The most commonly reported extended-spectrum β-lactamases (ESBLs) in U.S. isolates of Escherichia coli are TEM and SHV derived (2). CTX-M ESBLs have been reported elsewhere, mostly for clinical isolates of Salmonella enterica serovar Typhimurium, E. coli, and Klebsiella pneumoniae, but not in the United States (5). In this report we describe nine U.S. isolates of E. coli from five different states (Virginia, Idaho, Ohio, Washington, and Texas) that appear to produce CTX-M-like ESBLs. These isolates were discovered as we began to investigate the types of ESBLs produced by organisms in a U.S. hospital surveillance study.
All isolates were obtained from patient specimens during 2001-2002. The origins of the isolates, pIs of the β-lactamases, and NCCLS broth microdilution MICs (4) are shown in Table 1. Pulsed-field gel electrophoresis (PFGE) results after restriction with XbaI (7; R. V. Goering and F. C. Tenover, Letter, J. Clin. Microbiol. 35:2432-2433, 1997) determined that all but isolates 1 and 4 were unique (data not shown). Isolates 8 and 9 were obtained from the same patient but had distinctly different antibiotic susceptibility and PFGE patterns. Cefepime MICs were generally higher than usual for TEM- and SHV-derived ESBL-producing isolates, with cefepime MICs being ≥64 μg/ml for seven of these isolates. Clavulanate-based ESBL tests confirmed ESBL production, although ceftazidime MICs for two isolates were <1 μg/ml below the NCCLS ESBL screening criterion (4).
TABLE 1.
MICs of antibiotics for the E. coli isolates that produced CTX-M-like ESBLs
| Agent | MIC (μg/ml) for isolate (source/pI[s] inhibited by clavulanate)
|
||||||||
|---|---|---|---|---|---|---|---|---|---|
| Isolate 1 (Falls Church, Va.; urine/9.4 and 7.4) | Isolate 4 (Falls Church, Va.; urine/9.4 and 7.4) | Isolate 2 (Falls Church, Va.; urine/9.4, 7.4, and 5.4) | Isolate 3 (Falls Church, Va.; urethra/9.4, 7.4, and 5.4) | Isolate 5 (Boise, Idaho; urine/9.0, 7.9, and 5.4) | Isolate 6 (Cleveland, Ohio; sputum/ 9.4 and 7.4) | Isolate 7 (Seattle, Wash.; blood/9.4) | Isolate 8 (El Paso, Tex.; urine/ 8.0 and 5.4) | Isolate 9 (El Paso, Tex.; sputum/ 8.0 and 5.4) | |
| Ceftriaxone | >32 | >32 | >32 | >32 | >32 | >32 | >32 | >32 | >32 |
| Cefotaxime | >64 | >64 | >64 | >64 | >64 | >64 | >64 | 16 | 32 |
| Cefotaxime-clavulanatea | 0.25 | 0.25 | 0.12 | 0.12 | ≤0.06 | 0.12 | ≤0.06 | ≤0.06 | ≤0.06 |
| Ceftazidime | 64 | 128 | 128 | 32 | 2 | 16 | 16 | 0.5 | 0.5 |
| Ceftazidime-clavulanatea | 0.5 | 0.5 | 0.5 | 0.25 | 0.12 | 0.12 | 0.12 | 0.06 | 0.06 |
| Cefepime | >128 | >128 | >128 | >128 | 64 | >128 | 64 | 2 | 4 |
| Cefepime-clavulanateb | 0.06 | 0.06 | 0.12 | ≤0.03 | ≤0.03 | ≤0.03 | ≤0.03 | ≤0.03 | ≤0.03 |
| Aztreonam | >128 | >128 | >128 | 128 | 16 | 64 | 32 | ≤1 | 4 |
| Cefoxitin | >16 | 16 | >16 | 16 | 8 | 8 | 8 | ≤4 | 16 |
| Imipenem | 0.25 | 0.25 | 0.25 | 0.12 | 0.12 | 0.12 | 0.12 | 0.25 | 0.12 |
| Piperacillin-tazobactamc | 16 | 8 | 32 | ≤4 | ≤4 | 8 | ≤4 | ≤4 | ≤4 |
| Ciprofloxacin | >4 | >4 | >4 | >4 | ≤0.25 | >4 | >4 | >4 | >4 |
| Amikacin | 8 | ≤4 | 32 | ≤4 | ≤4 | 32 | ≤4 | ≤4 | ≤4 |
Clavulanate at a fixed concentration of 4 μg/ml.
