Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2006 Oct;80(19):9730–9740. doi: 10.1128/JVI.00246-06

ORF18 Is a Transfactor That Is Essential for Late Gene Transcription of a Gammaherpesvirus

Vaithilingaraja Arumugaswami 1, Ting-Ting Wu 1, DeeAnn Martinez-Guzman 2, Qingmei Jia 1, Hongyu Deng 3,7, Nichole Reyes 1, Ren Sun 1,3,4,5,6,*
PMCID: PMC1617240  PMID: 16973577

Abstract

Lytic replication of the tumor-associated human gammaherpesviruses Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus has important implications in pathogenesis and tumorigenesis. Herpesvirus lytic genes have been temporally classified as exhibiting immediate-early (IE), early, and late expression kinetics. Though the regulation of IE and early gene expression has been studied extensively, very little is known regarding the regulation of late gene expression. Late genes, which primarily encode virion structural proteins, require viral DNA replication for their expression. We have identified a murine gammaherpesvirus 68 (MHV-68) early lytic gene, ORF18, essential for viral replication. ORF18 is conserved in both beta- and gammaherpesviruses. By generating an MHV-68 ORF18-null virus, we characterized the stage of the virus lytic cascade that requires the function of ORF18. Gene expression profiling and quantitation of viral DNA synthesis of the ORF18-null virus revealed that the expression of early genes and viral DNA replication were not affected; however, the transcription of late genes was abolished. Hence, we have identified a gammaherpesvirus-encoded factor essential for the expression of late genes independently of viral DNA synthesis.

Human gammaherpesviruses Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV) contribute to the development of epithelial, hematopoietic, and endothelial cell cancers. EBV is associated with a number of malignancies, including Burkitt's lymphoma, nasopharyngeal carcinoma, gastric carcinoma, and Hodgkin's disease (40). KSHV has been shown to be the causative agent of Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma (9, 10, 51). A murine gammaherpesvirus, MHV-68, is a model to study gammaherpesvirus biology due to its conservation with EBV and KSHV in both genomic content and gene expression program. In addition, MHV-68 retains the ability to lytically infect various cell lines, including those of human origin, and provides a small-animal model for experimental gammaherpesvirus infection in vivo (36, 46, 52, 55).

Herpesviruses undergo both lytic and latent phases of infection. Following primary lytic infection in epithelial cells and lymphocytes, gammaherpesviruses establish a life-long latent infection, with intermittent bursts of lytic reactivation (33, 35). This sporadic reactivation allows the virus to maintain a dynamic infectious reserve for transmission and secondary infection. During latent infection, the virus expresses a limited number of genes which promote the survival and proliferation of infected cells, resulting in transformation of a small percentage of cells (32). In KSHV, a subset of the transformed cell population supports spontaneous reactivation, leading to the expression of virally encoded cellular cytokine and chemokine homologues, including viral macrophage inflammatory proteins I, II, and III and viral interleukin-6 (11, 34, 37). These viral cytokines have a paracrine growth-promoting effect on neighboring infected cells; thus, lytic infection contributes to pathogenesis and tumorigenesis.

Based on a temporal gene expression pattern, herpesvirus lytic genes are classified as immediate early (IE or α), early (E or β), and late (L or γ) (20, 41). Following infection, the expression of IE genes is regulated by incoming virion-associated proteins and/or cellular transcription factors. The IE transcription factors ZEBRA (ZTA) and RTA in EBV (6, 12, 17) and RTA in KSHV and MHV-68 (27, 53, 58) initiate the lytic cascade by activating the expression of downstream early genes (e.g., MTA or ORF57) and modulating the cellular microenvironment. Transcription of early genes occurs in nuclear compartment ND10 or promyelocytic leukemia nuclear bodies (21, 29). Many early genes encode enzymes and factors required for viral genome replication. EBV-ZEBRA, KSHV-K8, RTA, and six other core DNA replication proteins, carried in KSHV by open reading frames (ORFs) 6, 9, 40, 41, 44, 56, and 59, are involved in viral genome replication. These proteins localize to a subnuclear domain, termed the replication compartment, where viral DNA synthesis, late gene transcription, and viral genome encapsidation take place (4, 18, 25, 47, 57). Following viral DNA replication, late genes coding for structural proteins are expressed (19, 30). A subset of late genes, early-late, or γ1 genes is expressed preceding viral DNA replication, and their transcription rate is enhanced considerably during DNA synthesis. On the other hand, for expression of true-late or γ2 genes, viral DNA replication is absolutely required in cis. These studies resulted in the notion that these two processes are coupled (41, 45).

The regulation of alphaherpesvirus lytic genes has been studied in detail. The herpes simplex virus (HSV) IE gene products ICP0, ICP4, ICP22, ICP27, and ICP47 have been shown to regulate downstream early and late lytic genes (44, 60, 15). Although the regulation of gammaherpesvirus IE and early gene expression has been studied extensively in tumor cell lines (8, 22, 49, 56), studies on the regulation of late gene expression have been limited by the lack of a robust lytic system. EBV late lytic gene promoter sequences essential for the regulation of late gene expression have been mapped using a plasmid containing a late promoter-reporter and origin of lytic replication (3, 43). Nevertheless, the viral factor(s) specifically controlling the transcriptional regulation of gammaherpesvirus late genes is unknown.

Using a library of signature-tagged MHV-68 mutant viruses, we identified 41 viral genes essential for completion of the virus life cycle (50). Though most of these essential genes are well characterized, the function of a conserved essential lytic gene, ORF18, is unknown. ORF18 is conserved among both beta- and gammaherpesviruses (14, 55). MHV-68 ORF18 has 39% and 28% amino acid identity to the KSHV and human cytomegalovirus (HCMV) proteins, respectively. The betaherpesvirus ORF18 homologue, UL79, was identified as an essential gene for virus replication in genome-wide screens (14, 59). Our previous studies showed that during MHV-68 lytic infection, ORF18 is expressed as an early gene (28). In silico analysis of ORF18 revealed no cellular functional homology or conserved domains. ORF18 is neither a gammaherpesvirus virion protein (5, 7) nor a core viral DNA replication protein (4, 57).

To define the function of ORF18 during viral replication, we engineered an ORF18-null virus. The gene expression pattern of the ORF18-null virus was analyzed using viral DNA array, Northern blotting, Western blotting, and promoter-reporter assays, and the viral DNA synthesis was quantitated by real-time PCR. The results demonstrated an essential role for ORF18 in viral late gene transcription.

MATERIALS AND METHODS

Cells.

The Flp-in T-Rex-293 cell line (Invitrogen) is a human embryonic kidney epithelial cell line that stably expresses the tetracycline (Tet) repressor and contains a single stably integrated Flp recognition target (FRT) site. This cell line was cultured in complete Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum as well as blasticidin (5 μg/ml). NIH-3T12 and BHK-21 cells were maintained in complete DMEM with 10% fetal bovine serum, supplemented with penicillin and streptomycin. All the cell lines were grown at 37°C with 5% CO2.

Plasmids.

