083/jcb.153.1.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sanford LP, Ormsby I, Gittenberger-de Groot AC, Sariola H, Friedman R, Boivin GP, Cardell EL, Doetschman T. TGFβ2 knockout mice have multiple developmental defects that are non-overlapping with other TGFβ knockout phenotypes. Development. 1997;124:2659–2670. doi: 10.1242/dev.124.13.2659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shull MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Protzel G, Calvin D, Annunziata N, Doetschman T. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature. 1992;359:693–699. doi: 10.1038/359693a0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Horner A, Kemp P, Summers C, Bord S, Bishop NJ, Kelsall AW, Coleman N, Compston JE. Expression and distribution of transforming growth factor-β isoforms and their signaling receptors in growing human bone. Bone. 1998;23:95–102. doi: 10.1016/s8756-3282(98)00080-5. [DOI] [PubMed] [Google Scholar]
- Fukumura K, Matsunaga S, Yamamoto T, Nagamine T, Ishidou Y, Sakou T. Immunolocalization of transforming growth factor-βs and type I and type II receptors in rat articular cartilage. Anticancer Res. 1998;18:4189–4194. [PubMed] [Google Scholar]
- Verdier M-P, Seite S, Guntzer K, Pujol J-P, Boumediene K. Immunohistochemical analysis of transforming growth factor beta isoforms and their receptors in human cartilage from normal and osteoarthritic femoral heads. Rheumatol Int. 2005;25:118–124. doi: 10.1007/s00296-003-0409-x. [DOI] [PubMed] [Google Scholar]
- Boumediene K, Conrozier T, Mathieu P, Richard M, Marcelli C, Vignon E, Pujol J-P. Decrease of cartilage transforming growth factor-β receptor II expression in the rabbit experimental osteoarthritis—potential role in cartilage breakdown. Osteoarthritis Cartilage. 1998;6:146–149. doi: 10.1053/joca.1997.0104. [DOI] [PubMed] [Google Scholar]
- Gomez-Camarillo MA, Kouri JB. Ontogeny of rat chondrocyte proliferation: studies in embryo, adult and osteoarthritic cartilage. J Cell Res. 2005;15:99–104. doi: 10.1038/sj.cr.7290273. [DOI] [PubMed] [Google Scholar]
- Ghosh P, Cheras PA. Vascular mechanisms in osteoarthritis. Best Practice Res Clin Rheum. 2001;15:693–710. doi: 10.1053/berh.2001.0188. [DOI] [PubMed] [Google Scholar]
- Pelton RW, Saxena B, Jones M, Moses HL, Gold LI. Immunohistochemical localization of TGFβ1, TGFβ2, and TGFβ3 in the mouse embryo: expression patterns suggest multiple roles during embryonic development. J Cell Biol. 1991;115:1091–1105. doi: 10.1083/jcb.115.4.1091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Elford PR, Graeber M, Ohtsu H, Aeberhard M, Legendre B, Wishart WL, MacKenzie A. Induction of swelling, synovial hyperplasia and cartilage proteoglycan loss upon intra-articular injection of transforming growth factor-β2 in the rabbit. Cytokine. 1992;4:232–238. doi: 10.1016/1043-4666(92)90061-u. [DOI] [PubMed] [Google Scholar]
- Shlopov BV, Smith GN, Cole AA, Hasty KA. Differential patterns of response to doxycycline and transforming growth factor beta 1 in the downregulation of collagenases in osteoarthritic and normal human chondrocytes. Arthritis Rheum. 1999;42:719–727. doi: 10.1002/1529-0131(199904)42:4<719::AID-ANR15>3.0.CO;2-T. [DOI] [PubMed] [Google Scholar]
- Shlopov BV, Gumanovskaya ML, Hasty KA. Autocrine regulation of collagenase 3 (matrix metalloproteinase 13) during osteoarthritis. Arthritis Rheum. 2000;43:195–205. doi: 10.1002/1529-0131(200001)43:1<195::AID-ANR24>3.0.CO;2-G. [DOI] [PubMed] [Google Scholar]
- Zerath E, Holy X, Mouillon JM, Farbos B, Machwate M, Andre C, Renault S, Marie PJ. TGFβ2 prevents the impaired chondrocyte proliferation induced by unloading in growth plates of young rats. Life Sci. 1997;61:2397–2406. doi: 10.1016/s0024-3205(97)00957-0. [DOI] [PubMed] [Google Scholar]
- Tardif G, Pelletier J-P, Dupuis M, Geng C, Cloutier J-M, Martel-Pelletier J. Collagenase 3 production by human osteoarthritic chondrocytes in response to growth factors and cytokines is a function of the physiologic state of the cells. Arthritis Rheum. 1999;42:1147–1158. doi: 10.1002/1529-0131(199906)42:6<1147::AID-ANR11>3.0.CO;2-Y. [DOI] [PubMed] [Google Scholar]
- Moldovan F, Pelletier JP, Mineau F, Dupuis M, Cloutier JM, Martel-Pelletier J. Modulation of collagenase 3 in human osteoarthritic cartilage by activation of extracellular transforming growth factor beta: role of furin convertase. Arthritis Rheum. 2000;43:2100–2109. doi: 10.1002/1529-0131(200009)43:9<2100::AID-ANR22>3.0.CO;2-#. [DOI] [PubMed] [Google Scholar]
- Freemont AJ, Hampson V, Tilman R, Goupille P, Taiwo Y, Hoyland JA. Gene expression of matrix metalloproteinases 1, 3, and 9 by chondrocytes in osteoarthritic human knee articular cartilage is zone and grade specific. Ann Rheum Dis. 1997;56:542–549. doi: 10.1136/ard.56.9.542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tetlow LC, Woolley DE. Expression of vitamin D receptors and matrix metalloproteinases in osteoarthritic cartilage and human articular chondrocytes in vitro. Osteoarthritis Cartilage. 2001;9:423–431. doi: 10.1053/joca.2000.0408. [DOI] [PubMed] [Google Scholar]
- Kawashima-Ohya Y, Satakeda H, Kuruta Y, Kawamoto T, Yan W, Akagawa Y, Hawakawa T, Noshiro M, Okada Y, Nakamuro S, Kato Y. Effects of parathyroid hormone (PTH) and PTH-related peptide on expression of matrix metalloproteinase-2, -3, and -9 in growth plate chondrocyte cultures. Endocrinology. 1998;139:2120–2127. doi: 10.1210/endo.139.4.5941. [DOI] [PubMed] [Google Scholar]
- Sakiyama H, Inaba N, Toyoguchi T, Okada Y, Matsumoto M, Morija Y, Ohtsu H. Immunolocalization of complement C1s and matrix metalloproteinase 9 (92kDa gelatinase/ type IV collagenase) in the primary ossification centre of human femur. Cell Tissue Res. 1994;277:239–245. [PubMed] [Google Scholar]
- Haeusler G, Walter I, Heimreich M, Egerbacher M. Localization of matrix metalloproteinases, (MMPs) their tissue inhibitors, and vascular endothelial growth factor (VEGF) in growth plates of children and adolescents indicates a role for MMPs in human postnatal growth and skeleton maturation. Calcif Tissue Int. 2005;7:326–335. doi: 10.1007/s00223-004-0161-6. [DOI] [PubMed] [Google Scholar]
- Yin M, Gentili C, Koyama E, Zasloff M, Pacifici M. Antiangiogenic treatment delays chondrocyte maturation and bone formation during limb skeletogenesis. J Bone Miner Res. 2002;17:56–65. doi: 10.1359/jbmr.2002.17.1.56. [DOI] [PubMed] [Google Scholar]
- Trippel SB. Growth factor inhibition. Potential role in the etiopathogenesis of osteoarthritis. Clin Orthop Rel Res. 2004;427:S47–S52. [PubMed] [Google Scholar]
- Cuevas P, Burgos J, Baird A. Basic fibroblast growth factor (FGF) promotes cartilage repair in vivo. Biochem Biophys Res Commun. 1998;156:611–618. doi: 10.1016/s0006-291x(88)80887-8. [DOI] [PubMed] [Google Scholar]
- Weisser J, Rahforth B, Timmermann A, Aigner T, Brauer R, von der Mark K. Role of growth factors in rabbit articular cartilage repair by chondrocytes in agarose. Osteoarthritis Cartilage. 2001;9:S48–S54. doi: 10.1053/joca.2001.0444. [DOI] [PubMed] [Google Scholar]
- Martin I, Vunjak-Novakovic G, Yang J, Langer R, Freed LE. Mammalian chondrocytes expanded in the presence of fibroblast growth factor 2 maintain the ability to differentiate and regenerate three-dimensional cartilaginous tissue. Exp Cell Res. 1999;253:681–688. doi: 10.1006/excr.1999.4708. [DOI] [PubMed] [Google Scholar]
- Yamamoto T, Wakitani S, Imoto K, Hattori T. Fibroblast growth factor-2 promotes the repair of partial thickness defects of articular cartilage in immature rabbits but not in mature rabbits. Osteoarthritis Cartilage. 2004;12:636–641. doi: 10.1016/j.joca.2004.04.007. [DOI] [PubMed] [Google Scholar]
- Shida J-I, Jingushi S, Izumi T, Ikenoue T, Iwamoto Y. Basic fibroblast growth factor regulates expression of growth factors in rat epiphyseal chondrocytes. J Orthop Res. 2001;19:259–264. doi: 10.1016/S0736-0266(00)90009-3. [DOI] [PubMed] [Google Scholar]
- Yaeger PC, Masi TL, Buck de Ortiz JL, Binette F, Tubo R, McPherson M. Synergistic action of transforming growth factor-β and insulin-like growth factor-I induces expression of type II collagen and aggrecan genes in adult human articular chondrocytes. Exp Cell Res. 1997;237:318–325. doi: 10.1006/excr.1997.3781. [DOI] [PubMed] [Google Scholar]
- Barbero A, Grogan S, Schafer D, Heberer M, Mainil-Varlet P, Martin I. Age related changes in human articular chondrocyte yield, proliferation and post-expansion chondrogenic capacity. Osteoarthritis Cartilage. 2004;12:476–484. doi: 10.1016/j.joca.2004.02.010. [DOI] [PubMed] [Google Scholar]
- Lafeber FP, van Roy HL, van der Kraan PM, van den Berg WB, Bijlsma JW. Transforming growth factor-β predominantly stimulates phenotypically changed chondrocytes in osteoarthritic human cartilage? J Rheumatol. 1997;24:536–542. [PubMed] [Google Scholar]
- Dore S, Pelletier J-P, DiBattista JA, Tardif G, Brazeau P, Martel-Pelletier J. Human osteoarthritic chondrocytes possess an increased number of insulin-like growth factor 1 binding sites but are unresponsive to its stimulation. Arthritis Rheum. 1994;37:253–263. doi: 10.1002/art.1780370215. [DOI] [PubMed] [Google Scholar]
- Guerne PA, Blanco F, Kaelin A, Desgeorges A, Lotz M. Growth factor responsiveness of human articular chondrocytes in aging and development. Arthritis Rheum. 1995;38:960–968. doi: 10.1002/art.1780380712. [DOI] [PubMed] [Google Scholar]
- Aigner T, Hemmel M, Neureiter D, Gebhard PM, Zeiler G, Kirchner T, McKenna L. Apoptotic cell death is not a widespread phenomenon in normal aging and osteoarthritic human articular knee cartilage: a study of proliferation, programmed cell death (apoptosis), and viability of chondrocytes in normal and osteoarthritic human knee cartilage. Arthritis Rheum. 2001;44:1304–1312. doi: 10.1002/1529-0131(200106)44:6<1304::AID-ART222>3.0.CO;2-T. [DOI] [PubMed] [Google Scholar]
- van Beuningen HM, van der Kraan PM, Arntz OJ, van den Berg WB. In vivo protection against interleukin-1-induced articular cartilage damage by transforming growth factor-β: age-related differences. Ann Rheum Dis. 1994;53:593–600. doi: 10.1136/ard.53.9.593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smith P, Shuler FD, Georgescu HI, Ghivizzani SC, Johnstone B, Niyibizi C, Robbins PD, Evans CH. Genetic enhancement of matrix synthesis by articular chondrocytes. Arthritis Rheum. 2000;43:156–164. doi: 10.1002/1529-0131(200005)43:5<1156::AID-ANR26>3.0.CO;2-M. [DOI] [PubMed] [Google Scholar]
- Aoyama T, Liang B, Okamoto T, Matsusaki T, Nishijo K, Ishhibe T, Yasura K, Nagayama S, Nakayama T, Nakamura T, Toguchida J. PGE2 signal through EP2 promotes the growth of articular chondrocytes. J Bone Miner Res. 2005;20:377–389. doi: 10.1359/JBMR.041122. [DOI] [PubMed] [Google Scholar]
- Kurihara Y, Endo H, Akahoshi T, Kondo H. Upregulation of prostaglandin E receptor EP2 and EP4 subtypes in rat synovial tissues with adjuvant arthritis. Clin Exp Immunol. 2001;123:323–330. doi: 10.1046/j.1365-2249.2001.01442.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li T-F, Zuscik MJ, Ionescu AM, Zhang X, Rosier RN, Schwarz EM, Drissi H, O’Keefe RJ. PGE2 inhibits chondrocyte differentiation through PKA and PKC signaling. Exp Cell Res. 2004;300:159–169. doi: 10.1016/j.yexcr.2004.06.019. [DOI] [PubMed] [Google Scholar]
- Zhang X, Ziran N, Goater JJ, Schwarz EM, Puzas JE, Rosier RN, Zuscik M, Drissi H, O’Keefe RJ. Primary murine limb bud mesenchymal cells in long-term culture complete chondrocyte differentiation: TGF-β delays hypertrophy and PGE2 inhibits terminal differentiation. Bone. 2004;34:809–817. doi: 10.1016/j.bone.2003.12.026. [DOI] [PubMed] [Google Scholar]