Clavulanate at a fixed concentration of 10 μg/ml.
Tazobactam at a fixed concentration of 4 μg/ml.
Isoelectric focusing of crude sonicates of the isolates by a cefotaxime-β-lactamase inhibitor overlay procedure (1, 6) revealed that all isolates produced a cefotaxime-hydrolyzing β-lactamase that was inhibited by clavulanate but not cloxacillin. The pIs of these enzymes were ≥9.0 for seven isolates and 8.0 for two (Table 1). All isolates except isolate 7 produced other clavulanate-inhibited β-lactamases. PCR amplification confirmed the presence of CTX-M-like genes within the isolates: isolates 1 to 7 resulted in amplified products of 414 bp with forward primer MEN-1F, CGGAAAAGCACGTCGATGGG, and reverse primer MEN-1R, GCGATATCGTTGGTGGTGCC; these primers correspond to nucleotide numbers 397 to 416 and 811 to 792, respectively, of the sequence with accession number X92506; isolates 8 and 9 yielded products of 1,346 bp with the forward primer CTX-M14 F1, GAGTGTTGCTCTGTGGATAAC, and the reverse primer CTX-M14 R2, GGCAAGGTCAGAATAGCGCTG; these primers correspond to nucleotide numbers 1514 to 1534 and 2860 to 2840, respectively, of the sequence with accession number AF252622. PCR amplification was performed as previously described (3) using an annealing temperature of 55°C for the MEN-1 primer pair and 50°C for the CTX-M14 primer pair. Both amplification reactions were performed using 2.0 mM MgCl2. The isoelectric focusing results combined with the PCR data suggest the presence of at least two different types of CTX-M-like enzymes.
To our knowledge this is the first report of CTX-M-like ESBLs in the United States. Since the isolates were from five different states, all but two were unrelated, and at least two different types of CTX-M-type enzymes were detected, it is clear that the CTX-M ESBL family is possibly spreading throughout the United States. This suggests that these enzymes may have been previously overlooked. With these isolates, although the susceptibility patterns may not have been due solely to the CTX-M β-lactamases, the elevated cefepime MICs (≥64 μg/ml) for seven isolates were distinctive, and the very low ceftazidime MICs (<1 μg/ml) for two isolates reaffirmed the need to utilize multiple ESBL screening agents and not to rely solely on ceftazidime to screen for ESBLs.
Acknowledgments
We thank Thomas R. Fritsche at the University of Washington, Seattle, and Jinxin Hu, Ravi Pallipamu, and Romesh Gautom at the Department of Health in Washington State for the PFGE testing. We also thank D. Wilson, The Cleveland Clinic Foundation, Cleveland, Ohio; C. Park, Inova Fairfax Hospital, Falls Church, Va.; J. Burch, St. Alphonsus Regional Medical Center, Boise, Idaho; C. Fierro, Thomason Hospital, El Paso, Tex.; and S. Swanzy, University of Washington, Seattle, for providing these isolates.
We thank Merck & Co., Inc., for supporting this research.
REFERENCES
- 1.Bauernfeind, A., H. Grimm, and S. Schweighart. 1990. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection 18:294-298. [DOI] [PubMed] [Google Scholar]
- 2.Bradford, P. A. 2001. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14:933-951. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hanson, N. D., K. S. Thomson, E. S. Moland, C. C. Sanders, G. Berthold, and R. G. Penn. 1999. Molecular characterization of a multiply resistant Klebsiella pneumoniae encoding ESBLs and a plasmid-mediated AmpC. J. Antimicrob. Chemother. 44:377-380. [DOI] [PubMed] [Google Scholar]
- 4.National Committee for Clinical Laboratory Standards. 2002. Performance standards for antimicrobial susceptibility testing; 12th informational supplement (aerobic dilution) M100-S12. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 5.Saladin, M., V. T. B. Cao, T. Lambert, J.-L. Donay, J.-L. Hermann, Z. Ould-Hocine, C. Verdet, F. Delisle, A. Philippon, and G. Arlet. 2002. Diversity of CTX-M β-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol. Lett. 209:161-168. [DOI] [PubMed] [Google Scholar]
- 6.Sanders, C. C., W. E. Sanders, Jr., and E. S. Moland. 1986. Characterization of β-lactamases in situ on polyacrylamide gels. Antimicrob. Agents Chemother. 30:951-952. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239. [DOI] [PMC free article] [PubMed] [Google Scholar]