The suicide shuttle vector pGS284 was a kind gift from G. Smith and L. Enquist (Princeton University) (48). To introduce triple stop codons in MHV-68 ORF18 between nucleotides (nt) 30,066 and 30,067, a MHV-68 fragment corresponding to nt 29671 to 30503 was amplified in a two-step PCR. First, the homologous upstream and downstream sequences to the site of the stop codon insertion were amplified with primer pairs Pr1-Pr2 and Pr3-Pr4 (Table 1), respectively. Primers Pr2 and Pr3 were designed to contain triple stop codons and an AvrII restriction site with overlapping sequences. Finally, the homologous up- and downstream fragments containing the triple stop codons were amplified by crossover PCR with primers Pr1 and Pr4. This PCR fragment was cloned into NheI and XhoI sites of the shuttle vector (pGS284/18STOP). To construct the pGS284/wt ORF18 region, the PCR-amplified ORF18 region (primers Pr1 and Pr4) was inserted into NheI and XhoI sites of the shuttle vector.

TABLE 1.

Primers used in this studya

Primer Sequence (5′-3′)
Pr1 tctcctcgagGTAAGTGTGATGTGAGAGGC
Pr2 AGGTCCTCAATTAATTAACCGGCAATTCTGTCGAGGATAGCG
Pr3 GCCGGTTAATTAATTGAGGACCTAGGTTGTTACATGCTATCCTC
Pr4 tctcgctagcGAGGAAGAACTTTCCCACGT
Pr5 ccgaattcaATGTCCACATATCCTCCCACGT
Pr6 cgggatccGTTTATTTTTGTGTGTTG
Pr7 caccATGTCCACATATCCTCCCACG
Pr8 TTATTTTTGTGTGTTGGGGGCAC
Pr9 ctctgctagcGGCATCAACCTCTGTGTTTATTG
Pr10 cggcctcgagGATAATTAATAAACTTCAGGTTCC
Pr11 ctctgctagcCAGGATGGTTCTTCATGAATG
Pr12 cgctctcgagCACCCTTATTGGAACACTTTTGAC
Pr13 CAGCTGTCAGGGTGAGATTGGTGCGGCGACGATAGTCATG
Pr14 CCTGGCCATGGTTACATACTC
Pr15 GGAACATAATCCATAAGCAGGGT
Pr16 ccgaattcaATGTTGGGGCGATATGTGATAG
Pr17 ccgaattcaTGTCACCTGTATAATTTTACCACCAA
Pr18 ccgaattcaAAGGACCTCACTGACGAGAC
Pr19 ccgaattcaAACCTGGGAAGCACCATCCCTT
Pr20 cgggatccttatcaAATAAAGCTGTTGTTAAAAGT
Pr21 cgggatccttatcaATTTTTCAGACAAAAGAGCA
Pr22 ACGCTGTGTGGGTTCTGTGAAGCGCTCGACCTAGTGAATCT
Pr23 AGATTCACTAGGTCGAGCGCTTCACAGAACCCACACAGCGT
Pr24 AGAGATGGTAACCTGCTGTTCAATTGGGGAGCGCAAGGCCTG
Pr25 CAGGCCTTGCGCTCCCCAATTGAACAGCAGGTTACCATCTCT
Pr26 GCCAAGCTTACCATGGCCAAGCGCCGGTGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACC
Pr27 GGATGTCGTAGTCCAGTGCCCCGGAGGATGAGATCTTCTTAAAGCGGTTGGCTGCTGAGACGGCT
Pr28 GGCACTGGACTACGACATCCCTACTACCGCATCCGACTACAAAGACCATGACGGTGATTATAAAG
Pr29 CGAGGATCCCTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACCGTCATGG
Open in a new tab
a

Linker sequences are in lowercase; restriction sites are underlined.

To construct MHV-68 ORF18 expression plasmid pFLAG-ORF18, ORF18 was PCR amplified with primers Pr5 and Pr6 (Table 1) and was inserted into the EcoRI-BamHI sites of pFLAG-CMV2 (Kodak). For ORF18 domain mapping, a series of FLAG-tagged ORF18 deletion plasmids was generated. The ORF18 N- or C-terminal deletion fragments (the primer pairs used for PCR are indicated in parentheses) ΔN-13 (Pr16-Pr6), ΔN-57 (Pr17-Pr6), ΔN-108 (Pr18-Pr6), ΔN-163 (Pr19-Pr6), ΔC-16 (Pr5-Pr20), ΔC-101(Pr5-Pr21), and ΔN13-C16 (Pr16-Pr20) (Table 1) were PCR amplified and cloned into EcoRI-BamHI sites of pFLAG-CMV2. To delete the ORF18 basic (amino acids [aa] 138 to 149) and hydrophobic (aa 165 to 181) region, a two-step PCR was employed by using an oligonucleotide directed-mutagenesis method. Initially, to remove the basic region of aa 138 to 149 or the hydrophobic region of aa 164 to 182, the up- and downstream sequences of ORF18 were PCR amplified with primer pairs Pr5-Pr23 and Pr22-Pr6 or Pr5-Pr25 and Pr24-Pr6, respectively (Table 1). Subsequently, by crossover PCR using primers Pr5 and Pr6, the final mutated products were obtained and cloned into the EcoRI-BamHI sites of pFLAG-CMV2.

Firefly luciferase reporter genes driven by promoters of MHV-68 ORF26 or ORF65 were constructed by inserting a 1-kbp sequence upstream of the ATG of the corresponding genes into NheI-XhoI sites of pGL3-Basic plasmid (Promega). To amplify promoters of ORF26 and ORF65, the primer pairs Pr9-Pr10 and Pr11-Pr12 were used for PCR, respectively. Subsequently the ORF26 promoter or ORF65 promoter coupled to the luciferase coding region was PCR amplified by using Pr9 or Pr11 and Pr13 and cloned into the NaeI site of pMOΔ16, a plasmid containing the MHV-68 minimum origin of lytic replication (oriLyt) (13).

Construction of ORF18-null and ORF18 revertant MHV-68 (bacterial artificial chromosome [BAC]) plasmids.

The wild-type (wt) MHV-68 (BAC) plasmid was used for construction of ORF18 stop codon insertion (18S) BAC by allelic exchange using the recA+ Escherichia coli strain GS500, harboring the target MHV-68 (BAC) plasmid, and conjugation-competent E. coli GS111, containing the donor suicide shuttle vector pGS284/18STOP as described previously (23). To generate ORF18 revertant (18R) BAC, the 18S BAC plasmid containing strain GS500 and the pGS284/wt ORF18 region harboring E. coli GS111 were used.

Generation of wild-type, ORF18-null, and ORF18 revertant MHV-68 (BAC) viruses.

To generate virus stock, initially a Tet-inducible stable ORF18 cell line, 293FT-18, was established by transfecting Flp-in T-Rex-293 cells (Invitrogen) with CBP epitope and a 3× FLAG-tagged ORF18 mammalian Tet-inducible expression vector, pTAG18. To construct pTAG18 vector, primers Pr26, Pr27, Pr28, and Pr29 were used (Table 1). The cells were then selected with hygromycin (150 μg/ml) and blasticidin (5 μg/ml) (H. Deng and N. Reyes, unpublished data). The 293FT-18 cells were seeded into a 24-well plate at 4 × 104 cells/well in the presence of 0.2 μg/ml of tetracycline. At 24 h postplating, the Wt MHV-68 (BAC) plasmid, p18S (BAC) plasmid, or p18R (BAC) plasmid (0.5 μg/well) was transfected into the 293FT-18 cells using Lipofectamine Plus reagent (Invitrogen). At 5 days posttransfection, all three viruses produced cytopathic effect (CPE). The cells and supernatants were harvested, and intracellular viral particles were released by three cycles of freeze and thaw. Stocks for individual viruses were made after two rounds of amplification in 293FT-18 cells. The virus titer was assessed based on 50% tissue culture infectivity doses (TCID50) by infecting the 293FT-18 cells with 10-fold serially diluted viruses.

Quantitative PCR.

One-hundred nanograms of DNA template and MHV-68 M1-specific primers Pr14 and Pr15 were mixed with 10× PCR buffer, Taq, and SYBR Green. MHV-68 BAC DNA (100 to 107 copies) was included as a standard for copy number determination. The reaction was run at 95°C for 15 min, followed by 45 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 10 s. The results were analyzed in an Opticon Monitor (MJ Research, Cambridge, MA).

Northern blotting and viral DNA membrane array hybridization.

Total cellular RNA was harvested using Tri-reagent (Molecular Research Center, Inc., Cincinnati, OH). Northern blotting was done as described before (13). The following probes were used: ORF57 (corresponding to MHV-68 nt 76650 to 77139), M3 (nt 6060 to 7277), and ORF65 (nt 93962 to 94512). The viral DNA membrane array experiment was performed as described previously (28).

Replication kinetics analysis.

The noncomplementing BHK-21 cells were seeded onto 24-well plates. The cells were inoculated with MHV-68 wt, 18R, or 18S virus at a multiplicity of infection (MOI) of 1 for the single-step growth curve and an MOI of 0.01 for the multiple-step growth curve. After 1 h of incubation, the virus inocula were removed and the cells were washed twice with DMEM. Subsequently, fresh DMEM was added, and this time point was considered 0 h postinfection (hpi). The cells and the supernatant were harvested at 0, 4, 8, 12, and 24 hpi for single-step curves and at 0, 1, 2, 3, and 4 days postinfection for multistep growth curves. The samples were subjected to three cycles of freeze and thaw and were stored at −80°C. The virus titer was measured by limiting dilution assay in Tet-induced 293FT-18 cells.

Promoter-reporter assay.

A total of 600 ng of reporter constructs pGL2-57pLUC (26) (kind gift from Samuel H. Speck), pGL3/M3promoter-LUC (28), pORI/ORF65 promoter-LUC, and pORI/ORF26 promoter-LUC was transfected with 20 ng of pRLSV40 construct into BHK-21 cells using Lipofectamine Plus reagent (Invitrogen). pRLSV40 contains the Renilla luciferase gene driven by the constitutively active simian virus 40 (SV40 promoter) and was used as an internal control. At 24 h posttransfection, the cells were reseeded into 48-well plates at 2 × 104 cells per well. The next day, the cells were infected with MHV-68 wt or 18S virus at an MOI of 5. Uninfected cells transfected with reporter constructs were included as a negative control. For phosphonoacetic acid (PAA; Sigma) treatment, 200 μg/ml of PAA was added to the wells during infection. At 24 hpi, the cells were lysed and both firefly and Renilla luciferase activities were assayed using the Dual Luciferase reporter assay system (Promega). The firefly luciferase activities were normalized against Renilla luciferase values. Fold induction was calculated by comparing the normalized firefly luciferase activities of infected cells to that of uninfected cells.

Western blotting and antibodies.

For Western blotting, the cell lysates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Antigens were probed with primary rabbit polyclonal antibodies to ORF65 (1:500), MHV68 lytic antigens (1:2,000) (both generated in our laboratory), or mouse monoclonal antibody to FLAG (1:3,000; Sigma). Goat anti-rabbit or goat anti-mouse immunoglobulin G conjugated with horseradish peroxide (Amersham Pharmacia Biotech) secondary antibodies was detected by chemiluminescence (ECL Plus; Amersham Pharmacia Biotech), and the signals were detected and analyzed using a storm imaging system (Molecular Dynamics).

RESULTS

Construction of ORF18-null and ORF18-revertant recombinant MHV-68 (BAC) plasmids.

By Mu-transposon signature-tagged mutagenesis of MHV-68 bacterial artificial chromosome (BAC), we identified ORF18 as essential for viral replication (50). However, insertion of a 1.3-kbp transposon in a viral gene could affect the expression of neighboring genes. Hence, for further characterization, we generated an ORF18-null mutant virus (18S) by introducing translational stop codons into ORF18 of wild-type (wt) MHV-68 BAC (Fig. 1) using an allelic exchange method described previously (23, 48). The triple nonsense codons were inserted 150 nt downstream of the ORF18 translation initiation codon (between nt 30,066 and 30,067 of the viral genome), which prevents the expression of functional ORF18. To confirm the correct genomic arrangement, the wt and mutant BAC DNAs were digested with EcoRI or AvrII, resolved, and visualized (Fig. 1C). The EcoRI digestion patterns of wt and 18S DNA were similar (Fig. 1C, lanes 3, 6, and 7). The AvrII digestion yielded a 7.2-kbp fragment for the wt and, due to insertion of the stop codons, AvrII site, and 18S DNA yielded two fragments with sizes of 4.0 kbp and 3.2 kbp (Fig. 1B and C, lanes 12 and 13). A revertant (18R) of ORF18-null virus was generated. 18R had a restriction pattern similar to that of the wt (Fig. 1C, lanes 3, 4, and 5). The structure of the viral genome was further confirmed by Southern blotting (Fig. 1D) as described previously (23) using a probe spanning the ORF17 to ORF19 region (nt 29671 to 32094) (Fig. 1B). ORF18 is located downstream of the 40-bp internal repeat, and the varying number of this repeat accounts for the size difference observed among different clones in the 5.1-kbp EcoRI and 7.2-kbp/4.0-kbp AvrII fragments. This varying number of repeats does not affect the viral replication efficiency in vitro (1 and T.-T. Wu, unpublished data).

FIG. 1.

FIG. 1.

Open in a new tab

Analysis of recombinant viruses. (A) The location of ORF18 in the MHV-68 BAC (wt) genome is indicated. ORF18 and the flanking ORFs are shown with EcoRI (e) and AvrII (a) restriction sites. The 40-bp internal repeat sequence present in the M6 gene is shown as a striped box. (B) The position of stop codons and the AvrII insertion site in ORF18-null virus (18S) is depicted. The solid bar indicates the location of the probe used for Southern blotting. The EcoRI or AvrII restriction pattern of ORF18 locus is indicated. For AvrII, the fragments (sizes are in kilobase pairs) generated by 18S (below the line) and wt (above the line) viruses are shown. (C) Restriction profile of recombinant viruses. Five micrograms of viral BAC plasmids (two clones for each of 18R and 18S viruses) was digested with EcoRI or AvrII and separated on a 0.7% gel, and the DNA was visualized with UV after ethidium bromide staining. (D) Southern blotting of the EcoRI- or AvrII-digested viral BAC DNA. M, 1-kbp DNA ladder; TR, terminal repeat.

ORF18-null virus is replication incompetent.

The ORF18-null virus was tested for its ability to replicate in BHK-21 cells, a cell line which is permissive for wt MHV-68 infection. The cells were transfected with 18S (BAC) plasmid and observed daily, for 7 days, for the appearance of virus-induced cytopathic effect (CPE) and production of infectious virus particles. At 5 days posttransfection, complete CPE was observed in wt and 18R-transfected cells but not in 18S virus cells. Passage of the supernatant collected from 18S-transfected cells into BHK-21 cells did not produce any infectious viral particles. Consistent with these results, MHV-68 lytic antigen was expressed in the wt and 18R-transfected cells but not in the 18S cells (Fig. 2). The wild-type phenotype observed in ORF18-revertant virus indicates that the 18S virus has no additional mutations elsewhere in the genome and the observed phenotype is ORF18 specific. The ORF18 mutant virus can be rescued by exogenously expressed ORF18 (Fig. 2). Collectively, the results show that ORF18 is indispensable for completion of the virus life cycle, which is consistent with a previous report (50). The HCMV-carried ORF18 homologue (UL79) knockout mutant is also replication defective in human fibroblasts (14, 59), underscoring a conserved function of ORF18 in the beta- and gammaherpesvirus life cycles.

FIG. 2.

FIG. 2.

Open in a new tab

Rescue of ORF18-null virus by ORF18 trans-complementation. ORF18-null BAC plasmid (18S) was cotransfected into BHK-21 cells with (+) or without (−) complementing FLAG-tagged ORF18 expression vector. Wild-type MHV-68 (wt) and ORF18 revertant (18R) BAC plasmids were also transfected as positive controls. (Upper panel) At 5 days posttransfection, viral lytic antigen expression was analyzed by Western blotting using rabbit polyclonal anti-MHV-68 antisera. (Middle panel) Immunoblot probed with mouse monoclonal anti-FLAG antibody. The lower panel depicts a cellular cross-reacting antigen as a control. M, marker; UI, uninfected.

Analysis of ORF18 domains essential for viral replication.

ORF18 amino acid sequence alignment of beta- and gammaherpesviruses revealed that MHV-68 ORF18 has nonconserved N- and C-terminal regions and a well-conserved internal region (Fig. 3). In order to map the domains of ORF18 which are essential for viral replication, a series of ORF18 deletion mutants were generated (Fig. 4A). The mutant ORF18 expression plasmids were tested for their ability to trans-complement 18S (BAC) plasmid in BHK-21 cells as described above. The ORF18 deletion mutants lacking the nonconserved N-terminal 13 aa and/or C-terminal 16 aa complemented the 18S virus, resulting in formation of CPE and expression of ORF65 (M9) capsid antigen (Fig. 4B). Analysis of the ORF18 locus showed that these nonconserved regions overlap with ORF17 and ORF19 coding regions (Fig. 1A). Removal of the conserved, basic (aa 138 to 149), or hydrophobic (aa 164 to 182) region resulted in failure to trans-complement the 18S virus. Further, deletion of N- or C-terminal regions resulted in loss of trans-complementing function (Fig. 4B). In addition, the expression level of these mutant proteins was undetectable, thus, we concluded that deleting large portions of this predicted globular protein renders the truncated proteins unstable for expression. We obtained reproducible results from three independent experiments. The mapping data suggest that ORF18 function is conserved during virus replication.

FIG. 3.

FIG. 3.

Open in a new tab

Alignment of the predicted amino acid sequences of ORF18 homologues in murine gammaherpesvirus 68 (MHV-68), Kaposi's sarcoma-associated herpesvirus (KSHV), bovine herpesvirus 4 (BHV4), and human cytomegalovirus (HCMV). The consensus sequence of the alignment is shown. Identical amino acid residues conserved among four viruses are depicted in boldface.

FIG. 4.

FIG. 4.

Open in a new tab

Mapping ORF18 regions essential for trans-complementation. (A) Schematic representation of FLAG-tagged (▪) ORF18 deletion mutants. The deleted ORF18 region is depicted as a dotted line. The N-terminal (gray boxes) and C-terminal (horizontally striped boxes) nonconserved regions as well as basic (black boxes with white dots) and hydrophobic (diagonally striped boxes) regions are shown. (B) The pFLAG-CMV2-based ORF18 deletion mutant plasmids were tested for their ability to trans-complement ORF18-null virus (18S) in BHK-21 cells. At 5 days posttransfection, the cells were subjected to Western blotting to detect the expression of viral capsid antigen ORF65 using rabbit polyclonal antibody. The ORF18 mutant proteins were detected using monoclonal anti-FLAG antibody. A nonspecific band indicated by the star serves as a loading control.

Growth kinetics of ORF18-null virus.

We determined the effect of the absence of ORF18 on virus replication by performing single- and multiple-step growth curves of 18S virus in a noncomplementing (BHK-21) cell line. We generated a stock of 18S virion particles carrying the ORF18 mutant genome through complementation in a stable cell line, 293FT-18, that inducibly expresses ORF18. For the single-step growth curve, cells were infected with the wt, 18R, or 18S virus at an MOI of 1, and the infected cells with supernatant were harvested at various time points postinfection. The virus titer was measured based on the TCID50 of Tet-induced 293FT-18 cells. From 8 hpi onwards, wt and 18R viruses entered into the logarithmic phase of replication, and at 24 hpi the virus titer reached 103 TCID50/0.1 ml (Fig. 5A). wt and 18R viruses did not show any significant differences in growth characteristics, which further confirms that the 18S virus has no additional deleterious mutations in the genome other than the stop codon insertion. However, 18S virus did not produce any viral progeny at any time points, although it had titers similar to those of wt and 18R viruses at the 0-h time point (Fig. 5A).

FIG. 5.

FIG. 5.

Open in a new tab

Growth kinetics of ORF18-null virus. For both single-step (A) and multiple-step (B) growth curves, noncomplementing BHK-21 cells were infected with wt, 18R, or 18S virus at MOIs of 1 and 0.01, respectively. Infected cells were harvested at the indicated time points postinfection and the viral titer, in 50% tissue culture infectivity doses (TCID50), was determined in a Tet-inducible ORF18 cell line by limiting dilution.

To study the multiple-step virus replication curve, a similar experiment was performed with wt, 18R, and 18S viruses at an MOI of 0.01 (Fig. 5B). Both wt and 18R viruses reached a titer of ca. 106 TCID50/0.1 ml at 4 days postinfection, whereas the 18S virus titer remained below the detection level during all time points (Fig. 5B). These results showed that ORF18 is essential for both single and multiple rounds of virus replication.

ORF18-null virus is defective in late antigen expression.

To understand at which step of the viral lytic cycle ORF18 functions, we examined viral lytic antigens expressed by 18S virus in the complementing 293FT-18 and noncomplementing BHK-21 cell lines with or without viral DNA polymerase inhibitor (PAA) treatment. At 24 hpi, an accumulation of a viral capsid antigen, ORF65, was detected (Fig. 6). For ORF65, a true-late gene, expression depends on viral genome replication, hence treatment with PAA resulted in inhibition of ORF65 expression. In untreated cells, ORF65 expression by wt and 18R viruses was not affected in either cell line; however, 18S virus expressed ORF65 in the complementing cell line 293FT-18 (Fig. 6, lane 7) but not in the noncomplementing BHK-21 cells (Fig. 6, lane 14). The observed result was further confirmed by probing with rabbit-polyclonal antibody raised against MHV-68 lytic antigens. These data indicate that ORF18 is essential for the expression of the lytic late antigens that we have assayed.

FIG. 6.

FIG. 6.

Open in a new tab

Viral lytic protein expression. (Upper panel) ORF18-complementing 293FT-18 and noncomplementing BHK-21 cell lines were infected with wt, 18R, or 18S virus at an MOI of 1 with (+) or without (−) PAA treatment. At 24 hpi, the infected cell lysate was harvested and the expression of viral capsid antigen ORF65 was determined by Western blotting. (Middle panel) MHV-68 lytic antigen was detected by reprobing the blot with rabbit polyclonal antisera. The lower panel depicts a cellular cross-reacting antigen as a control. M, marker; UI, uninfected.

Analysis of ORF18-null transcript profile.

The failure of 18S virus to express the selected late viral protein could be due to a block at the level of translation or transcription of these genes. Hence, we investigated the effect of ORF18 deficiency on the transcription program of MHV-68. Total RNA harvested from wt or 18S virus-infected noncomplementing BHK-21 cells at 24 hpi was subjected to Northern analysis. We investigated the mRNA level of genes representing early (ORF57), early-late (M3), and late (ORF65) kinetic classes (2, 16, 28). Cellular housekeeping gene GAPDH mRNA served as an internal control (Fig. 7D). Analysis revealed that the transcript of ORF57 in 18S virus infection was not affected (Fig. 7A). The mRNA for the early-late gene M3 was transcribed during 18S infection; however, it did so at a reduced level (Fig. 7B). The late gene ORF65 transcript was completely absent in 18S (Fig. 7C), which is corroborated by ORF65 protein expression data (Fig. 6). Hence, the data suggested that in 18S virus the late gene expression could be affected at the level of transcription initiation, mRNA processing, or turnover rate.

FIG. 7.

FIG. 7.

Open in a new tab

Analysis of gene expression pattern. The BHK-21 cells were infected with wt or 18S virus. The total RNA harvested at 24 hpi was subjected to Northern blot analysis. The blot was probed with ORF57 (A), M3 (B), ORF65 (C), or cellular GAPDH (D). Note that the ORF65 mRNA is completely absent in 18S virus. Arrow heads (◂) indicate major lytic transcripts identified by each probe. The sizes of the DNA ladder are indicated on the left. M, marker.

Since we observed a selective absence of late gene ORF65 transcript, we investigated the relative abundance of 18S viral transcripts across the entire genome using our custom DNA array (28). The DNA array, comprising virtually all the predicted MHV-68 genes, was hybridized with cDNAs generated from total RNA harvested from wt or 18S virus infection of noncomplementing BHK-21 cells. Array values were normalized against cellular GAPDH, and the data were processed as described previously (28). The fold reduction of 18S viral transcription was obtained by comparing the GAPDH-normalized PhosphorImager units for each array element from the 18S array to that of the wt (Fig. 8). Although the replication-incompetent 18S virus had a relatively lower level of transcripts compared to that of wt virus, the genes encoding structural proteins, including glycoproteins, tegument proteins, capsid proteins, and other virion-associated proteins and a few proteins of unknown function, were downregulated drastically in comparison to other viral genes (Table 2). It has been reported that the expression of these genes is inhibited by PAA treatment; thus, they belong to the true-late kinetic class of genes (28). The expression of ORF40, encoding a helicase-primase protein involved in DNA replication, also showed severe reduction (Fig. 8). This gene has been reported as a late gene (2), suggesting it functions during a phase of virus DNA replication subsequent to initiation of viral DNA synthesis. The expression of the immediate-early gene ORF50 (encoding RTA) and the early gene ORF57 was least affected. The transcripts of M3 and latency-associated nuclear antigen homologue, encoded by ORF73, were downregulated moderately. Analysis of Northern blotting and array data of 18S virus pointed out that accumulation of late gene mRNAs was severely abrogated by the absence of ORF18.

FIG. 8.

FIG. 8.

Open in a new tab

Analysis of transcript profile. BHK-21 cells were infected with wt or 18S virus (MOI, 5). Total RNA harvested at 12 and 24 hpi was reverse transcribed, and the resulting cDNAs were hybridized to a DNA array spotted with MHV-68 genes. Array values were normalized against cellular GAPDH expression. The transcript profiles of wt and 18S viruses were compared, and the fold reduction of 18S virus gene expression was plotted for each gene on the array for 12 h and 24 h.

TABLE 2.

Genes downregulated more than 15-fold in ORF18-null virus at 24 hpi

Functional category Open reading frame(s)
Glycoprotein ORF27, ORF39, M7 (gp150), and ORF53
Tegument ORF19, ORF45, ORF52, ORF67, ORF75b, and ORF75c
Capsid ORF25, ORF26, ORF62, and ORF65 (M9)
Other virion proteins ORF20, ORF29a, and ORF33
Nucleotide metabolism ORF46
Unknown ORF23 and ORF66
Open in a new tab

ORF18 is essential for late promoter activity.

The observed absence of late gene expression in 18S virus could possibly be attributed to the failure of transcription initiation or reduced stability of late gene mRNA. To examine these possibilities, we performed a promoter-reporter assay in the context of ORF18-null virus infection of BHK-21 cells. We studied the activity of promoters representing three kinetic classes. Promoter regions (600 to 1,000 bp upstream of the translation initiation codon) of genes ORF57 (early or β), M3 (early-late or γ1), ORF26 (true-late or γ2), and ORF65 (true-late or γ2) were cloned upstream of the firefly luciferase coding gene. It was reported that the late promoters of herpesviruses require a functional viral origin of lytic replication (oriLyt) in cis besides viral transfactors for activity (3, 24). Hence, the late promoters were cloned into a vector containing the MHV-68 minimum oriLyt (13). The promoter-reporter constructs were transfected into BHK-21 cells, and 24 h posttransfection the cells were infected with wt virus or 18S virus. PAA treatment was included as a control for assessing the expression kinetic of promoter activity. At 24 hpi, the firefly luciferase activity was measured and the values were normalized against a Renilla luciferase internal transfection control (Fig. 9). Consistent with the array and Northern blotting data, the activities of ORF57 and M3 promoters were induced by 18S virus (Fig. 9A and B); however, the late promoters of ORF26 and ORF65 (Fig. 9C and D) were not activated. All four promoters were active in the context of wt virus infection. Consistent with their expression kinetic classes, PAA treatment enhanced the activity of ORF57 promoter, had no effect on M3 promoter, and completely inhibited the activity of the ORF26 and ORF65 promoters. The promoter-reporter assay indicated that the strength of activation of M3 promoter in ORF18-null and wt virus-infected cells is comparable, whereas the Northern and array analyses (Fig. 7B and 8), examining the accumulation of mRNA which includes processing and transcript stability, showed a relative reduction of M3 transcripts in ORF18-null virus compared to that in wt virus. The wt virus, which is capable of reinfection, can accumulate M3 transcript during subsequent rounds of replication, whereas ORF18-null virus cannot. Despite having similar levels of M3 promoter activity, the combined effect of differences in the replication kinetics and mRNA turnover rate between wt and ORF18-null viruses could account for the variation in M3 transcript level. Taken together, the data strongly support the conclusion that ORF18 is essential to initiate transcription of late genes.

FIG. 9.

FIG. 9.

Open in a new tab

Viral promoter-reporter assay. The viral promoters of (A) ORF57 (early), (B) M3 (early-late), (C) ORF26 (true-late), or (D) ORF65 (true-late) driving a firefly luciferase reporter construct were individually transfected into BHK-21 cells, and at 24 h posttransfection the cells were infected with wt or 18S virus in the presence or absence of PAA. At 24 hpi, cells were lysed and luciferase activity was measured. Values were normalized against a Renilla luciferase internal control. The normalized firefly luciferase activities of viral infected cells were compared to that of uninfected cells for calculating the fold induction.

ORF18 is dispensable for viral genome replication.

For expression of γ2 late genes, viral DNA replication in cis is a strict requirement (30, 45). A defect in the production of late lytic antigens by the 18S virus could be accounted for by the possibility that ORF18 may function as an essential cofactor for viral genome replication, and its absence could block viral DNA replication and thus late gene expression. We therefore examined viral DNA replication of 18S virus. Both complementing and noncomplementing cells were infected with wt, 18R, or 18S virus, and PAA treatment of cells was included as a control. The infected cellular DNA was harvested at 12 and 24 hpi, and the viral genome copy number was determined by real-time PCR (Fig. 10). Interestingly, we found that the level of viral DNA replication in 18S virus infection was comparable to that of wt virus infection. Treatment with PAA resulted in a 2- to 3-log reduction in viral DNA copy number in comparison to that of untreated cells (Fig. 10). Taken together, the absence of ORF18 did not have a major deleterious effect on viral genome replication. These data suggest that though viral DNA replication is essential for late gene expression, these two processes are separable in that ORF18 functions as a late-gene expression-regulatory factor downstream of viral DNA replication (Fig. 11).

FIG. 10.

FIG. 10.

Open in a new tab

Quantitation of viral genome replication. The ORF18-complementing 293FT-18 (A and B) and noncomplementing BHK-21 cell lines (C and D) were infected with wt, 18R, or 18S virus at an MOI of 1 with or without the viral DNA polymerase inhibitor PAA. Total infected cell DNA was harvested at 12 (A and C) and 24 hpi (B and D), and the viral genome copy number per 100 ng of DNA was determined by quantitative PCR.

FIG. 11.

FIG. 11.

Open in a new tab

Schematic model diagram showing the stage at which ORF18 functions during gammaherpesvirus replication. The circularized virus genome in the nucleus (nuc) is shown. The expression cascade of immediate-early (IE), early (E), and late (L) transcripts are indicated with squiggly lines. ORF18 regulates the expression of late genes downstream of viral DNA synthesis. PAA is an inhibitor of virus DNA replication. cyt, cytoplasm.

DISCUSSION

The herpesvirus gene expression program is temporally regulated by virus-encoded factors. The regulation of herpesvirus immediate-early and early phases of gene expression has been studied extensively. In contrast, investigation into regulation of late gene expression has been limited. The production of late lytic antigens is critical for completion of the virus life cycle. Here, we report the essential role of gammaherpesvirus ORF18 in expression of viral lytic genes by studying an ORF18-null MHV-68 virus. We characterized the ORF18-null virus phenotype by detailed analysis of viral gene expression and viral genome replication and investigated the effect of ORF18 deficiency on expression of virus lytic antigens. During ORF18-null virus infection in noncomplementing cells, expression of PAA-sensitive MHV-68 lytic antigens, such as the capsid antigen ORF65, was completely abrogated, confirming that ORF18 is required for late gene expression.

Subsequent analysis of mutant virus transcripts showed that the expression of an early gene, ORF57, was not affected, but the late gene ORF65 transcript was absent. This observation was further confirmed by a promoter-reporter assay, where the late promoters ORF26 and ORF65 were inactive in cells infected with ORF18-null virus but not with wild-type MHV-68 virus. This indicates that the defect in ORF18-null virus is at the level of late gene transcription. To address the issue of whether the observed block in late gene transcription is universal to all other transcripts in the late kinetic class, we analyzed the transcript profile of ORF18-null virus using a viral DNA array. Though the mutant virus had a relatively lower rate of mRNA production, transcripts of genes coding for true-late antigens, including envelope, tegument, capsid, and packaging proteins, were drastically reduced. The DNA array analysis also showed that besides late genes, the relative expression of some genes of other kinetic classes was reduced to a certain extent in ORF18-null virus. This can be explained by the following two contributing factors. (i) The ORF18-null virus infection is less cytotoxic, thus, the infected cells will have larger amounts of total RNA and more cells surviving at the time of harvest. This will reduce the radiolabeling of viral transcripts, resulting in less hybridization signal on the viral array. (ii) The other factor is differences observed in the replication kinetics between wt and ORF18-null viruses (Fig. 5). The wt virus is capable of reinfection resulting in accumulation of more transcripts, whereas ORF18-null virus is replication deficient, thus, no further transcript amplification occurs. At 12 hpi, the relative difference in the gene expression profile of wt and ORF18-null viruses is less pronounced, and at 24 hpi the expression of late gene transcripts was reduced severalfold compared to transcripts of other kinetic classes in ORF18-null virus (Fig. 8). Our results revealed that ORF18 is required for transcription initiation of late genes.

For production of late gene transcripts, viral DNA replication in cis is a stringent requirement. To pinpoint the exact stage of the defect in progression of the ORF18-null virus lytic phase, we analyzed DNA synthesis of the mutant virus by quantitating the viral genome copy number. DNA replication of the ORF18-null virus was comparable to that of the wt: treatment with PAA, an inhibitor of viral DNA polymerase, reduced the level of viral DNA synthesis in the ORF18-null virus, indicating that the mutant virus indeed replicated viral DNA. This surprising result sheds light on a previously unknown regulatory step downstream of virus DNA replication that controls the expression of late genes.

Studies on the HSV-1 immediate-early regulatory factor ICP27 (a homologue of gammaherpesvirus ORF57) have reported that temperature-sensitive and null mutants of ICP27 expressed elevated levels of some early genes, reduced levels of other early genes, namely, those involved in viral DNA replication, and exhibited a drastic decrease in the accumulation of late gene products (31, 39, 42). In contrast to the ORF18-null virus, which replicated the viral genome to wild-type levels, the ICP27 mutant viruses are defective in viral genome replication (54). It is possible that the defect in DNA synthesis by the ICP27-null virus contributes to the complete absence of late gene transcription, a finding consistent with our observation that PAA inhibited the activity of late promoters. An HSV-1 ICP22 null mutant virus had been shown to have a defect in the synthesis of an IE transactivator, ICP0, and a subset of late proteins, US11, UL38, and UL41. However, this mutant produced a normal amount of several other late proteins, specifically gC, UL48, and UL34 (38). Hence, the observed effect of ICP22 on late gene expression could be a consequence of a defect in expression of other early regulatory genes downstream of ICP0. Though several HSV-1 mutants have been shown to exhibit defects in late viral gene expression, these phenotypes appear distinct from that of MHV-68 ORF18.

Cellular and viral partners interacting with ORF18 are unknown. If any, the roles of ORF18 interacting proteins in the assembly of transcription machinery onto late promoters following viral DNA synthesis require further investigation. While the mechanism by which ORF18 regulates late gene expression is as yet undefined, these results potentially open up new avenues for investigation into the regulation of late gene expression.

In summary, we characterized the role of a conserved gene, ORF18, in the gammaherpesvirus life cycle. We have described an essential function of ORF18 in the expression of late genes and the protein's dispensability for early gene expression as well as virus DNA replication. This is the first description of a gammaherpesvirus factor controlling the expression of late genes independent of virus DNA replication. Further study is required to elucidate the molecular mechanism governing gammaherpesvirus late gene regulation, potentially presenting new targets for therapeutic intervention in EBV- and KSHV-associated diseases.

Acknowledgments

We thank Eric Bortz and Elaine Wong for their valuable suggestions and meticulous reading of the manuscript. We appreciate other R. Sun laboratory members for their constructive comments and useful discussion.

This work was supported by National Institutes of Health grants CA091791 and DE015752 and funding from the STOP CANCER Foundation.

REFERENCES

  • 1.Adler, H., M. Messerle, M. Wagner, and U. H. Koszinowski. 2000. Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. J. Virol. 74:6964-6974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ahn, J. W., K. L. Powell, P. Kellam, and D. G. Alber. 2002. Gammaherpesvirus lytic gene expression as characterized by DNA array. J. Virol. 76:6244-6256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Amon, W., U. K. Binne, H. Bryant, P. J. Jenkins, C. E. Karstegl, and P. J. Farrell. 2004. Lytic cycle gene regulation of Epstein-Barr virus. J. Virol. 78:13460-13469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.AuCoin, D. P., K. S. Colletti, S. A. Cei, I. Papouskova, M. Tarrant, and G. S. Pari. 2004. Amplification of the Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 lytic origin of DNA replication is dependent upon a cis-acting AT-rich region and an ORF50 response element and the trans-acting factors ORF50 (K-Rta) and K8 (K-bZIP). Virology 318:542-555. [DOI] [PubMed] [Google Scholar]
  • 5.Bechtel, J. T., R. C. Winant, and D. Ganem. 2005. Host and viral proteins in the virion of Kaposi's sarcoma-associated herpesvirus. J. Virol. 79:4952-4964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bhende, P. M., W. T. Seaman, H. J. Delecluse, and S. C. Kenney. 2004. The EBV lytic switch protein, Z, preferentially binds to and activates the methylated viral genome. Nat. Genet. 36:1099-1104. [DOI] [PubMed] [Google Scholar]
  • 7.Bortz, E., J. P. Whitelegge, Q. Jia, Z. H. Zhou, J. P. Stewart, T. T. Wu, and R. Sun. 2003. Identification of proteins associated with murine gammaherpesvirus 68 virions. J. Virol. 77:13425-13432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bryant, H., and P. J. Farrell. 2002. Signal transduction and transcription factor modification during reactivation of Epstein-Barr virus from latency. J. Virol. 76:10290-10298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N. Engl. J. Med. 332:1186-1191. [DOI] [PubMed] [Google Scholar]
  • 10.Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869. [DOI] [PubMed] [Google Scholar]
  • 11.Chatterjee, M., J. Osborne, G. Bestetti, Y. Chang, and P. S. Moore. 2002. Viral IL-6-induced cell proliferation and immune evasion of interferon activity. Science 298:1432-1435. [DOI] [PubMed] [Google Scholar]
  • 12.Countryman, J., and G. Miller. 1985. Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc. Natl. Acad. Sci. USA 82:4085-4089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Deng, H., J. T. Chu, N. H. Park, and R. Sun. 2004. Identification of cis sequences required for lytic DNA replication and packaging of murine gammaherpesvirus 68. J. Virol. 78:9123-9131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dunn, W., C. Chou, H. Li, R. Hai, D. Patterson, V. Stolc, H. Zhu, and F. Liu. 2003. Functional profiling of a human cytomegalovirus genome. Proc. Natl. Acad. Sci. USA 100:14223-14228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Durand, L. O., S. J. Advani, A. P. Poon, and B. Roizman. 2005. The carboxyl-terminal domain of RNA polymerase II is phosphorylated by a complex containing cdk9 and infected-cell protein 22 of herpes simplex virus 1. J. Virol. 79:6757-6762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ebrahimi, B., B. M. Dutia, K. L. Roberts, J. J. Garcia-Ramirez, P. Dickinson, J. P. Stewart, P. Ghazal, D. J. Roy, and A. A. Nash. 2003. Transcriptome profile of murine gammaherpesvirus-68 lytic infection. J. Gen. Virol. 84:99-109. [DOI] [PubMed] [Google Scholar]
  • 17.Feederle, R., M. Kost, M. Baumann, A. Janz, E. Drouet, W. Hammerschmidt, and H. J. Delecluse. 2000. The Epstein-Barr virus lytic program is controlled by the co-operative functions of two transactivators. EMBO J. 19:3080-3089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fixman, E. D., G. S. Hayward, and S. D. Hayward. 1992. trans-acting requirements for replication of Epstein-Barr virus ori-Lyt. J. Virol. 66:5030-5039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Holland, L. E., K. P. Anderson, C. Shipman, Jr., and E. K. Wagner. 1980. Viral DNA synthesis is required for the efficient expression of specific herpes simplex virus type 1 mRNA species. Virology 101:10-24. [DOI] [PubMed] [Google Scholar]
  • 20.Honess, R. W., and B. Roizman. 1974. Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins. J. Virol. 14:8-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ishov, A. M., and G. G. Maul. 1996. The periphery of nuclear domain 10 (ND10) as site of DNA virus deposition. J. Cell Biol. 134:815-826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Izumiya, Y., S. F. Lin, T. Ellison, L. Y. Chen, C. Izumiya, P. Luciw, and H. J. Kung. 2003. Kaposi's sarcoma-associated herpesvirus K-bZIP is a coregulator of K-Rta: physical association and promoter-dependent transcriptional repression. J. Virol. 77:1441-1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jia, Q., T. T. Wu, H. I. Liao, V. Chernishof, and R. Sun. 2004. Murine gammaherpesvirus 68 open reading frame 31 is required for viral replication. J. Virol. 78:6610-6620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Johnson, P. A., and R. D. Everett. 1986. The control of herpes simplex virus type-1 late gene transcription: a ‘TATA-box’/cap site region is sufficient for fully efficient regulated activity. Nucleic Acids Res. 14:8247-8264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lin, C. L., H. Li, Y. Wang, F. X. Zhu, S. Kudchodkar, and Y. Yuan. 2003. Kaposi's sarcoma-associated herpesvirus lytic origin (ori-Lyt)-dependent DNA replication: identification of the ori-Lyt and association of K8 bZip protein with the origin. J. Virol. 77:5578-5588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu, S., I. V. Pavlova, H. W. t. Virgin, and S. H. Speck. 2000. Characterization of gammaherpesvirus 68 gene 50 transcription. J. Virol. 74:2029-2037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252:304-312. [DOI] [PubMed] [Google Scholar]
  • 28.Martinez-Guzman, D., T. Rickabaugh, T. T. Wu, H. Brown, S. Cole, M. J. Song, L. Tong, and R. Sun. 2003. Transcription program of murine gammaherpesvirus 68. J. Virol. 77:10488-10503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Maul, G. G., A. M. Ishov, and R. D. Everett. 1996. Nuclear domain 10 as preexisting potential replication start sites of herpes simplex virus type-1. Virology 217:67-75. [DOI] [PubMed] [Google Scholar]
  • 30.Mavromara-Nazos, P., and B. Roizman. 1987. Activation of herpes simplex virus 1 gamma 2 genes by viral DNA replication. Virology 161:593-598. [DOI] [PubMed] [Google Scholar]
  • 31.McCarthy, A. M., L. McMahan, and P. A. Schaffer. 1989. Herpes simplex virus type 1 ICP27 deletion mutants exhibit altered patterns of transcription and are DNA deficient. J. Virol. 63:18-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.McCormick, C., and D. Ganem. 2005. The kaposin B protein of KSHV activates the p38/MK2 pathway and stabilizes cytokine mRNAs. Science 307:739-741. [DOI] [PubMed] [Google Scholar]
  • 33.Miller, G. 1990. The switch between latency and replication of Epstein-Barr virus. J. Infect. Dis. 161:833-844. [DOI] [PubMed] [Google Scholar]
  • 34.Molden, J., Y. Chang, Y. You, P. S. Moore, and M. A. Goldsmith. 1997. A Kaposi's sarcoma-associated herpesvirus-encoded cytokine homolog (vIL-6) activates signaling through the shared gp130 receptor subunit. J. Biol. Chem. 272:19625-19631. [DOI] [PubMed] [Google Scholar]
  • 35.Moser, J. M., J. W. Upton, R. D. Allen, 3rd, C. B. Wilson, and S. H. Speck. 2005. Role of B-cell proliferation in the establishment of gammaherpesvirus latency. J. Virol. 79:9480-9491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Nash, A. A., and N. P. Sunil-Chandra. 1994. Interactions of the murine gammaherpesvirus with the immune system. Curr. Opin. Immunol. 6:560-563. [DOI] [PubMed] [Google Scholar]
  • 37.Nicholas, J., V. R. Ruvolo, W. H. Burns, G. Sandford, X. Wan, D. Ciufo, S. B. Hendrickson, H. G. Guo, G. S. Hayward, and M. S. Reitz. 1997. Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6. Nat. Med. 3:287-292. [DOI] [PubMed] [Google Scholar]
  • 38.Purves, F. C., W. O. Ogle, and B. Roizman. 1993. Processing of the herpes simplex virus regulatory protein alpha 22 mediated by the UL13 protein kinase determines the accumulation of a subset of alpha and gamma mRNAs and proteins in infected cells. Proc. Natl. Acad. Sci. USA 90:6701-6705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Rice, S. A., and D. M. Knipe. 1990. Genetic evidence for two distinct transactivation functions of the herpes simplex virus alpha protein ICP27. J. Virol. 64:1704-1715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Rickinson, A. B., and K. Keiff. 2001. Epstein-Barr virus, p. 2575-2627. In D. M. Knipe, P. M. Howley, D. E. Griffin, M. A. Martin, R. A. Lamb, and B. Roizman (ed.), Fields virology, 4th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, Pa. [Google Scholar]
  • 41.Roizman, B., and D. M. Knipe. 2001. Herpes simplex viruses and their replication, p. 2399-2459. In D. M. Knipe, P. M. Howley, D. E. Griffin, M. A. Martin, R. A. Lamb, and B. Roizman (ed.), Fields virology, 4th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, Pa. [Google Scholar]
  • 42.Sacks, W. R., C. C. Greene, D. P. Aschman, and P. A. Schaffer. 1985. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J. Virol. 55:796-805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Serio, T. R., N. Cahill, M. E. Prout, and G. Miller. 1998. A functionally distinct TATA box required for late progression through the Epstein-Barr virus life cycle. J. Virol. 72:8338-8343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Shapira, M., F. L. Homa, J. C. Glorioso, and M. Levine. 1987. Regulation of the herpes simplex virus type 1 late (gamma 2) glycoprotein C gene: sequences between base pairs −34 to +29 control transient expression and responsiveness to transactivation by the products of the immediate early (alpha) 4 and 0 genes. Nucleic Acids Res. 15:3097-3111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Silver, S., and B. Roizman. 1985. Gamma 2-thymidine kinase chimeras are identically transcribed but regulated a gamma 2 genes in herpes simplex virus genomes and as beta genes in cell genomes. Mol. Cell. Biol. 5:518-528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Simas, J. P., and S. Efstathiou. 1998. Murine gammaherpesvirus 68: a model for the study of gammaherpesvirus pathogenesis. Trends Microbiol. 6:276-282. [DOI] [PubMed] [Google Scholar]
  • 47.Simpson-Holley, M., J. Baines, R. Roller, and D. M. Knipe. 2004. Herpes simplex virus 1 U(L)31 and U(L)34 gene products promote the late maturation of viral replication compartments to the nuclear periphery. J. Virol. 78:5591-5600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Smith, G. A., and L. W. Enquist. 1999. Construction and transposon mutagenesis in Escherichia coli of a full-length infectious clone of pseudorabies virus, an alphaherpesvirus. J. Virol. 73:6405-6414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Song, M. J., H. Deng, and R. Sun. 2003. Comparative study of regulation of RTA-responsive genes in Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8. J. Virol. 77:9451-9462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Song, M. J., S. Hwang, W. H. Wong, T. T. Wu, S. Lee, H. I. Liao, and R. Sun. 2005. Identification of viral genes essential for replication of murine γ-herpesvirus 68 using signature-tagged mutagenesis. Proc. Natl. Acad. Sci. USA 102:3805-3810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Soulier, J., L. Grollet, E. Oksenhendler, P. Cacoub, D. Cazals-Hatem, P. Babinet, M. F. d'Agay, J. P. Clauvel, M. Raphael, L. Degos, and F. Sigaux. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86:1276-1280. [PubMed] [Google Scholar]
  • 52.Stevenson, P. G., and P. C. Doherty. 1998. Kinetic analysis of the specific host response to a murine gammaherpesvirus. J. Virol. 72:943-949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sun, R., S. F. Lin, L. Gradoville, Y. Yuan, F. Zhu, and G. Miller. 1998. A viral gene that activates lytic cycle expression of Kaposi's sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. USA 95:10866-10871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Uprichard, S. L., and D. M. Knipe. 1996. Herpes simplex ICP27 mutant viruses exhibit reduced expression of specific DNA replication genes. J. Virol. 70:1969-1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Virgin, H. W. t., P. Latreille, P. Wamsley, K. Hallsworth, K. E. Weck, A. J. Dal Canto, and S. H. Speck. 1997. Complete sequence and genomic analysis of murine gammaherpesvirus 68. J. Virol. 71:5894-5904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wang, S. E., F. Y. Wu, Y. Yu, and G. S. Hayward. 2003. CCAAT/enhancer-binding protein-alpha is induced during the early stages of Kaposi's sarcoma-associated herpesvirus (KSHV) lytic cycle reactivation and together with the KSHV replication and transcription activator (RTA) cooperatively stimulates the viral RTA, MTA, and PAN promoters. J. Virol. 77:9590-9612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wu, F. Y., J. H. Ahn, D. J. Alcendor, W. J. Jang, J. Xiao, S. D. Hayward, and G. S. Hayward. 2001. Origin-independent assembly of Kaposi's sarcoma-associated herpesvirus DNA replication compartments in transient cotransfection assays and association with the ORF-K8 protein and cellular PML. J. Virol. 75:1487-1506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Wu, T. T., E. J. Usherwood, J. P. Stewart, A. A. Nash, and R. Sun. 2000. Rta of murine gammaherpesvirus 68 reactivates the complete lytic cycle from latency. J. Virol. 74:3659-3667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Yu, D., M. C. Silva, and T. Shenk. 2003. Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proc. Natl. Acad. Sci. USA 100:12396-12401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Zhou, C., and D. M. Knipe. 2002. Association of herpes simplex virus type 1 ICP8 and ICP27 proteins with cellular RNA polymerase II holoenzyme. J. Virol. 76:5893-5904. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES