Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2001 Aug;133(8):1249–1254. doi: 10.1038/sj.bjp.0704195

Mutational analysis of the human vasoactive intestinal peptide receptor subtype VPAC2: role of basic residues in the second transmembrane helix

P Vertongen 1,3, R M Solano 2,3, J Perret 1, I Langer 1, P Robberecht 1, M Waelbroeck 1,*
PMCID: PMC1621147  PMID: 11498510

Abstract

  1. We investigated the role of two conserved basic residues in the second transmembrane helix arginine 172 (R172) and lysine 179 (K179) of the VPAC2 receptor.

  2. Vasoactive intestinal polypeptide (VIP) activated VPAC2 receptors with an EC50 value of 7 nM, as compared to 150, 190 and 4000 nM at R172L, R172Q and K179Q-VPAC2 receptors, respectively. It was inactive at K179I mutated VPAC2 receptors. These results suggested that both basic residues were probably implicated in receptor recognition and activation.

  3. The VPAC2-selective VIP analogue, [hexanoyl-His1]-VIP (C6-VIP), had a higher affinity and efficacy as compared to VIP at the mutated receptors.

  4. VIP, Asn3-VIP and Gln3-VIP activated adenylate cyclase through R172Q receptors with EC50 values of 190, 2 and 2 nM, respectively, and through R172L receptors with EC50 values of 150, 12 and 8 nM, respectively. Asn3-VIP and Gln3-VIP behaved as partial agonists at the wild type receptor, with Emax values (in per cent of VIP) of 75 and 52%, respectively. In contrast, they were more efficient than VIP (Emax values of 150 and 150% at the R172Q VPAC2 receptors, and of 400 and 360% at the R172L receptors, respectively). These results suggested that the receptor's R172 and the ligand's aspartate 3 are brought in close proximity in the active ligand-receptor complex.

  5. The K179I and K179Q mutated receptors had a lower affinity than the wild-type receptors for all the agonists tested in this work: we were unable to identify the VIP amino acid(s) that interact with K179.

Keywords: VIP, VPAC2 receptors, PACAP, receptor point mutations

Introduction

The neuropeptides Vasoactive Intestinal Polypeptide (VIP) and Pituitary Adenylate Cyclase Activating Polypeptide (PACAP) contribute to the regulation of intestinal secretion and motility, of the vascular tone, of the exocrine and endocrine secretions, of immunological responses and to the development of the central nervous system (Christophe, 1993; Rawlings & Hezareh, 1996; Vaudry et al., 2000). Vasoactive Intestinal Peptide (VIP) acts through interaction with two receptors – VPAC1 and VPAC2 – encoded by different genes, that share 49% similarities (Harmar et al., 1998). These receptors belong to a subfamily of seven transmembrane G protein coupled receptors, characterized by a large amino-terminal domain containing highly conserved cysteine residues and by conserved transmembrane helices. This subfamily includes the receptors for VIP, PACAP (Pituitary Adenylate Cyclase Activating Peptide), secretin, glucagon, glucagon like peptides 1 and 2, GIP (Gastric Inhibitory Peptide), GRF (Growth Hormone Releasing Factor), CRF (Corticotrophin Releasing Factor), parathyroid hormone and calcitonin (Horn et al., 1998).

VPAC1 and VPAC2 receptors recognize with a comparable high affinity VIP and the related peptide PACAP. They can however be discriminated by low affinity natural ligands like secretin and GRF, and by high affinity synthetic ligands derived from VIP (Harmar et al., 1998; Nicole et al., 2000). Furthermore, mutation of extracellular amino acid residues that are conserved in both receptors subtypes but different in other members of the subfamily indicated that there are dissimilarities in the structure-function relationship of VPAC1 and VPAC2 receptors (Nicole et al., 1998).

We identified in the secretin (di paolo et al., 1999; Vilardaga et al., 1996) and VPAC1 receptors (Solano et al., 2001) two basic residues within the second transmembrane helix that serve as anchorage points for the Asp3 residue of secretin and VIP, respectively.

In the present work we extended these observations to the VPAC2 receptor. The replacement of these two basic residues by either hydrophobic or polar uncharged residues markedly reduced the affinity of VIP for the receptor and its capacity to stimulate adenylate cyclase activity. Acylation of the amino-terminus or replacement of the VIP Asp3 by an Asn or a Gln residue partially or completely restored VIP activity at the mutated VPAC2 receptors.

