Establishment of a Gene Expression System in Ochrobactrum anthropi

Abstract

Genetic studies of Ochrobactrum anthropi are hindered by the lack of a suitable gene expression system. We constructed a set of vectors containing several promoters and a His tag fusion in the N terminus to facilitate protein detection and purification. The new vectors should significantly enhance the genetic manipulation and characterization of O. anthropi.

Ochrobactrum strains are of particular interest for bioremediation (6). They are capable of degrading organophosphorus pesticides such as parathion and methylparathion (17), phenol (2), the toxic organic solvent dimethylformamide (14), petroleum waste (4), and the soil contaminant chlorothalonil (5). They are also capable of removing chromium, cadmium, copper, and toxic metals from the environment (10). Unfortunately, genetic studies with Ochrobactrum isolates have been hindered by the lack of an efficient system for gene expression and purification of recombinant proteins.

Our goal in this research was to establish an enhanced gene expression system in Ochrobactrum anthropi to enhance genetic manipulation and characterization and to allow rapid and easy one-step purification of recombinant proteins directly from O. anthropi.

The oligonucleotides used in this study are listed in Table 1. Recombinant DNA methods were used according to standard techniques (11). PCRs were performed using Platinum PCR SuperMix High Fidelity (Invitrogen). Restriction and modification enzymes were purchased from Promega. A QIAprep spin miniprep kit from QIAGEN was used for all plasmid extractions, and a QIAGEN PCR cleanup kit was used for removal of all restriction enzymes and for DNA gel extraction.

TABLE 1.

Primers used to amplify the promoters

Promoter	Size (bp)	Source of DNA	Primer name	Primer sequencea
Ch	237	pBBgroE expression vectorb	Ch-F	5′-CCCGTCGACGAATAAATACCTGTGACGGAA-3′
			Ch-R	5′-CCCGGATCCACCATGATGATGATGATGATGCATTTTAGCTTCCTTAGCTCCTGAAAATCT-3′
Kan	149	pUC4K cloning vector (Pharmacia)	Kan-F	5′-GGGGTCGACGGGGAAAGCCACGTTGTGTCT-3′
			Kan-R	5′-GGGGGATCCACCATGATGATGATGATGATGCATAACACCCCTTGTTAAACTGTT TATGTA-3′
Amp	233	pRSETA expression vector (Invitrogen)	Amp-F	5′-CCCGTCGACAAGGGCCTCGTGATACGCCTA-3′
			Amp-R	5′-CCCGGATCCACCATGATGATGATGATGATGCATACTCTTCCTTTTTCAATATTATTGAAG-3′
TrcD	277	pTrc2HisA expression vector (Invitrogen)	TrcD-F	5′-CCCGTCGACAGAAAAAAGATCAAAAAAATACTTGACAATTAATCATCCGGCTCGTATAATG-3′
			TrcD-R	5′-CCCGGATCCACCATGATGATGATGATGATGCATGGTTTATTCCTCCTTATTTAAT-3′

^aBoldface, restriction enzyme sites; underlining, His tag sequences.

^bSee reference 15.

The sequence carrying the origin of replication (rep), the chloramphenicol acetyltransferase gene (cat), and the multiple cloning site (MCS) of the broad-host-range pNSGroE Brucella expression vector (GenBank accession number AY576605) (13) was used as the backbone for the construction of the new vectors. The Brucella abortus groE promoter was excised from pNSGroE with the SalI and BamHI restriction enzymes, and the promoterless pNS construct was used for promoter replacement.

The chloramphenicol resistance gene promoter (Ch) was amplified from the broad-host-range pBBGroE expression vector (15) with primers Ch-F and Ch-R. In the reverse primer, six histidine residues and one glycine residue were engineered after the translational start codon to facilitate epitope tagging at the amino terminus by fusing a minimum number of amino acids to any expressed protein (13). To avoid the translational error or inhibition arising from rare codon bias (7), the preferred codon usage of Ochrobactrum spp. (http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=Ochrobactrum+anthropi+%5Bgbbct%5D) for histidine and glycine was used. After restriction digestion and purification, the Ch promoter was cloned into the pNS construct to form the pNSCh expression vector (Fig. 1).

FIG. 1.

Plasmid map. Shown are the engineered pNSCh and pNST5 expression vectors for constitutive and regulated expression, respectively, with the His tag fusion in the N terminus. cat, chloramphenicol acetyltransferase gene conferring chloramphenicol resistance; rep, gene required for plasmid replication; 6×His, His tag fusion; LacO, lac operator for regulated expression.

The kanamycin resistance gene promoter (Kan) and the ampicillin resistance gene promoter (Amp), each containing a His tag fusion in the N terminus, were amplified and cloned in the same way as was Ch by using the pUC4K cloning vector (Pharmacia)and primers Kan-F and Kan-R for Kan and the pRSETA expression vector (Invitrogen) and primers Amp-F and Amp-R for Amp.

The coliphage T5 promoter (16) with the downstream lac repressor, a synthetic ribosomal binding site (RBSII), and the His₆ tag codon sequence was excised with XhoI and BamHI from the pQE-40 expression vector (QIAGEN) and ligated to the pNS construct to form the pNST5 expression vector (Fig. 1).

The hybrid TrcD promoter (1) with the downstream bacteriophage gene 10 translational enhancer (9) minicistron, reinitiation ribosome binding site (12), and lac repressor was amplified from the pTrc2HisA vector (Invitrogen) and ligated to the pNS construct to form the pNSTrcD expression vector.

In order to study the expression and activity of the cloned promoters inside O. anthropi, the promoterless Escherichia coli β-galactosidase gene (lacZ) was amplified from pRSETB/β-gal (Invitrogen) as described previously (13) and cloned into all expression vectors downstream of the various promoters. A colorimetric assay (15) was employed to compare the levels of β-galactosidase expression.

A promoterless green fluorescent protein (GFP) gene (gfp) was excised from the pGFPuv vector (BD Biosciences Clontech), cloned into the MCS of pNSTrcD, and used for Western blotting and protein purification.

The lacZ constructs and the pNSTrcD-gfp expression vector with gfp expressed under the control of the TrcD promoter were transformed into O. anthropi strain 49237 as described previously (8). The gfp was purified from recombinant O. anthropi using nickel-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN) and 6 M guanidine HCl. Imidazole and β-mercaptoethanol (both at 20 mM) were added to the lysis buffer, and 1% Triton X-100 and 250 mM NaCl were added to the washing buffer to reduce contaminating proteins. The cells were pretreated with TE-citrate-Zwittergent 3-14 (10 mM Tris, 1 mM EDTA, pH adjusted to 4 with citric acid, 1% Zwittergent 3-14) for 2 h at 55°C prior to purification. The concentration of the purified recombinant protein was determined by the bicinchoninic acid protein assay kit (Pierce) using the manufacturer's enhanced test tube procedure after removal of urea by Microcon YM-10 centrifugal filter devices (Millipore). The purity of the extracted protein was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

To test the fusion of the His epitope tag and the efficiency of detection, Western blot analysis was performed by separating the total-cell lysates of recombinant O. anthropi expressing gfp under the control of the TrcD promoter by 10% SDS-PAGE, followed by transfer to one of two nitrocellulose membranes (Osmonics). One membrane was incubated overnight with a mixture of a horseradish peroxidase (HRP)-conjugated anti-HisG antibody (1:3,000) (Invitrogen) and peroxidase-conjugated anti-His₆ (Roche) (1:3,000). The second membrane was incubated overnight with an anti-His₆ antibody (Roche) (1:1,000) and then for 1 h with HRP-conjugated anti-mouse secondary antibodies (1:1,000) (Kirkegaard & Perry Laboratories).

The sizes and descriptions of the vectors are given in Table 2.

TABLE 2.

Descriptions of plasmids constructed and used in this study

Plasmid	Size (bp)	Promoter	Type of expression	GenBank accession no.
pNSCh	2,903	Ch	Constitutive	DQ412050
pNSKan	2,809	Kan	Constitutive	DQ412052
pNSAmp	2,891	Amp	Constitutive	DQ412053
pNST5	2,810	Phage T5	Regulated	DQ412054
pNSTrcD	2,937	trc hybrid + UP	Regulated	DQ412056
pNSGroE	2,863	B. abortus groE	Constitutive	AY576605

Figure 1 diagrams the pNSCh expression vector, which was introduced into O. anthropi with an efficiency of 2.1 × 10⁹ transformants per μg DNA. Due to the reduction in size, the new plasmids (∼3 kb) were 1.6 × 10³ times more efficient at transformation than the broad-host-range expression vector pBBGroE (5.9 kb) (15). All plasmids were stably maintained after 8 serial passages over 16 days on tryptic soy agar plates in the absence of chloramphenicol selection.

All amplified promoters were able to express β-galactosidase inside O. anthropi with various strengths (Fig. 2). The B. abortus constitutive groE promoter was the strongest promoter. The results indicate that the vectors constructed may be used in O. anthropi as reporters of gene expression and promoter activity. The anti-His antibodies were used successfully to detect the expression of GFP fused with the His tag (Fig. 3). The N-terminal His tag fusion allowed one-step purification of 7.3 mg of recombinant GFP from 100 ml of bacterial culture (optical density at 600 nm, 2). Figure 4 shows the purity of the purified recombinant protein.

FIG. 2.

LacZ activity from different promoters in O. anthropi. The LacZ activity of each construct was determined as described in the text for expression of β-galactosidase and is represented in Miller units. Each bar represents the average of three separate cultures. Triplicate cultures were used in each experiment.

FIG. 3.

Western blot of recombinant GFP. Shown is the detection of the His-tagged GFP fusion protein expressed from the TrcD promoter in O. anthropi. (A) The membrane was incubated with an anti-His₆ antibody (1:1,000) overnight and with HRP-conjugated anti-mouse secondary antibodies (1:1,000) for 1 h. (B) The membrane was incubated with a mixture of an HRP-conjugated anti-HisG antibody (1:3,000) and peroxidase-conjugated anti-His₆ (1:3,000) overnight. M, Precision Plus Protein dual-color standards (Bio-Rad).

FIG. 4.

SDS-PAGE of purified recombinant GFP. The cells were pretreated with TE-citrate-Zwittergent 3-14 for 2 h at 55°C prior to purification of GFP from O. anthropi using Ni-NTA agarose (QIAGEN). The SDS-PAGE gel was stained with Coomassie blue. Lane 1, total-cell lysate of recombinant O. anthropi; lanes 2 to 4, purified recombinant GFP elutions 1 to 3; MW, Precision Plus Protein dual-color standards (Bio-Rad).

In this study we report the construction of a series of expression vectors for O. anthropi that can be used for heterologous gene expression and for protein detection and purification.

The lacZ and gfp genes were introduced into O. anthropi and expressed under the control of various promoters. Recombinant GFP was detected by Western blotting using anti-His antibodies and purified using Ni-NTA. The newly described vectors will enhance genetic manipulation and characterization and will facilitate the use of O. anthropi as a potential bioremediation tool and a biopesticide agent.

Nucleotide sequence accession numbers.

The sequences of all the vectors reported in this paper have been deposited in GenBank under the accession numbers listed in Table 2.