Methods

Construction of the mutated receptors

The cell line expressing the VPAC2 wild-type (wt) receptor has already been described (Svoboda et al., 1994). Four VPAC2 receptor mutants were obtained: R172L, R172Q, K179I, K179Q.

Generation of the mutated receptors was achieved using the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla CA, U.S.A.) essentially according to the manufacturer's instructions. Briefly, the human VPAC2 receptor-coding region, inserted into the mammalian expression vector pcDNA3.1 (Invitrogen Corp. CA, U.S.A.), was submitted to 22 cycles of polymerase chain reaction (PCR) (95°C for 30 s; 54°C for 1 min and 68°C for 14 min) in a 50 μl reaction volume. The forward and reverse primers were complementary and contained the desired nucleotide changes, flanked on either side by 15 perfectly matched nucleotides (only the forward primers are shown): V2H-R172L CTGTCCTTCATCCTGTTAGCCATCTCAGTGCTG; V2H-R172Q CTGTCCTTCATCCTGCAAGCCATCTCAGTGCTG; V2H-K179I CATCTCAGTGCTGGTCATTGACGACGTTCTCTAC; V2H-K179Q CATCTCAGTGCTGGTCCAGGACGACGTTCTCTAC.

Following PCR, 10 μl were analysed by agarose gel electrophoresis and the remaining 40 μl were digested for at least 2 h at 37°C by 1 μl DpnI restriction enzyme (Stratagene, La Jolla CA, U.S.A.) to remove the parental methylated DNA. The digested PCR products were transformed into TOP10 One Shot competent E. Coli bacterial cells (Invitrogen Corp. CA, U.S.A.). Miniprep plasmid DNA was prepared from several colonies and verified by agarose gel electrophoresis (Sambrook et al., 1989), and three were retained, further purified on Qiaquick PCR purification spin columns (Qiagen, Hilden, Germany) and the mutations verified by DNA sequencing on an ABI automated sequencing apparatus (using BigDye Terminator Sequencing Prism Kit also from ABI (Perkin-Elmer, CA, U.S.A.)). Plasmid DNA from one clone for each mutation, was prepared using a midiprep endotoxin-free kit (Stratagene, La Jolla CA, U.S.A.). The complete nucleotide sequence of the receptor coding region was verified by DNA sequencing. Twenty μg plasmid DNA were electroporated (Electroporator II, Invitrogen Corp. CA, U.S.A.) into wild-type Chinese Hamster Ovary (CHO-K1) cells. Selection was carried out in culture medium HamF12 50%, DMEM 50%, Foetal Calf Serum 10%, Penicillin (10 mU ml−1) 1%, Streptomycin (10 μg ml−1) 1%, L-Glutamine (200 mM), Life Technologies Ltd., Paisley, U.K.], supplemented with 600 μg ml−1 Geneticin (G418) medium. After 10 to 15 days of selection, isolated colonies were transferred to 24 well microtiter plates and grown until confluence, trypsinized and further expanded in 6-well microtiter plates. The cell clones expressing the different constructions were selected by testing the ability of 10 μM VIP or 10 μM C6-VIP to stimulate the membrane adenylate cyclase activity.

Membrane preparation

Membranes were prepared from scraped cells lysed in 1 mM NaHCO3 solution and immediate freezing in liquid nitrogen. After thawing, the lysate was first centrifuged at 4°C for 10 min at 400×g and the supernatant further centrifuged at 20,000×g for 10 min. The pellet, resuspended in 1 mM NaHCO3 was used immediately as a crude membrane fraction.

Binding studies

Binding studies were performed as described using either [125I]-VIP, [125I]-C6-VIP, Acetyl-His1 [E8, K12, Nle17, A19, D25, L26, K27, K28, G29, G30, T31] cyclo 21-25 VIP (2–24) ([125I]-Ro 25-1553) and [125I]-Gln3-VIP as tracer. The tracers were radiolabelled similarly and had comparable specific radioactivity (Gourlet et al., 1997). In all cases, the non-specific binding as defined as residual binding in the presence of 1 μM VIP. Binding was performed at 25°C in a total volume of 120 μl containing 20 mM Tris-maleate, 2 mM MgCl2, 0.1 mg ml−1 bacitracin and 1% bovine serum albumin (pH 7.4) buffer. Ten to 20 μg of protein were used per assay in the experiments shown; the membrane concentration was increased up to 50 μg protein per assay in an attempt to observe tracer binding to R172L, K179I and K179Q VPAC2 receptors. Bound and free radioactivity were separated by filtration through glass-fibre GF/C filters pre-soaked for 24 h in 0.01% polyethyleneimine and rinsed three times with a 20 mM (pH 7.4) sodium phosphate buffer containing 1% bovine serum albumin.

Adenylate cyclase activity

Adenylate cyclase activity was determined by the procedure of Salomon et al. (1974) as described previously. Membrane proteins (3–15 μg) were incubated in a total volume of 60 μl containing 0.5 mM [α32P]-ATP, 10 μM GTP, 5 mM MgCl2, 0.5 mM EGTA, 1 mM cyclic AMP, 1 mM theophylline, 10 mM phospho(enol)pyruvate, 30 μg ml−1 pyruvate kinase and 30 mM Tris-HCl at a final pH of 7.8.

Peptide synthesis

The peptides used were synthesized in our laboratory as described (Gourlet et al., 1998; O'donnell et al., 1994). The 1-hydroxybenzotriazole derivative of hexanoic acid was coupled to the amino-terminus of VIP before cleavage and deprotection. The purity of peptides was assessed by capillary electrophoresis, and their conformity to the expected sequence, by electrospray mass spectrometry.

Statistics

All competition curves and dose-effect curves were analysed by non-linear regression (Graph Pad Prism). The differences between the IC50, EC50 and efficacy values were tested for statistical significance by Student's t-test; P<0.05 was accepted as being significant.

Results

Interaction of VIP and analogues with the human wild-type recombinant VPAC2 receptor expressed in CHO cells

Three tracers could be used to characterize binding to VPAC2 receptors, [125I]-VIP, [125I]-Ro 25-1553 and [125I]-C6-VIP. The unlabelled ligands IC50 values did not depend on the tracer used. The cell line used expressed at least 210±40 fmol of VPAC2 receptors·(mg protein)−1. As previously shown (Juarranz et al., 1999) VIP, Ro 25-1553 and C6-VIP recognized VPAC2 receptors with a high affinity, and stimulated maximally the adenylate cyclase activity (Figure 1, Table 1). Three VIP analogues in which the Asp3 residue was replaced by a Glu, an Asn or a Gln residue (Glu3-VIP, Asn3-VIP, Gln3-VIP) had significantly higher IC50 values in competition curves, and higher EC50 values for adenylate cyclase activation (Figure 1, Table 1). Asn3-VIP and Gln3-VIP were partial agonists, as the maximal adenylate cyclase stimulation by these analogues reached only 50% of the value obtained with VIP.

Figure 1.

Figure 1

Open in a new tab

Binding to and adenylate cyclase stimulation through human VPAC2 receptors. VIP (closed circles), C6-VIP (open circles), Asn3-VIP (open squares), Gln3-VIP (open triangles), Glu3-VIP (open diamonds) and Ro 25-1553 (inverted triangles) competition curves (top panel) and dose-effect curves (bottom panel) were obtained on membranes from cloned CHO cells expressing human VPAC2 receptors (mean±s.e.mean of four experiments in duplicate).

Table 1.

Peptide concentrations necessary to activate the adenylate cyclase activity (EC50) or inhibit tracer binding (IC50) at membranes from CHO cells expressing the wild-type or mutated VPAC2 receptors

graphic file with name 133-0704195t1.jpg

Open in a new tab

Analysis of the mutated R172Q, R172L, K179Q and K179I VPAC2 receptors

Mutations were performed on residues located in the second transmembrane helix. The CHO cells expressing the mutated receptors were selected by screening geneticin resistant clones for the ability of 10 μM VIP or 10 μM of C6-VIP to increase adenylate cyclase activity. We then attempted to measure [125I]-VIP, or [125I]-Ro 25-1553 binding, and performed dose-effects curves of adenylate cyclase in presence of VIP and the various analogues.

Tracer binding is directly proportional to its affinity constant. At a receptor concentration of 1000 fmol mg protein−1, using 50 μg protein per assay, the predicted specific binding varies between 0.5 and 0.05% of the added radioactivity if the tracer KD value varies between 100 and 1000 nM. Radiolabelled peptides bind non-specifically to CHO cell membranes: non-specific binding represented up to 8% of the added tracer at this protein concentration. The tracer binding increment due to specific recognition of receptors was, therefore, non-significant when the receptors' affinity for the radiolabelled peptide was too low. This probably explains why we were unable to demonstrate significant specific binding of [125I]-VIP or [125I]-Ro 25-1553 to the mutated receptors. We therefore attempted to identify another high affinity ligand to allow binding studies at the mutated receptors.

VIP, Ro 25-1553 and Glu3-VIP had very high EC50 values at the R172Q and R172L mutants (Figure 2, Table 1). C6-VIP, Asn3-VIP and Gln3-VIP had a lower EC50 values and stimulated more efficiently adenylate cyclase activity. Based on these data, we attempted to use [125I]-Gln3-VIP and [125I]-C6-VIP in binding studies. Binding of both tracers was sufficient to analyse competition curves at the R172Q mutant: the receptor concentration was 400±90 fmol mg protein−1. Competition curves are shown in Figure 3, and the IC50 values in Table 1.

Figure 2.

Figure 2

Open in a new tab

Adenylate cyclase stimulation through R172L and R172Q VPAC2 receptors. VIP (closed circles), C6-VIP (open circles), Asn3-VIP (open squares), Gln3-VIP (open triangles), Glu3-VIP (open diamonds) and Ro 25-1553 (inverted triangles) dose-effect curves were obtained on membranes from cloned CHO cells expressing human R172L (top panel) and R172Q (bottom panel) VPAC2 receptors (mean±s.e.mean of 2–4 experiments in duplicate).

Figure 3.

Figure 3

Open in a new tab

Binding to R172Q VPAC2 receptors. VIP (closed circles), C6-VIP (open circles), Asn3-VIP (open squares), Gln3-VIP (open triangles) and Glu3-VIP (open diamonds) competition curves were obtained at R172Q VPAC2 receptors using [125I]-Gln3-VIP (top panel) or [125I]-C6-VIP (bottom panel) (mean±s.e.mean of 2–4 experiments in duplicate).

[125I]-Gln3-VIP binding to the R172L VPAC2 receptors was detectable, but too low to allow competition curves analysis, as non-specific binding represented >50% of the total tracer binding. Assuming that the [125I]-Gln3-VIP KD value was close to its EC50 value, the R172L VPAC2 receptor concentration was estimated between 250 and 1000 fmol mg protein−1.

The EC50 values of all analogues tested on the K179Q mutant receptor were in the μM range. C6-VIP had the lowest EC50 value, and was also the most efficient analogue – giving much higher maximal stimulation than VIP itself (Figure 4 and Table 1). On the K179I VPAC2 mutant, C6-VIP was the only peptide able to significantly stimulate the adenylate cyclase activity (Figure 4 and Table 1). We were unable to observe significant specific binding of either [125I]-C6-VIP or [125I]-Gln3-VIP to membranes from CHO cells expressing the K179Q or K179I VPAC2 receptor mutants.

Figure 4.

Figure 4

Open in a new tab

Adenylate cyclase stimulation through K179I and K179Q VPAC2 receptors. VIP (closed circles), C6-VIP (open circles), Asn3-VIP (open squares), Gln3-VIP (open triangles), Glu3-VIP (open diamonds) and Ro 25-1553 (inverted triangles) dose-effect curves were obtained on membranes from cloned CHO cells expressing human K179I (top panel) or K179Q (bottom panel) VPAC2 receptors (mean±s.e.mean of 2–4 experiments in duplicate).

Discussion

Most members of the secretin-receptor family share two basic residues in the second transmembrane domain (TM2) or at the beginning of the first extracellular loop (EC1) region: an arginine or lysine residue (R172 in the VPAC2 receptor) is found in the second transmembrane helix of all but calcitonin receptors and with the exception of the glucagon, GRF and Corticotrophin Releasing Factor (CRF) receptors, all the receptors from the secretin-receptor family (Horn et al., 1998) have a second basic residue (lysine, arginine or histidine) (K179 in the VPAC2 receptor) close to or inside EC1. As shown in this work, mutation of either residues in the VPAC2 receptor resulted in marked alterations of the receptors' pharmacological properties. Receptor mutations that affect their binding or functional properties can be subdivided into three (non-exclusive) categories: (1) mutations that affect ligand recognition, (2) mutations that affect the receptors' biological activity (for instance by preventing G protein recognition), and (3) mutations that affect the isomerization constant between receptor conformations (Colquhoun, 1998; Galzi et al., 1996). If the receptor activation is described by Inline graphic in the absence of agonist and by Inline graphic in the presence of agonist (where K represents the agonists' affinity constant for the resting receptor, Kact, the receptor constitutive activation constant and α, the effect of agonist recognition on receptor activation), it is possible to define three important parameters: K, the agonists' ability to recognize the receptor, α, that measures the agonist ability to activate the receptor, and Kact, the activated receptor's stability. The agonist affinity constant ([HR+HR*]/[H(R+R*)]) is defined as: K(1+αKact), and its' efficacy (HR*/(HR+HR*) as αKact/(1+αKact). Mutations that affect the agonist binding site and modify K affects the agonists' affinities, but not their relative efficacies. If the αKact product is not too large, receptor mutations that affect Kact, like agonist modifications that affect α, affect simultaneously the agonists affinities and efficacies. If the activated receptor stability (Kact) is sufficient, all compounds characterized by large α values (sufficient to achieve αKact>10) behave as full agonists (activate >90% of the occupied receptors) – independently of the actual values of α, Kact, or of the receptor density. Receptor mutations that destabilize the active receptor conformation (decrease Kact) decrease the affinity of all agonists, but affect their efficacy only if the agonist α value is not sufficient to compensate the decreased receptor Kact (Colquhoun, 1998). As discussed below, our results suggested that R172 facilitates VIP recognition (increases K) by forming an ionic bond with the ligand Asp3 residue, and that both basic residues stabilize the activated receptor conformation (increase Kact).

The VIP Asp3 residue was important for high affinity binding and activation of the VPAC2 receptors: replacement by glutamic acid reduced 10 fold the VIP affinity, and replacement by the uncharged asparagine or glutamine residues reduced the peptide affinity 300 and 100 fold, respectively. Glu3-VIP behaved as a full agonist (adenylate cyclase activation), but Asn3-VIP and Gln3-VIP were partial agonists: as in the VPAC1 (Hoare et al., 1999; Nicole et al., 2000) and secretin receptor (di paolo et al., 1999; Vilardaga et al., 1996), replacement of the VIP Asp3 residue decreased the agonist ‘α' value. The following results suggested that the VIP Asp3 interacted with the VPAC2 receptor R172. Mutation of this residue to hydrophobic (L) or polar uncharged (Q) residues markedly reduced the VPAC2 receptor's affinity for its natural ligand. The mutated VPAC2 receptors did not discriminate VIP from Glu3-VIP, but recognized Asn3-VIP and Gln3-VIP with a higher affinity than the wild-type receptor. The observation that Gln3-VIP and Asn3-VIP were more efficient than VIP at the mutated receptors suggested that the VIP aspartate and receptor arginine residue must be brought into close contact to allow receptor activation. Indeed, dehydration of ionic residues is a very unfavourable process: it is compensated for in the wild-type agonist-receptor complex by the interaction between the two opposite charges. We previously demonstrated that VIP acylation by hexanoic acid increased its affinity (but not its efficacy) at VPAC2 receptors, in binding and functional studies (Juarranz et al., 1999). The ability of the Asn3-VIP-bound R172Q-VPAC2 receptor to activate adenylate cyclase was normal (compared to VIP-bound VPAC2 receptors), but VIP behaved as a partial agonist at the mutated receptors, when compared to either C6-VIP or Asn3-VIP: the α value of C6-VIP and Asn3-VIP were larger than VIP's at the mutated receptor. Our results thus suggested that, like in the VPAC1 receptor, the VPAC2 receptor R172 and the VIP Asp3 must be buried in close contact in the agonist-receptor complex for optimal receptor activation, and that hexanoylation of the VIP α-amino residue increased the value of α.

We were unable to measure the K179I and K179Q receptor densities. This means that we could not verify that the ability of agonist-bound mutant VPAC2 receptor mutants to activate adenylate cyclase was normal, and that the agonist EC50 values were not underestimated due to the presence of spare receptors. Mutation of the basic residue K179 to hydrophobic (I) or uncharged (Q) residues increased at least 400 fold the VIP EC50 value, suggesting that its' affinity was markedly decreased. We were unable to identify the VIP amino acid (if any) that contact this lysine residue: all the VIP analogues we tested had greater EC50 values at the mutated VPAC2 receptor as compared to wild-type receptors. C6-VIP had a higher affinity and efficacy than VIP at the four mutated VPAC2 receptors: it is likely that this compound had a greater ability than VIP to stabilize the active receptor conformation (greater ‘α' value), and therefore compensated more efficiently the deleterious effect of the receptor mutations on the stability of the active VPAC2 receptor conformation (Kact).

Taken together, our results supported the hypothesis that the conserved arginine residue interacted with the VIP Asp3 residue, and that the arginine and lysine residues were important to stabilize the active receptor conformation.

Acknowledgments

Supported by F.R.S.M. grants no3.4507.98 and 3.4504.99, by an ‘Action de Recherche Concertée' from the Communauté Française de Belgique, by an ‘Interuniversity Poles of Attraction Program - Belgian state, Prime Minister's Office, Federal Office for Scientific, Technical and Cultural Affairs' and by a grant from the European Community (PAVE project). R.M. Solano was a recipient of a post-doctoral Fellowship from the F.R.S.M. (Belgium).

Abbreviations

C6-VIP

[hexanoyl-His1]-VIP

CHO

Chinese hamster ovary cells

EC1

first extracellular loops

EC50

concentration of agonist required for half maximal response

GRF

Growth Hormone Releasing Factor

IC

intracellular domain

IC50

concentration of ligand required for 50% inhibition of tracer binding

PCR

polymerase chain reaction

Ro 25-1553

Acetyl-His1 [E8, K12, Nle17, A19, D25, L26, K27, K28, G29, G30, T31] cyclo 21-25 VIP (2-24)

TM2

second transmembrane domain

VIP

vasoactive intestinal polypeptide

References

  1. CHRISTOPHE J. Type I receptors for PACAP (a neuropeptide even more important than VIP. Biochim. Biophys. Acta. 1993;1154:183–199. doi: 10.1016/0304-4157(93)90011-c. [DOI] [PubMed] [Google Scholar]
  2. COLQUHOUN D. Binding, gating, affinity and efficacy: the interpretation of structure-activity relationships for agonists and of the effects of mutating receptors. Br. J. Pharmacol. 1998;125:924–947. doi: 10.1038/sj.bjp.0702164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. DI PAOLO E., VILARDAGA J.P., PETRY H., MOGUILEVSKY N., BOLLEN A., ROBBERECHT P., WAELBROECK M. Role of charged amino acids conserved in the vasoactive intestinal polypeptide/secretin family of receptors on the secretin receptor functionality. Peptides. 1999;20:1187–1193. doi: 10.1016/s0196-9781(99)00122-9. [DOI] [PubMed] [Google Scholar]
  4. GALZI J.L., EDELSTEIN S.J., CHANGEUX J. The multiple phenotypes of allosteric receptor mutants. Proc. Natl. Acad. Sci. U.S.A. 1996;93:1853–1858. doi: 10.1073/pnas.93.5.1853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. GOURLET P., RATHE J., DE NEEF P., CNUDDE J., VANDERMEERS-PIRET M.C., WAELBROECK M., ROBBERECHT P. Interaction of lipophilic VIP derivatives with recombinant VIP1/PACAP and VIP2/PACAP receptors. Eur. J. Pharmacol. 1998;354:105–111. doi: 10.1016/s0014-2999(98)00435-x. [DOI] [PubMed] [Google Scholar]
  6. GOURLET P., VERTONGEN P., VANDERMEERS A., VANDERMEERS-PIRET M.C., RATHE J., DE NEEF P., WAELBROECK M., ROBBERECHT P. The long-acting vasoactive intestinal polypeptide agonist RO 25-1553 is highly selective of the VIP2 receptor subclass. Peptides. 1997;18:403–408. doi: 10.1016/s0196-9781(96)00322-1. [DOI] [PubMed] [Google Scholar]
  7. HARMAR A.J., ARIMURA A., GOZES I., JOURNOT L., LABURTHE M., PISEGNA J.R., RAWLINGS S.R., ROBBERECHT P., SAID S.I., SREEDHARAN S.P., WANK S.A., WASCHEK J.A. International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol. Rev. 1998;50:265–270. [PMC free article] [PubMed] [Google Scholar]
  8. HOARE S.R., DE VRIES G., USDIN T.B. Measurement of agonist and antagonist ligand-binding parameters at the human parathyroid hormone type 1 receptor: evaluation of receptor states and modulation by guanine nucleotide. J. Pharmacol. Exp. Ther. 1999;289:1323–1333. [PubMed] [Google Scholar]
  9. HORN F., WEARE J., BEUKERS M.W., HÖRSCH S., BAIROCH A., EDVARDSEN Ø., CAMPAGNE F., VRIEND G. GPCRDB: an information system for G protein-coupled receptors. Nucleic Acids Res. 1998;26:277–281. doi: 10.1093/nar/26.1.275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. JUARRANZ M.G., VAN RAMPELBERGH J., GOURLET P., DE NEEF P., CNUDDE J., ROBBERECHT P., WAELBROECK M. Different vasoactive intestinal polypeptide receptor domains are involved in the selective recognition of two VPAC2-selective ligands. Mol. Pharmacol. 1999;56:1280–1287. doi: 10.1124/mol.56.6.1280. [DOI] [PubMed] [Google Scholar]
  11. NICOLE P., DU K., COUVINEAU A., LABURTHE M. Site-directed mutagenesis of human VIP1 versus VIP2 receptors. Ann. N.Y. Acad. Sci. 1998;865:378–381. doi: 10.1111/j.1749-6632.1998.tb11199.x. [DOI] [PubMed] [Google Scholar]
  12. NICOLE P., LINS L., ROUYER-FESSARD C., DROUOT C., FULCRAND P., THOMAS A., COUVINEAU A., MARTINEZ J., BRASSEUR R., LABURTHE M. Identification of key residues for interaction of vasoactive intestinal peptide with human VPAC1 and VPAC2 receptors and development of a highly selective VPAC1 receptor agonist. Alanine scanning and molecular modeling of the peptide. J. Biol. Chem. 2000;275:24003–24012. doi: 10.1074/jbc.M002325200. [DOI] [PubMed] [Google Scholar]
  13. O'DONNELL M., GARIPPA R.J., RINALDI N., SELIG W.M., TOCKER J.E., TANNU S.A., WASSERMAN M.A., WELTON A., BOLIN D.R. Ro 25-1553: a novel, long-acting vasoactive intestinal peptide agonist. Part II: Effect on in vitro and in vivo models of pulmonary anaphylaxis. J. Pharmacol. Exp. Ther. 1994;270:1289–1294. [PubMed] [Google Scholar]
  14. RAWLINGS S.R., HEZAREH M. Pituitary adenylate cyclase-activating polypeptide (PACAP) and PACAP/vasoactive intestinal polypeptide receptors: actions on the anterior pituitary gland. Endocr. Rev. 1996;17:4–29. doi: 10.1210/edrv-17-1-4. [DOI] [PubMed] [Google Scholar]
  15. SALOMON Y., LONDOS C., RODBELL M. A highly sensitive adenylate cyclase assay. Anal. Biochem. 1974;58:541–548. doi: 10.1016/0003-2697(74)90222-x. [DOI] [PubMed] [Google Scholar]
  16. SAMBROOK J., FRITSCH E.F., MANIATIS T. Molecular Cloning: A Laboratory Manual. 1989New York: Cold Spring Harbor Laboratory Press; ed. Ford, N., Nolan, C. & Ferguson, M [Google Scholar]
  17. SOLANO R.M., LANGER I., PERRET J., VERTONGEN P., JUARRANZ M.G., ROBBERECHT P., WAELBROECK M. Two Basic Residues of the h-VPAC1 Receptor Second Transmembrane Helix are Essential for Ligand Binding and Signal Transduction. J. Biol. Chem. 2001;276:1084–1088. doi: 10.1074/jbc.M007696200. [DOI] [PubMed] [Google Scholar]
  18. SVOBODA M., TASTENOY M., VAN RAMPELBERGH J., GOOSSENS J.F., DE NEEF P., WAELBROECK M., ROBBERECHT P. Molecular cloning and functional characterization of a human VIP receptor from SUP-T1 lymphoblasts. Biochem. Biophys. Res. Commun. 1994;205:1617–1624. doi: 10.1006/bbrc.1994.2852. [DOI] [PubMed] [Google Scholar]
  19. VAUDRY D., GONZALEZ B.J., BASILLE M., YON L., FOURNIER A., VAUDRY H. Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol. Rev. 2000;52:269–324. [PubMed] [Google Scholar]
  20. VILARDAGA J.P., DI PAOLO E., DE NEEF P., WAELBROECK M., BOLLEN A., ROBBERECHT P. Lysine 173 residue within the first exoloop of rat secretin receptor is involved in carboxylate moiety recognition of Asp 3 in secretin. Biochem. Biophys. Res. Commun. 1996;218:842–846. doi: 10.1006/bbrc.1996.0150. [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES